CA1240940A - A-factor and its processing signals - Google Patents

Abstract

a-FACTOR AND ITS PROCESSING SIGNALS
ABSTRACT OF THE DISCLOSURE

Novel DNA constructs are provided for efficient expression of polypeptides by yeasts. The constructs employ yeast a-factor secretion leader and processing signals joined to a DNA sequence encoding a polypeptide of interest in reading frame with the a-factor signals. The constructions provide for the expression, secretion and maturation of the desired polypeptide. A strategy is provided for the isolation of the a-factor secretion leader and processing signals and the joining, by means of a relatively short adaptor, molecules of the DNA sequence encoding the polypeptide to the processing signals in proper reading frame.
The bacterial cell strain E. coli HB101 (pAB163) was deposited at the A.T.C.C. on April 20, 1983 and given Accession No. 39342.

Description

9~

a-FACTO~ AND ITS PROCESSING SI~NALS

The initial stages of the biological revolution demon~trated the feasibility of obtaining expression of ~ammalian genes in lower organisms.
Because of the much greater amount of ~nowledge associ-ated with the regulatory sequences of bacteria, bacteria were chosen as ~he initial host for producing heter- i ologous proteins. However, bacteria have many 6hortcomings. Nst least of these shortcomings is the fact ~ha~ they produce an en~ero~oxin which must be completely xemoved, if the product is to be admini~tered to a mammalian recipient, e.g. as a pharmaceutical agent.
Furthermore, the codons of the hPt~rologous genes will b~ expres~ed with relatively low efficiency, since the preferred codons of the source of the heter-ologous protein and the host will be substantially ~ifferent. In additionl where the product of interest needs to be processed, ~uch as glycosylated, matured by r~moval of polypeptide ~equences, or assembled, bacteria frequently prove to be incapable or inef~icient at these processes. ~or~over, for commerical applica~ion of genetic engineering t~chnology it would b~ desirable for ease of ~ubsequent purification if ~ynthesized product~ were ~ecreted into the growth medium, a proces8 in bacteria of only limited, laboratory s~ale use. It is therefore desirable to find alternative hosts.
Yeast as a host has many advantages which recommend it~ use. The c~merical fermen$ation of yeast is well established. Yeast is a eukaryote unlike bacteria, so that it ~hares greater similarities with mammalian organisms. Y~a~ts are thus capable of many of the processing Bt2pX observed i~ higher organisms i and secretion of several na-tural polypeptides and proteins is known. Furthermore, yeasts do not produce enterotoxins.
It is therefore desirable to provide yeast regu-latory signals which may be employed or the efficient pro-duction of heterologous proteins in yeast. While theexistence of the regulatory signals may be predicted, their isolation, manipulation, and ultimately establishing that the regulatory signals can operate with alien flanking ~egions in conjunction with a foreign DNA sequence is long and arduous work, requiring well thought out experimental design, careful manipulation, and rigorous proof~ of having achieved the intended result at each of the many stages involved.
Betz and Duntze, Eur. J. Biochem. (1979) 95:469 report the initial isolation and preliminary charac-terization of mature a-factor peptide and Betz, Manney and Duntze, Gamete Res. (1981) 4:571-584 propose an amino acid sequence for the mature a-factor peptide. Kurjan and ~erskowitz, Cell (1982) 30:933-943 describe a putative ~-factor precursor, describe the sequence and postulate a proce~sing mechanism. U.S. Patent Nos. 4,336,326 and 4,338,397 describe sequences encoding for leaders in pro-karyotes. Julius et al., Cell (1983) 32:839-852 describe the role of a rnembrane dipeptidase in the processing of

2~ ~-factor. See also Canadian patent application Serial No.
441,501, Eiled November 18l l983, which describes the use o~ the ~Eactor leader and processing signals for expression of a heterologous polypeptide.
Yeast a-factor in combination with its regulatory signals is detected, isolatedt and manipulated to provide for joining to a DN~ sequence encoding a polypeptide of interest. The resulting construct 9~

provides ~or expres~ion and maturation of the poly-pep~ide wi~h ~ecretion of the polyp~ptide into ~he nutrient medium. An experimental design is provided for the manipulation of the yeast a-~actor gene to provide for joining vf a DNA coding sequence by means ~f small adaptor molecules to the yeast a-factor leader and processing ~ignals in proper reading frame, In the drawings:
Figure 1 is a diayram of the plasmid pAB161.
In accordance with the subject invPntion~
eukaryotic hosts, particularly yeasts, are employ~d for the production of secreted, usually mature or maturable, polypeptides, where such polypeptides may ~e harvested from a nutrient medium. The polypeptides are produced by employing a DNA construct encoding for yeast a-factox secretion leader and processing signals joined in proper reading frame to a DNA sequence encoding for a polypeptide of interest. The resulting construct encode5 for a pro-polypeptide, which will contain the ~ignals for secretion of the pro-polypeptide and processing of the polypeptide, either intra- or extra-cellularly, desirably to the mature polypeptide. Where the pro-polypeptide is incompletely processed, appro-priate peptidases/ particularly membrane peptidases,may be employed for completing the maturation of the pro-polypeptide. This invention contemplates the production of secreted pro-polypeptide, partially processed pro polypeptide and mature polypeptide and mixtures thexeof.
Constructs of the subject invention will have the following formula defining a pro-polypeptide:

((PS~ - (a-factor~n - PS - gene wherein:

PS indicates yeast-recognizable processing signals for cleavage and removal of amino ac.ids, the processing signals including at least two basic amino acids, which basic ami.no ac.ids are lysine ancl arginine;
a-factor intends the DNA sequence encoding for at least a porkion of the mature a-factor; usually the entire a-factor;
n is O or l; ~nd "gene" int~nds a DN~ sequence other than lf~ a actor having an open reading frame encoding for a -polypeptide of interest~ wh.ich .is joined at -the termi.nal base of the immediately preceding PS ~the pxocessing signal) in proper reading frame. For the purposes of this invention "gene" encompasses fused proteins, whe:re 1.~ a structural gene may be inserted into another struc tural gene in pxoper reading :f.rame, portions or eomplete stru~-tural genes joined kogether o~ arb.it~rary syn~.het.ir se~uenceC hav.ing ~o known natural analog.
:For the most part, the ~NA constr~lcts of t.he subje~t inverlti.on will have~ at least the fol1.owing formul~:

L - ~PS - ta-factor))n ~ :PS - gene wherein.
L intends the yeast a-factor secretory leader sequence, or similar se~llence providing for secretion;
and al.l t.ne othe:r symbols have been defined previously.
PS will Eor the mos~ part have the following formula.
B - D - ~ ~ H
wherein:
B and D ~re the ~ame or dif~rent 9 and defin~
the codons for the basic amino acid.s lysine and arginine, preferably being ~G; and ~L2~L1139~

F and ~ are the ~ame or different and define the codons for the acidic amino acids, aspartic or glutamic ~cid or the amides thereof, asparagine or glutamine, pxeferably being a combination of acid and amide, more preferably, F being GAC and H being AAC
The prefer.red DNA sequence is the naturally occurring DNA sequence encoding for lys~lys~asp-asn.
Alternatively~ PS may have the formu.la:

.lO ((B-D)5 ~ ~F~ (B-D) wherein:
s and v are 1-3; and t and u are 0-3 J5 Thusl the processing signal may be varied by elimination of the acid amino acids and their amides or increasing the number of basic amino acids or provi~ing for multiple dipeptides or tetrapeptides having the acid amino acid and the amide of the acid amino acid as repetitive dipep-tide sequences or having the two basic amino ac.ids in addition. However, ~or the most part, these additional amino acids will add a further compli--cation to the organization of the construct~ and therefore normally will not be used.
r~ The secretion leadex sequencP of y2ast a-factor is relatively short, ~eing about 15 to 20 amino acids, more particularly, about 17 amino acids.
The leader sequence has a methionine at its N-terminus.
In order for the polypeptide of interest to

3~ be expressed; Lt will be necessary to prepare a con~
~truct which will have a competent replication system and transcriptional regulatory signals for use in yeastO However~ to the extenk that the secretlon and processing signals will be recogn.ized by hosts other than yeast, replication systems for such other hosts may be employed. Usually the construct will include other function~l DNA. sequences as well, where the ~L2~

function may have been employed durlng the construction of the construct or may serve a useful function during the expression of the polypeptide.
Constructs can be prepared which are provided with the necessary transcriptional regulat~ry signals.
That is r such constructs will include a RNA polymerase binding site, whi~h may .have contiguous or non-contiguous ~equences r which binding site snay ~e t~e wild type for a~.factor or may be the RNA polymerase binding site for a variety of other yeast genes, such as the promoters concerned with enz~nes invo.l.ved i.n the glycolytic pathway, such as phosphoglucokinase, glyceraldehyde-3-phosphate dehydroyenase, pyru~Jate kinase, phosphogluco.i.somerase, triosephosphate isomerase, :~5 alcohol dehydrogenase, 4tc. r or with metalloth.ionein, v.iral promoters, or the like Reference to these promoters may be found in Hikzeman et a~., J. Blol ChemO (1980) 255:12073~12080.
In addition to the p.rornoters, va-Llou.
~o sequences regulatin~ the promotfxs may also be emplc~yed~
such as enhancer.s and VNA b.inding sites for represso.rs 7 derepressors, activators, and the l.ike a Other DNA
sequences which may be involved include ribosomal binding sites, cap sequence, stop codons, transcrip-r~L~ tional terminator, etc. One or more of these sequencesmay be present as part of the construct or may be available as a part of a replication system which ma~
serve as a vector. Usually~ the .repllcation system will be assoc.iated with other ~uncti.ons to be descxibed 3~ subsequently.
The yeast a-factor promoter and leader region may be joined to a yea~t replication system, e.g~ ~m plasmid and/or ARS1 ~ CEN3 to provid~ an expression vector having one or more convenient restrict1orl sitPs.
3~ This expression vector may be ormll1ated as ~o1~ows P~L--(PS (a~factor))n IPS lgene)r)W ¦RepS¦q~

~LZ~94~

or more pa-,ckicularly a5 ~ollows ~RS-P-~cap)~-(RBS) ic~LI~3PS~(a-:f~ctor)) PS-gene~sc-T-¦RepS~q wherein~
PS and gene have been ~efined pxeviously;
RS in~ends regulatory signals which may be on either side vf R and includes enhancers and DNA binding ~ites for repressors, derepressors and activato,rs, P is an RNA polymerase binding s:Lte or promoter, partioularly the a-factor wild~type p.romotex, cap .is a capping sequence;
ic is the f-met initiation codoll, which is ~,! part vf the secretion leader sequence;
~ ' is a DNA sequence which with ic defines the amino acid sequence of the a-factor leader ox similar se~uence provic]ing for sec.ret,ion;
sc .intends orle or rnore stop codons;
~f.l T intendc; a tran~cxiptional ~erminator;
¦RepS¦ intends a replicat:ion system wh.ich may be at any pos,Ltion .in t:he vector external to i:he ilmnediate express.i.on reg.ion of t.he cons~ruct~ gener~ f an episomal or viral repli.cation system having othe.r than the wild--type flanking regi4ns;
m, n and p and r are O or 1, q is at least ~ and may be 2 or more~ usually 1 ~o 2;
w .is O or a small integer, generally 3 ox ,3~ less, with at least one of n or w being 1;
wherein the cvnstruct may be linear or circular and except for ¦RepS¦ the various sequences are in the order indicated with the promoter d,irected toward the gene.
The leader secretion sequence 5wi.11 for the most part encode for the follos~ing polypept.ide sequence:

met-gln-pro-ser~thr-ala thr-ala~la~
pro-lys-glu-lys~thr-ser-ser-glu The processing signal sequence will for the most part encode or a polype~tide cequence o~ the follQwing formula:

asp asp lys lys asn asn arg arg glu glu gln gln wherP any amino acid in a column may be employed. 0~
particular interest is the DNA sequence ~unless other-wise indicated, sequences will read in the 5~3' direction):
AAG ~AG ~AC AAC
encoding for the :natural processiny signal havirly the following amino acid sequence:
lys ly~s asp asn.
The clon:ing and expression constructs wil.l ~enerally be ~rom about 5 to 50kbp ~kilobase paixs), where plasmi.ds will generally ranye from about S to 25kbp. Where viral vectors are used, packaging requirements may .result in ~onstructs of up to about SOkbp One strategy Eor developing the constructs of this invention is as follows: The DNA sequence encoding for the pro-a-factor can be obtained from the yeast genome by any convenient means, e.g detection by hybridization with labeled probes. Where the fragmPn~
is greater than about lOOObpg the fragment may be reducec~ by appropriate cleavage at available restriction sites~ Conveniently, within the a-Eactor gene near the 3f C-terminus o the mature p~ptide is an AvaII restriction .. ,~
site and the AvaII restricted Eragment may be resected~
80 as to have the terminus of the fragment at a conve~
nient site upstream from and proximal to the ~irst base ~2~

of the a-factor coding sequence, Preferably t the terminus is in the process:ing signal sequence, more preferably 29 bases upstream from the AvaII cleavage site. This fragment may then he ligat~d to linkers 5 having a Elush end an~ a cohesive end, where the linker encodes, by itself or in combination with the terminal bases of the fragment, fox an endonuclease recognition site. Particularly, if one resects 29 bases ~o that the three 3'-terminal bases of the fragment ar~ 5' AGG, by adding a linker having 5'~CCT, a StuI ~5'~AGGCCT-3') site is created, so that one can screen for the desired fragment. In the illustrative example, after addition of the linker and any other appropriate manipulation, e~g. endonuclease digestion, plasmids may then he 1~ screened for the StuI site which wa~ created by the linker containing the 5'~sequence CCT which was joined to the 31-terminal ~GG to define the StuI site. The plasmids may additionally be pre-screened, if desired, using a radiolabeled oligollucleotide probe complemerl~:ary ~n to the desired junction sequence.
A linker is ernployed which encodes a recognition site for an endonuclease which cleaves away from the recognition site. Furthermore, the asy~ne try of the recognition ~ite ~irects the cleavage upstream, ~S generally about three to fifteen bases upstream frorn the recognition sequence. In the present exa~nple~ the recognition site is a ~1 site. The presence of the StuI site ensures that the ~X cleavage ~ite is in the a-factor secretion leader sequence. With the ~ar 3P cleavage in the a-fac-tor leader region of the gene J the overhan~ DNA sPquence is not a recognition sequence Eor an endonuclease which would be ~mployed in further construction.
The a factor Leader Eragment now contains --~:, both StuI and ~ recognition and restriction sites either of which may be used for further manipulati-on~

By appropriate selection of reskriction enzymes and adapkors, one can provide for linking the leader sequence to a gene through the processing signals, where the gene is in reading phase with the S leader sequence, to provide a DNA fragment encoding for the pro-polypeptide. By providing for convenient restriction sites outside of the codiny region for the ~oined leader and gene DNA sequence, one may clone the codlng ragment for the pro-polypep-tide and 1~ transcriptional regulatory signals~ if present, in a cloning vehicle and then excise the coding fragment from the cloning vehicle and, as appropriate, insert the fragment into an expr~ssion vector in appropriate juxtaposition to the transcriptional regulatory signals.
1~ Preferably, and as will be described subsequently, one employs restriction sites~ where the transcriptional regulatory signals of the a~factor are retained so that the construct which is inserted into the expressior vector does not require the presence of a promoter, ~() although tandem promoters ar~ permissible.
The a-factor leader and processing signals and the strategy descri.bed above can be used for the expression of any polypeptide of interest, either derived from yeast or hetexologous to yeask. For the 2~ most part, the polypeptides of interest will be naturally occurring polypeptides from other than yeask, particularly mammals, more particularly primates, and most Erequently domestic animals or human. Xn addition, synthetic polypeptides may also be of interesk.
The construct provides a portable sequence for insertion into vectors where the construct may be joined to include the gene of interest for expression.
The resulting replication conskruct provides a conve~
nient replication system with transcriptional signals 3~j as well as aecretorv and processing signals and having a restriction site which ~y the use vf adaptors allows for insertion of a gene encoding a polypeptide of ~z~

interest in reading frame with the secretory and processing signals. Thus one can obtain expression of such gene in a host recognizing the yeast secretoxy siynals ~o produce a secxeted processed pro-polypeptide.
.~ The final construct will be an episomal element capable ~f stable maintenance in a host, particularly a fungal host such as yeast The construct includes one o.r more replication systems, dPsirably two replication systems~ wh.ich individual replication 1~ systems may be a single. sequenre or non-contiguous plural sequenGes, allowing fvx both maintenance in the expression host, parti.cularly yeast, and cloning in a prokaryote. In addition J one or more selection markers may be i.ncluded, which will allow for select:i~e pressu:re for rrlaintenance of the episomal ~lement in either or ~oth of the hosts. ~urthermore, the episomal element may be mai.ntained at high or low copy ~umber, the copy number general.l.y ranging ~rom about 1 to 200, more usually ~rom ahout :l to .L00y With hi.gh cop~ number 7.0 epi~omal elementsl Ihe number of copies wlll generally be at least 10, usually at :Least 20, and usually not exceeding about 150~ more usually not exceeding aboul:
100 copy number.
Depending upon the. particular polypeptide of 2~, interest, either high or low copy numbers may be desirable, taking into consi.deration the ~ffect of the polypeptide product on the host and the effi~iency of secretion Where the presence. of the expression product of the genP may ha-ve a del~terious ef~ect on 30 ~he viability of the host, a lo~ copy number ~nay be in~icated.
Various ho~ts, particular~y yeast hosts, may be employed, particula.rly mutants having desirecl properties, either lesions allo~wing fox complementation, 3~; mutants lackiny or having specific regulatory systems, sr the like. It should be appreciated that depend.ing llpon the r~te of produc~:ion of the expression produ~t of the oonstru~t, the processing enzyme may or may not be adequate for processing at ~hat level of product.ion~
Therefore, a mutant having ~nhanced production o:f the processing enz~ne~s) may be indicated or enhanced production of the enzyme(s) may be pxovided by means of an episomal element~ Generally, the production of the enz~ne should be of a lower order than the production of the desired expression product.
AltPrnatively, there may be sj.tuations where lQ intrace:llular processing i5 not desired. In this situat:ion, mutants would be desirable which lack the processing enz~nes in their membrane or have relativel.y inefficient processing. In this situat-ion/ the product can be subsequently processed in vltro.
L5 Furthermore, the structural gene may be present as a repeating unit .in tandern, with intervenin~
processiny s.ignals. The pIodu.ct may -then be processed in whole or in paxt, w.ith the result that one wi.ll obta.in the various polylam:Jno acid) sequences eithe) ~o .individ~laLly or .in tand2m fo.r subsequent prooessing.
In many situations, :it may be desirable to ~rovi~e for di:~ferent tandem sequences, where each of the sequences is a subunit o:~ a particular p.rotein produc~O In sorne s.ituations it may be desirable to elirnina~e ~he~ proces--~5 sing signals intervening between ad~acent tandemheterologous structural genes so as to prvvide for the product.ion of a multifunctional fusion product.
The structural. gene may encode for any type of polypeptide of interest. The polyp*ptide ma~ be as small as an oligopeptide of eight aminv acids or may be 100,000 daltons or higherO Usually, single oha.ins will be less than about 300,000 daltons) more usually less than about 150,000 daltons~ Of particular interest are polypeptides of from abollt 5~000 to 150,000 daltons~
~S more particularly of about ~,000 to :L00,000 daltons.
Illustrative polypeptides of intere~t include hormones and factors~ suçh as growth hormone, somatomedills ~z~o~o ~pidermal growth ~actor, etc.; the endocrine secretions~
such as luteinizing hormone, thyroid stimula-ting hormone, relaxin, secretin, oxytocin, insulin, vasopressin, renin, calcitonin/ follicle stimulating hormone, prolactin, etc., hematopoietic factors, e.g.
erythropoietin, colony stimulating factor, etc.;
lymphokines, ~.g. interleukin~2; globins, globulins~
eOg. imrnunoglobulins, albumins; interferons, such as a, ~ and r; regulatory protein.s and repressors; enzymes 10 and struc-tural proteins; endorphins, e.g. ~-endorphin, enkephalin, dynorphin, mammalian pathogen proteins, e.g. HBsAg, capsid proteins, etc.
~ aving prepared the episomal elements containing the constructs of this invention, one may 15 then .introduce such element into an appropriate host.
The manner of introduction is conventional, there being a wide variety of ways to introduce DNA into a host.
Conveniently, ~pheroplasts a.re prepared ernploying ~he procedure of, for example, Hinnen et al., PNAS USA
2() (1978) 75:l9:19-1933 or Stinchcomb et a1., EP O 045 573 The ~ransformanl:s may then be grown in an appropriate nutrient medium and where appropriate~ selective pressure maintained on the transformants. Where expression is inducible r one can allow for growth of the yeast to high density and then induce expression.
In those situations where although secreted, a substan~
tial proportion of the product may bP retained in the periplasmic space, one can .release the product by treating the yeast cells with an enzyme ~uch as zyrnolase or lyticase.
The product may be harvested by any conven.ient means, e.gu centrifugation and the protein then purified by filtration, chromatography, electrophoresis, dialysisf solvent-solvent extraction, etc.
In accordance with the subjec~ invention, one can provide for se~retion of a wide variety of poly-peptides, so as to greatly enhance product yield~

~2~

1~
simplify purification, minimize degradation ot the desired product, and simplify the processin~ equipment and engineering r~quirements. FurthermorP, utilization of nutxients based on productivity can be greatly enhancedr so that more economical and more efficient production of polypeptides may be achieved. Also, the use of yeast has many advantages both in avoiding ~nterotoxins, which may be pxesent with prokaryotes~
and in employiny known fermentation techniques, which L0 have been developed for yeast over long periods o-f time, which techniques include isolation of yeast products~
The following examples are offered by way o illustratlon and not by way of limitation~
1~
EXPERIMENTA
Isolation of the a-factor Structural Gel~e A collection of oligonucleotides with the ;Eollowing sequences is s~nthesi~ed~
~0 S'TGG(,CCCAGAAAAACC~'L'TGAq'3' These oligonucleotides are used to probe by hybridi~
zation of a yeast DNA fragment library cloned in the ~5 plasmid YRpl3 (Nasmyth and Tatchell, Cell ~1980) 19:753)O This oligonucleotide pool is designed to include molecules complementary to a region of DNA
encoding the a-factor peptide, based on the reported structure of the mature a-factor peptide (Betz et al., ~30 op.cit./ infra). The amino acid sequence of the mature a-factor peptide is reported as-TyrIleIleI.ysGlyTVeuPheTrpAla,AsxPro ~5 and the oligonucleotide probe extends from the first5'-base encoding the second Ile through the ~econd base o-E Asx.

~2~

A l9G5kb plasmid, pAB151, is identified by hybridization to this oligonucleotide pool Following digestion of pAB151 with the restriction enæymes EcoRI
and XbaI, a 1500bp fragment is identified which contains 5 the hybridization detected segment of ~NA. Following repair of the overhanging ends of this fragment with DNA polymerase Klenow fragment and ~he addit.ion of BantHI oligonucleotide linkers, this fragment is ligated .into the B HI site of plasmid pBR322 to obtain plasmi.d ln pABl61, a 5900bp plasmidO Where the direction of the fragment is determined by the coding d.irect.ion oE the a-factor gene, upstream from the fragment is a SalI
fragment, an EcoRI fragment at about the site of the B HI site upstream from the a factor and an EcoRI
downstream from the downstxeam BantHX site and the ~indIII site proximal to the downstream EcoRI site and intermediate the downstream EcoRI and BamHI sites (see Figure 1).
Structure of the Putative a-factor Structural Gene .~0 The DNA sequence of the insert .in p~B161 .is deterntlrled and found to COIlSist of 1569 base pairs~ A
reyion of this DNA .is Eound to contain nucleotides codiny for most of the reported a-factor peptide sequence. This sequence is part of a putative rt-facto.r precursor coding sequence as shown in ~he sequence on the following page.

~LZ~'t3~

~6 fjAA'rTCGAGACTCAAAGATGC'rGTACCGTTCACGCCG-rTTAACGG,rGArAGAGAAGCACACCCAAGt.~fTTTACG'rTGAAA
'GGTTCAG'rATACAATGACCCATTCATCAAAG7ATCTTGAGCACAGGAAAGAATTTATTGCGTCTGGGTTl,AACACTAATT
ATGCGTACGAAAGtJGTGTTGACAGAGGCATTTATGGGCTrAGGATG,'rGTTATA-rCCGAGGAGt,'rT'rAAAACArCAt.`,GAT
AGTGTGCAACtJ'It,~GCATAAGCTATGTAATt,AACTACTTTrTArTTTCTATGTACGCATATACATvCATrCACGATCTGT
:i TTCAGTGTTCAGAAAAAAtjGCACGTACTGCTACGGTTGGCCCATACCTT'rATTCTTTGl'TCTTG'r'rACAAACt.~AGTGTG
TAATTACCCAAAAAGGAAATTTACATGTTAAATt.,AAACCCAG`rAf'~-rCAGAAAAAACAGTTAAGAAACCTAAAA'rGGTAG
AGArAAAGATACAGATTCAGTGGTTGCTGAAAArCAAG`rAAAAAAATGAAATAGAGTCTrCATATATAAACGGÇCAGAA
met ArGAArTAArGAGAGGGATCTvTAACrGrr1CTCGGATAAAACCAAAArAAGrACAAAGCCArCGAArAGAA ATG
', 10 ZO
gln pro ser thr ala thr ala aia pro Iys glu Iy~ thr s~r ser glu Iys Iys asp asn CAA CCA TCT ACC t~,T ACC GCC GCT CCA AAA GAA AAG ACC AGC AGT GAA AAG AAG GAC AAC

tyr iie Tle Iys gly val phe trp asp pro ala cys val ile ala AM
- TAr ATT ATC AAA GG r GTC TTC TGG GAG CCA GCA rGT GTT ATT GC`r TAG 1rTCrGCG7rACAAAA
ACC~T rGTTcTcccTccT r rATc r rcc r r-rTccGc rAcAccAA I A I ATCA-t G 1 r rG T I CG rAA rA rT rc r 1 r lf rAGAcc rAArAATAAATATCC'rAAG'rAAC'rArAT'rA'rA'rAAAA'l'AT~r'l'rGATACCC'rG''l'ACCTGCTl''r'rGt.71''rA'l'CtjTrGrACA
rt~cArGcAt~AcGcrcATATArA-rArATArArArAlA`TATATGrAlArGTAcATATAGcGcT-rAcl~Act;rAccGTGAAG
rATA'T'I'j'rAAGGGTC;'r'rCGCACCCGGArATCCC'rrGl'GGGATCr'rGGA'rGCtjGATGGTGAGTG'rf'~AACA(GGCC'rCA'rAA
.! AGCltjrCrCTGTGlGCGGGAAGATGTCGTTrCArCGt~,TrCGACCTCCrCC1rATCTlGCTrCGATrGrrTCrrCGrA
AGAGGGAGGAtCTACGGGCAGCGGGGTCGC'rGTCTCCTTGTATGCATGCTTA'r'rTATA'rCAC'rC'l'T'rCCGC'rA'rCCAT
GATAArCrGTTTTTGTTTAtGTGC'rTTGAATACTCAACACA'rAAAA'rAA'rA'rCCAGTTAAT'rG-rCGrCTG'rCCATTGA
CGC rl tGccTTTGTcccTTTAGAcTGTt;TrTA TTG TGAAATATGCACGGCTGAGAATTACGTATACAGTGACTA rcGT
.A1G~GG(,GACAAAAGTTCCCAGCGAGAAACAAGATGAAGCAGACTGGGGCCTGCCTGTATGGAGGGAAGCATAAGTTA.~!; hTArACCTCCAGATATTrGCAGATTAGGATACrGAACTGACGAAGACCrACGCTACACAAC5AAGATAACACATGCTG
GCACAAACATTCAAAAAACCACACAGAGCCGTTCTAGA

Tr~nsl.3ted Moi. Weight = 3927.1.~

1 '~
Biolo~ical evidence of two typ~s i~ obtained that show that the lS00hp Bam~I fragment in pA~161 contains a functi.onal a-fackor structural gene (13 The plasmid pAB161 is used to probe RNA fr(jm ~. cerevisiae strains of a haploid, a haploid or a/
diploid mating type~ Only cells of the a mating type produc~ RNA which hybridizes to pAB161~ Therefore, the insex~ in pAB16:1 encodes an a~specific gene.
~23 ~he 1500bp BamHI fragment rom p.~B161 is ligated into the Bart~I site of the high-copy yeast plasmid pCl/l to obtai.n the plasmid pA.B163. (Plasmid pCl/l .is a derivati~7e of pJDB219 (Beggs, Nature ~l978) 275:104~ in which the region corresponding to bacte.rial plasmid pMB9 in pJDB219 has been replaced by pBR322 in pCl/1~ pC1/1 contains a complete yeast 2~m xeplica'co.r, yeast LEU2 gene and ~omplete pB~.322.) . pAB163 is introduced int.o the yeast stra.in AB101 ~a leu2 ura3 hi~4 trpl) by transforma'ciorl and seleckion of I,eu t.ransformarlts. These transform,.lr~t:s are found to pxoduce at le~st ten-fold greater amou~s of a-eactor than does a c~ntrol. ~tra:i.n, as judge~ by a rep1ica platirlg bioas~ay.
[n compar.ison with the aMino acid sequ~nce reported by Betz et alu lopucit., .infra)7 the DNA
~; sequence of pAB161 encodes additional am.ino acids both amino-terminal an~ carboxy-terminal to the mature a-factor sequence. Additionally, there is a difference in the oxder of amino acids cor.responding to the carboxyl terminus of t.he mature a~factor pep~id~
.~o sequence yields: ~TrpAspP.roAla-, reported peptide sequence- -TrpAla~s~Pro3..
lO ~ ts The following was the exemp:l.ary procedure for a cvnstruct employing human epide~mal growth Eactor as the gene or express.ion. Plasmid pAB161 is cleaved with AvaII and ~he :resu:l.t:i.ng f.~a~ments are resected 1~
with nuclease Bal31 to remov~ approximately 2gbp f.rom each end. An oligonucl20tide with the sequence 3,GGACGCAGCAGCT~, is ligated to the resulting mixture. ~he ligation mixture .is digested with the enzymes BamHI and SalI and fragments of approximately 690bp are gel isolatedD
3.0 These fragments are ligated to pBR322 which has been digested with BamHI and SalI. The resulting plasmids are screened for molecules hybridizing to a 32p_ radiolabeled chemically synthesized oligonucleo-tide probe with the fo].lowing seque.nce:
,L.~
5'-~AC(,CAGGCCTTCTT--3'.

Plasmids so ~elec~ed a.re then additionally :~creened for the pxesence of a StuI site. Such molecu1.es are .~ created by ~he junct:ioll sf the above oliyonucleotide at the desi.red position of the a-factor gene ac; shown below:

~5 3,TCACTTTTCTTCCGGACGCAGCAGCT5, The resulting molecule now has both a StuI
and a ~I recognition site adjacent to the region encoding the a-factor .leader of the a~-factor precursor.
~0 Cleavage with StuI results in cleavage in the a-actor leader xegion o the gene, as shown below:

3,TCACTTTTCTTCC5, .~j Alternatively, one may employ ~l~aI for a-factor leader cleavage to generate the product shown below:

9~

lg 3,TCACTTTTCTT5, Either of these product sequences can then be joined to a DNA molecule containing the gene for human epidermal growkh factor derived by cleavage of plasmid p328EG~
The DNA sequence obtained from cleavage of p328EGF-l with ~I is as follows:

10 AACTCCGACTCCG ~ TGTCCATTGTCCC~ACGACGGT'rACTGTTTGCACGACGGTGTTTGT
GCTGAGGCTTACAGGTA~CAGGGTGCTGCCAATGACAAAGCTGCTGCCACAAACA
ATGTACATCGAAGCTTTGGACAAGT~CGCTTGTAACTGTG'rTG'rTGGTTACATCGGTGAA
TACATGTAGCTTCGAAACCTGTTCATGCGAACA'rTGACACAACAACCAATGTAGCCACTT
AGATGTCAATACAGAGACTTGAAGTGGTGGGAAT
TCTACAGTTATGTCTCTGAACTTCACCACCCT'rAACTCT
:L~
Liga-tion of these molecules is carried out with the followin~ oliyonucleotide adaptor molecules:
Æither (1) a StuI-Hgal adaptor t ~ ACAAC3 ,TGTTGTT~,AG51 .if StuI was employed prev.i.ous:Ly to clea~e the a-factox leader;
or ~2) a H~aI~ I adapto.r~ 5 AAGAAGGACAAC3 ,CCTGT'.rGTTGAG
if ~I was used; and (3) a ~I-SalI adaptur, TGAGATGATAAG
3,ACTATTCAGC'I'5 t Cleavage of either of these liqation mixtures with ~amHI and SalI ~ields an 870bp fragment wh.ich .is isolated and ligated into pCl/l digested to completion with the restrict.ion enzymes BamHI and SalI and 1:reated ~ikh alkaline phosphata~e~ This mixture is used to 3~ transform E, coli HB101 cellsO Transfvrmants are selected by ampicillin resistance and their plasmids analyzed by rest.r.iction endonuclease digestionO

~2~

~o Plasmid DNA from one selected clone (pYaEG~l) is prepared and used to transform yeast AB102 cells.
Transf~rmants are ~elected by their Leu+ phenotype.
Assay and Characterization of Expression Product Fifty millilitex cultures of yeast ~train AB102 (a, pep 4-3, leu 2-3, leu 2-112, ura 3-52, his

4-580) transformed with the above plasmid pYaEGF1 are grown at 30 in medium lackiny leucine to saturation (op~ical density of 600nm of 5). Cell supernatants are collected by centrifugation and analyzed for the presence of human EGF using the fibroblast receptor competition binding assay. The assay of EGF is based on the ability of both mouse and human EGF to compete with 125I-labeled mouse EGF for binding sites on human foreskin fibroblasts. Standard curves can be obtained by measuring the effects of increasing quantities of EGF on the binding of a .standard amount of 125I~labeled mou~e EGF. Under these conditions 2 to 20ng of the EGF
are r~adily measurable. Details on the bindiny of 125I-labeled epidermal growth factor to human fibro-blasts have been described by Carpente~ et al., J.
Biol~ Chem. (1975) 250:4297. Using this assay it is found that the culture medium contains xeadily measur-able quantities of human EGF per li~er. The human EGF
present in the supernatant, may be subjected tv appro-priate biochemical analytical methods, e.g. gel electrophoresis, ~PLC and amino acid sequence anslysis.
The results of these procedures further confirm the identity of the product~
For further characteriz~tion/ human EGF
present in the supernatant is purified by absorption to the ion~exchange resin Biorex-7~ and elution with HCl lOmM in 80% ethanol. After evaporation of the HCl and ethanol the EGF is solubilized in water. This material migr~tes as a single major protein of MW approx. 6,000 in 17~5% SDS gels, roughly the same as authentic mouse EGF (~W~6,D00). This indicates that the a-factor * Trade Mark ~eader sequence has been properly excised during ~he ~ecretion processO Analysis by high resolution liquid chromatography ~microbondapack C18~ ~aters column~
indicates that the product migrates with a retent.ion

5 time similar to an authentic mouse EGF standard~
In accordance with the subject inventionf novel constructs are provided which may be inserted into vectors to p.rovide for xpressiorl of polypept:ides having an N~terminal leader sequence and one sr more i.CI processing signals to provide ~or secretion o:E the polypep~ide as well as processing to rP ult in a processed polypeptide p,roduct, either mature or capable of being freed of superfluous amino acids~ Thus, one may obtain secretion of the pro-polypeptide which then may be subsequently processed in v vo or ln v:Ltro to provi-.le for the mature product. In this manrler, one can obta:in a polypeptide having *he identical amin~
acid ~equence to ~ natura,ll,y occurring polypeptide,, ~n ~ddi,t:ion, because the polypeptide can be producf:d irl ~() yeast, glyco.sylatiorl can occu:r, so that a proc]uct can he obt~ined whi.ch :is identlcal to or sub~tantial'ly ident,ical to the natuxally occurring productD Further-more, hecause the product .is secreted, greatly enhanc~d yields can be ob~ained based on cell population and ~,5 processing and pur.iflcation are greatly simplified~
Although the foregoing invention has been descr.ibed in some detail by way o.~ illustration and example for purposes sf clarity of ~nderstanding, it will be obviou.s that certain changes and modifica~ions 3~ may be practiced within the scope of the appended claimsO

Claims (11)

The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows:

1. A DNA construct comprising the yeast leader sequence of a-factor including processing signals and a heterologous gene in reading frame with said leader sequence and processing signals.

2. A DNA construct according to claim 1 of the formula:
L-(PS-(a-factor))n-PS-gene wherein:
L is the a-factor secretory leader sequence;
PS is the processing signal;
gene is a gene heterologous to yeast;
n is 0 or 1; and a-factor is the DNA sequence encoding for at least a portion of the mature a-factor.

3. A DNA construct according to claim 2, wherein said gene is a mammalian gene or portion thereof.

4. A DNA construct according to claim 2, wherein said gene is a mammalian pathogen gene or portion thereof.

5. A DNA construct of the formula:
P-L-(PS-(a-factor))n (PS-(gene)r)w-¦RepS¦q wherein:
P is a promoter recognized by yeast RNA
polymerase;
L is the a-factor secretory leader sequence;
PS is the processing signal;
gene is a DNA sequence having an open reading frame in phase with L and PS encoding for a polypeptide heterologous to yeast;
q and w are at least one;
¦RepS¦ is a replication system recognized by yeast and may be located anywhere in the construct external to the immediate expression region defined by P and gene as extremities;
n and r are 0 or 1, at least one of n or r being 1; and a-factor is the DNA sequence encoding for at least a portion of the mature a-factor.

6. A construct according to claim 5, wherein r is 1 and said polypeptide is a mammalian polypeptide.

7. A construct according to claim 5, wherein r is 1 and said polypeptide is a mammalian pathogen gene or portion thereof.

8. A construct according to claim 5, wherein said promoter is a-factor promoter.

9. A construct according to claim 5 wherein said replication system recognized by yeast is the yeast 2µm plasmid or portion thereof.

10. A construct according to claim 5 wherein q is 2 and further comprising a replication system recognized by bacteria.

11. A method for producing a secreted polypep-tide product which comprises:
growing yeast cells containing a DNA construct according to claim 5, whereby said secretory leader sequence, processing signals and gene encoding for said polypeptide are expressed as a fused polypeptide, which is secreted and processed by said yeast cells.