CA2498319A1 - Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules - Google Patents

Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules Download PDF

Info

Publication number
CA2498319A1
CA2498319A1 CA002498319A CA2498319A CA2498319A1 CA 2498319 A1 CA2498319 A1 CA 2498319A1 CA 002498319 A CA002498319 A CA 002498319A CA 2498319 A CA2498319 A CA 2498319A CA 2498319 A1 CA2498319 A1 CA 2498319A1
Authority
CA
Canada
Prior art keywords
cytokine
modified
amino acid
proteases
ifn
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
CA002498319A
Other languages
French (fr)
Inventor
Rene Gantier
Thierry Guyon
Manuel Vega
Lila Drittanti
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nautilus Biotech SA
Original Assignee
Nautilus Biotech
Rene Gantier
Thierry Guyon
Manuel Vega
Lila Drittanti
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nautilus Biotech, Rene Gantier, Thierry Guyon, Manuel Vega, Lila Drittanti filed Critical Nautilus Biotech
Publication of CA2498319A1 publication Critical patent/CA2498319A1/en
Abandoned legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475Growth factors; Growth regulators
    • C07K14/505Erythropoietin [EPO]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/53Colony-stimulating factor [CSF]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/53Colony-stimulating factor [CSF]
    • C07K14/535Granulocyte CSF; Granulocyte-macrophage CSF
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575Hormones
    • C07K14/61Growth hormones [GH] (Somatotropin)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Abstract

Processes and systems for the high throughput directed evolution of peptides and proteins, particularly cytokines that act in complex biological settings, are provided. Also provided is a rational method for generating protein variants and the resulting variants.

Description

RATIONAL EVOLUTION OF CYTOKINES FOR HIGHER STABILITY, THE
CYTOKINES AND ENCODING NUCLEIC ACID MOLECULES
RELATED APPLICATIONS
Benefit of priority to U.S. Provisional Application Serial No, 60/457,135, entitled "RATIONAL EVOLUTION OF CYTOKINES FOR
HIGHER STABILITY, ENCODING NUCLEIC ACID MOLECULES AND
RELATED APPLICATIONS," filed March 21, 2003, and fio U.S. Provisional Application Serial No. 60/409,898, entitled "RATIONAL EVOLUTION OF
CYTOKINES FOR HIGHER STABILITY, ENCODING NUCLEIC ACID
MOLECULES AND RELATED APPLICATIONS," filed September 9, 2002, each to Rene Gamier, Thierry Guyon, Manuel Vega and Lila Drittanti.
This application is related to U.S. application Serial No. attorney dkt. no. 37851-922, entitled, "RATIONAL EVOLUTION OF CYTOKINES
FOR HIGHER STABILITY, THE CYTOKINES AND ENCODING NUCLEIC
ACID MOLECULES," to Rene Gantier, Thierry Guyon, Manuel Vega and Lila Drittanti. This application also is related to U.S. application Serial No, Attorney docket no. 37851-923, filed the same day herewith, entitled "RATIONAL DIRECTED PROTEIN EVOLUTION USING TWO-DIMENSIONAL
RATIONAL MUTAGENESIS SCANNING," to U.S. provisional application Serial No. 60/457,063, entitled "RATIONAL DIRECTED PROTEIN
EVOLUTION USING TWO-DIMENSIONAL RATIONAL MUTAGENESIS
SCANNING," filed March 21, 2003, and to U.S. Provisional Application Serial No. 60/410,258, entitled "RATIONAL DIRECTED PROTEIN
EVOLUTION USING TWO-DIMENSIONAL RATIONAL MUTAGENESIS
SCANNING," filed September 9, 2002, each to Rene Gantier, Thierry Guyon, Hugo Cruz Ramos, Manuel Vega and Lila Drittanti. This application also is related to co-pending U.S. application Serial No.
10/022,249, filed December 17, 2001, entitled "HIGH THROUGHPUT
-2-DIRECTED EVOLUTION BY RATIONAL MUTAGENESIS," to Manuel Vega and Lila Drittanti.
Where permitted, the subject matter of each of the above-noted applications and provisional applications is incorporated by reference in its entirety.
FIELD OF INVENTION
Modified cytokine proteins having seleced modified properties compared to the unmodified or wild type proteins, and nucleic acid molecules encoding these proteins are provided. Uses of these proteins for diagnosis and treatment of diseases also are provided.
BACKGROUND
The delivery of therapeutic proteins for clinical use is a major challenge to pharmaceutical science. Once in the blood stream, these proteins are constantly eliminated from circulation within a short time by different physiological processes, involving metabolism as well as clearance using normal pathways for protein elimination, such as (glomerular) filtration in the kidneys or proteolysis in blood. The latter is often the limiting process affecting the half-life of proteins used as therapeutic agents in per-oral administration and either intravenous or intramuscular injection. The problems associated with these routes of administration of proteins are well known and various strategies have been used in attempts to solve them.
A protein family, which has been the focus of much clinical work, and efforts to improve its administration and bio-assimilation, is the cytokine family, including the interferon family. Interferon molecules are grouped in the heterogeneous family of cytokines, originally identified on the basis of their ability to induce cellular resistance to viral infections (Diaz et al., J. Interferon Cytokine Res., 16:179-180, 1996). Type I
interferons, referred to as interferons all3, include many members of the
3 PCT/IB2003/004347 interferon a family (interferon a1, a2, cu and r) as well as interferon a.
The type II interferon y is different from type 1 in its particular mechanisms that regulate its production. Whereas the production of interferons all3 is most efficiently induced in many types of cells upon viral infection, interferon-y is produced mainly in cells of hemopoietic system, such as T-cells or natural killer cells, upon stimulation by antigens or cytokines, respectively. These two interferon systems are functionally non-redundant in the antiviral defense host.
lnfierferon a, hereinafter "interferon alpha-2b," or "interferon a-2b"
or "IFNa-2b," used interchangeably, has a broad spectrum of biological effects, including antiviral effects. Antiviral effects include antiproliferative and immuno-modulatory actions (Stark et al., Annu. Rev.
Biochem., 67:227-264, 1998). As well as eliciting strong antiviral activities in target cells, interferons a//3 also activate effector cells of the innate immune system such as natural killer cells and macrophages (Pestka et al,, Annu. Rev. Biochem., 56:727-777, 1987; Biron et al., Annu. Rev. lmmunol., 17:189-220, 1999). As part of its immuno-modulatory action, interferon type I protects T-lymphocytes from apoptosis (Schee!-Toeller et al., Eur. J. lmmunol., 29:2603-2612, 1999;
Marrack et al., J. Exp. Med., 189:521-530, 1999) and growth enhancing factors (Robert et al., Hematol. Oncol., 4:1 13-120, 1986; Morikawa et al., J. lmmunol., 139:761-766, 1987). The biological effects of interferons a//3 are initiated upon binding to the IFN type I receptor, which results in activation of several downstream effector molecules (Hibbert and Foster, J. Interferon Cytokine Res., 19:309-318, 1999).
Interferons as well as many cytokines are important therapeutics.
Since naturally occurring variants have not evolved as therapeutics, they often have undesirable side-effects as well as the above-noted problems of short-half life, administration and bioavailability. Hence, there is a need
-4-to improve properties of cytokines, including interferons, for use as therapeutic agents. Therefore, among the objects herein, it is an object to provide cytokines that have improved therapeutic properties.
SUMMARY
Provided herein are methods for directed evolution of families of proteins and resulting families of modified proteins. A family, such as the cytokine protein family, is initially identified. A property or phenotype for modification, such as resistance to proteolysis for increased stability in blood, is selected for modification. A representative member or members of the family, such as members of the interfero a family, such as IFNa-2b or IFNa-2a, or interferon ~3 family, is (are) selected. It is modified using any directed evolution method and proteins) with a desired phenotype are screened and identified. In addition, the 3-dimensional structure of the protein can be mapped to topologically and spatially identify the loci that are modified to achieve the phenotypic change. 3-dimensional structures of other members of the family are generated or obtained and compared with the modified family member. Loci in the other family members that correspond on the protein to those modified in the original protein are identified and modified. The resulting proteins can be tested to confirm that they exhibit the modified phenotype.
Provided herein are methods for generating modified cytokines based on structural homology (3D scanning). These methods are based on the spatial and topological structure; they are not based on their underlying sequences of amino acid residues. The methods are used for identification of target sites for mutagenesis, particularly in families of target proteins. The targets are identified through comparison of patterns of protein backbone folding between and among structurally related
-5-proteins. The methods are exemplifed herein for cytokines. Families of the modified cytokines also are provided herein.
Any protein known or otherwise available to those of skill in the art is suitable for optimization using the directed evolution methods provided herein, including cytokines (e.g., IFNa, including IFNa-2b and IFNa-2a, and IFN~3) or any other proteins that have already been mutated or opfiimized.
Provided herein are modified cytokines that exhibit increased resistance to proteolysis as assessed in vivo or in vitro. Typically the increase in resistance is a least 5%, generally 8%, 10% or more. The modified cytokines provided herein include those designed by 3D
scanning using the interferon a's that were modified based upon 2D
scanning methods herein.
Also provided herein are modified (mutant) cytokine proteins, such as variants of IFN~3 and IFNa, including IFNa-2b and IFNa-2a proteins and IFN,~ proteins, that have altered, particularly, improved therapeutic properties, including higher stability compared to the unmodified forms.
In particular, exemplary modified cytokines provided herein have increased stability, which, for example, improves their use as therapeutics. Among the modified cytokines provided herein are those that exhibits increased resistance to proteolysis compared to the unmodified cytokine. In particular, such resistance is at least 10%, 20%, 30%, 40%, 50%, 70%, 100% or more resistant to proteolysis compared to the unmodified cytokine. Also provided are cytokines that have increased anti-proliferative and/or antiviral activity and/or resistance to proteolysis compared to an unmodified cytokine.
Exemplary of the modified cytokines provided herein are modified interferons that exhibit higher stability compared to unmodified forms.
Such modified interferons can be used for treating conditions in humans
-6-that are responsive to treatment with interferons, such, but are not limited to, as viral infections, cancer or tumors, undesired cell proliferation and for immuno-modulation.
Exemplary of proteins that can be modified by the 2D and 3D
scanning methods provided herein are cytokines from the inter-ferons/interleukin-10 family. This family includes, for example, interleukin-10 (IL-10; SEQ ID N0:200, interferon beta (IFN,~; SEC? ID NO:
196), interferon alpha-2a (IFNa-2a; SEQ ID NO: 182), interferon alpha-2b (IFNa-2b; SEC! ID N0:1 ), and interferon gamma (IFN-y; SEQ ID NO: 199).
The long-chain cytokine protein family includes, among others, granulocyte colony stimulating factor (G-CSF; SEQ ID NO: 210), leukemia inhibitory factor (LIF; SEC? ID NO: 213), growth hormone (hGH; SEQ ID
NO: 216), ciliary neurotrophic factor (CNTF; SEQ ID N0: 212), leptin (SEQ 1D NO: 211 ), oncostatin M (SEQ ID N0: 214), interleukin-6 (IL-6;
SEQ ID NO: 217) and interleukin-12 (IL-12; SEQ ID NO: 215). The short-chain cytokine protein family includes, among others, erythropoietin (EPO;
SEQ JD NO: 201 ), granulocyte-macrophage colony stimulating factor (GM-CSF; SEQ ID NO: 202), interleukin-2 (IL-2; SEQ ID NO: 204), interleukin-3 (IL-3; SEQ ID NO: 205), interleukin-4 (IL-4; SEQ ID NO: 207), interleukin-5 (IL-5; SEQ ID NO: 208), interleukin-13 (IL-13; SEO ID NO: 209), Flt3 ligand (SEQ ID N0: 203) and stem cell factor (SCF; SEQ ID N0: 206).
Modified forms of each that have increased resistance to proteolysis are provided. They were generated by comparison among the 3D-structures to identify residues that improve resistance to proteolysis.
Pharmaceutical compositions containing each modified cytokine and uses and methods of treatment are provided.

_7_ The modified cytokines have use as therapeutics. Each cytokine has improved biological and or therapeutic activity, compared to the know activity of the unmodified cytokine. Accordingly, uses of the cytokines for treatment of cytokine-mediated diseases and diseases for which immunotherapy is employed are provided. Methods of treatment using the modified cytokines for diseases also are provided. Each cytokine has a known therapeutic use, and such use is contemplated herein. Cyokines provided herein have improved properties, such as increased bioavailability, improved stability, particularly in vivo, and/or greater efficacy.
DESCRIPTION OF THE FIGURES
Figure 1 (A) displays the sequence of the mature IFNa-2b, Residues targeted by a mixture of proteases, including a-chymotrypsin (F, L, M, W, and Y), endoproteinase Arg-C (R), endoproteinase Asp-N (D), endoproteinase Glu-C (E), endoproteinase Lys-C (K), and trypsin (K, and R), are underlined and in bold lettering Figure 1 (B) displays the structure of IFNa-2b obtained from the NMR structure of IFNa-2a (PDB code 11TF) in ribbon representation.
Surface residues exposed to the action of the proteases considered in FIG1A are in space filling representation.
Figure 2 depicts the "Percent Accepted Mutation" (PAM250) matrix Values given to identical residues are shown in gray squares. Highest values in the matrix are shown in black squares and correspond to the highest occurrence of substitution between two residues.
Figure 3 presents the scores obtained from PAM250 analysis for the amino acid substitutions (replacing amino acids on the vertical axis;
amino acid position on the horizontal axis) aimed at introducing resistance to proteolysis into the IFNa-2b at the protease target sequences. The two _g_ best replacing residues for each target amino acid according to the highest substitution scores are shown in black rectangles.
Figures 4(A)-4(C) provide graphs of experiments indicating the levels of protection against in vitro proteolysis for IFNa-2b variants produced in mammalian cells. In Figures 4(B) and 4(C), the vertical axis indicates the relative level of non-proteo(ized protein and fihe horizontal axis indicates time in hours.
Figure 5 displays the characterization of several IFNa-2b variants, produced in mammalian cells, treated with a-chymotrypsin.
Figure 6(A) shows the characterization of the E1 13H IFNa-2b variant when treated with a-chymotrypsin. The percent of residual (anti-viral) activity for the variant (black line and white circles) after treatment with a-chymotrypsin was compared to the treated wild-type IFNa-2b (dashed line and black squares). For this experiment, the E113H IFNa-2b varianfi was produced in mammalian cells.
Figure 6(B) shows the characterization of the E113H IFNa-2b variant treated with a mixture of proteases. The percent of residual (anti-viral) activity for the variant (black line and white circles) after treatment with protease mixture was compared to the treated wild-type IFNa-2b (dashed line and black squares). For this experiment, the E113H IFNa-2b variant was produced in mammalian cells.
Figure 6(C) presents the characterization of the E113H IFNa-2b variant treated with blood lysate. The percent of residual (anti-vita() activity for the variant (black line and white circles) after treatment with blood lysate was compared to the treated wild-type IFNa-2b (dashed line and black squares). For this experiment, the E113H IFNa-2b variant was produced in mammalian cells.
Figure 6(D) presents the characterization of the E1 13H IFNa-2b variant treated with serum. The percent of residual (anti-viral) activity for _g_ the variant (black line and white circles) after treatment with serum was compared to the treated wild-type IFNa-2b (dashed line and black squares). For this experiment, the E1 13H IFNa-2b variant was produced in mammalian cells.
Figures 6(E) and 6(F) provide graphs indicating the levels of protection against in vitro proteolysis for IFNa-2b variants produced in bacteria. In Figures 6(E) and 6(F), the vertical axis indicates the relative level of non-proteolized protein and the horizontal axis indicates time in hours. The percent of residual (anti-viral) activity for the variants (gray circles with continuous lines) after treatment were compared to the treated wild-type IFNa-2b (solid circles with dashed lines).
Figure 6(G) provides graphs indicating the in vitro potency for antiviral activity, for IFNa-2b variants produced in bacteria. The vertical axis indicates the level of antiviral activity and the horizontal axis indicates concentration of the variants at which each level of activity is achieved. The activity for the variants (continous line with gray circles) was compared to that of the wild-type IFNa-2b (black triangles with dashed lines). The potency for each variant was calculated from the graphs as the concentration at the inflection point of the respective curves. Figure 6(T) shows the value of potency obtained for each variant tested compared to the wild type IFNa.
Figure 6(H) provides the in vitro potency for anti-proliferation activity, for IFNa-2b variants produced in bacteria. The activity for the variants was compared to that of the wild-type IFNa-2b in serial dilution experiments where the anti-proliferation activity was measured for a number of dilutions for each variant. Potency was calculated from the graphs as the concentration at the inflection point of the respective curves. The figure shows the value of potency obtained for each variant tested and in comparison to the wild type IFNa.

Figures 6(I) to 6(N) provide graphs indicating the pharmacokinetics in mice following subcutaneous injection of IFNa-2b variants produced in bacteria. The vertical axis indicates the level of antiviral activity in blood and the horizontal axis indicates the time after injection at which the level of antiviral activity is determined. The pharmacokinetics of the variants {in gray solid circles with gray continuous lines) was compared to that of the wild-type IFNa-2b (in black with dashed lines) and of a pegylated derivative (Pegasys, Roche) (36~g/ml open triangles with continuous black lines; and 1 ~ ,cig/ml open circles with continuous black lines); and vehicle {gray solid triangles with continous gray lines. The Area Under the Curve (AUC) for each variant was calculated from the graphs and is shown in 6(U).
Figure 6(O) provides graphs indicating the levels of protection against in vitro proteolysis for IFN/3 variants produced in mammalian cells.
Figure 6(N), the vertical axis indicates the relative level of non-proteolized protein and the horizontal axis indicates time in hours. The percent of residual (anti-viral) activity for the variants after treatment were compared to the treated wild-type IFN~3.
Figures 6(P) to 6(S) provide graphs indicating the in vitro potency for either antiviral activity {6{P) and 6(Q)) or anti-proliferative activity (6(R) and 6(S), for a number of IFN,r3 variants produced in mammalian cells.
The vertical axis indicates the level of (antiviral or anti-proliferation) activity and the horizontal axis indicates the concentration of the variants at which each level of activity is achieved. The activity for the variants (6(Q) and (6(S)) was compared to that of the wild-type IFN,~ (6(P) and (6(R)). The activity obtained with either no previous treatment or by treating the variants with proteases prior to the activity test is shown.
Figure 6(T) provides a comparison of antiviral activity (potency), anti-proliferation activity (potency), number of mutations present and AUC

(from PK) for a number of IFNa-2b and in comparison with the wild-type IFNa-2b.
Figure 6(U) provides 1FN units injected and protein injected (,~g/ml) for the data in Figure 6(T).
Figure 7(A) depicts a top view ribbon representation of IFNa-2b structure obtained from the NMR structure of IFNa-2a (PDB code 11TF).
Residues represented in "space filling" define (1 ) the "receptor binding region" based on either our "alanine scanning" analysis or on studies by Piehler et al., J. Biol. Chem., 275:40425-40433, 2000, and Roisman et al., Proc. Nat/. Acad. Sci. USA, 98:13231-13236, 2001 (in light-gray and dark-gray, respectively), and (2) replacing residues (LEADs) for resistance to proteolysis (in black).
Figure 7(B) depicts a side view ribbon representation of IFNa-2b structure (PDB code 11TF). Residue representation is as in FIG7A.
Figure 8(A) schematizes the identification of homologous amino acid positions between a number of cytokines and the LEAD mutants of IFNa-2b using 3-dimensional scanning (also referred to herein as based on "structure-based homology" methods or "structural homology" methods).
Figure 8(B) illustrates a structural overlapping between human interferon a-2b obtained from the NMR structure of IFNa-2a (PDB code 1 ITF) and human interferon ,Q (PDB code 1 AU 1 ) using Swiss Pdb Viewer.
Figure 8(C) illustrates a structural overlapping between human interferon a-2b obtained from the NMR structure of IFNa-2a (PDB code 1 ITF) and erythropoietin (PDB code 1 BUY) using Swiss Pdb Viewer.
Figure 8(D) illustrates a structural overlapping between human interferon a-2b obtained from the NMR structure of IFNa-2a (PDB code 1 ITF) and granulocyte-colony stimulating factor (PDB code 1 CD9) using Swiss Pdb Viewer.

Figure 9 illustrates a structural alignment of a number of cytokines and interferon a-2b sequences. Bold underlined residues define the region on each cytokine sequence that based on structural homology comparison corresponds to the structurally-related mutations found on the LEADs for protease resistance of IFNa-2b.
Figure 10(A) shows the antiviral activity of interferon a-2b mutants generated by alanine-scanning analysis used for protein redesign. Plotted symbols for wild type and variants of interferon a-2b are indicated in the inset.
Figure 10(B) displays cell proliferation after treatment with interferon a-2b mutants obtained by alanine-scanning analysis. Plotted symbols for wild type and variants of interferon a-2b are indicated in the inset.
Figure 10(C) displays the correlation between the antiviral activity and cell proliferation activity of interferon a-2b mutants obtained by alanine-scanning analysis.
Figure 11 Candidate glycosylation sites for interferon a-2b stabilization and redesign thereof.
Figure 12 (A) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interferon /3 (corresponding to SEQ ID Nos: 233-289), based on 3D-scanning (structural homology method), including PAM250 analysis.
Figure 12 (B) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interferon gamma (corresponding to SEQ ID Nos: 290-31 1 ), based on structural homology and PAM250 analysis.
Figure 12 (C) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-10 (corresponding to SEQ ID Nos: 312-361 ), based on structural homology and PAM250 analysis.
Figure 12 (D) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of ciliary neurotraphic factor (corresponding to SEQ ID Nos: 684-728), based on structural homology and PAM250 analysis.
Figure 12 (E) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of granulocyte-colony stimulating factor (corresponding to SEQ ID Nos: 631-662), based on structural homology and PAM250 analysis.
Figure 12 (F) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of human growth hormone (corresponding to SEQ ID Nos: 850-895, based on structural homology and PAM250 analysis.
Figure 12 (G) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-12 (corresponding to SEQ ID Nos: 794-849), based on structural homology and PAM250 analysis.
Figure 12 (H) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-6 (corresponding to SEQ ID Nos: 896-939), based on structural homology and PAM250 analysis.
Figure 12 (I) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of leptin (corresponding to SEQ ID Nos: 663-683), based on structural homology and PAM250 analysis.
Figure 12 (J) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of leukemia inhibitory factor (corresponding to SEQ ID Nos: 729-760), based on structural homology and PAM250 analysis.
Figure 12 (K) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of oncostatin M (corresponding to SEQ ID Nos: 761-793), based on structural homology and PAM250 analysis.
Figure 12 (L) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of erythropoietin (corresponding to SEQ ID Nos: 940-977), based on structural homology and PAM250 analysis.
Figure 12 (M) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of FIt3 ligand (corresponding to SEQ ID Nos: 401-428), based on structural homology and PAM250 analysis.
Figure 12 (N) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of granulocyte-macrophage colony-stimulating factor (corresponding to SEQ
ID Nos: 362-400), based on structural homology and PAM250 analysis.
Figure 12 (O) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-13 (corresponding to SEQ ID Nos: 603-630), based on structural homology and PAM250 analysis.
Figure 12 (P) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-2 (corresponding to SEQ ID Nos: 429-476), based on structural homology and PAM250 analysis.
Figure 12 (Q) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-3 (corresponding to SEQ ID Nos: 477-498), based on structural homology and PAM250 analysis.
Figure 12 (R) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-4 (corresponding to SEQ ID Nos: 543-567), based on structural homology and PAM250 analysis.
Figure 12 (S) shows the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of interleukin-5 (corresponding to SEQ ID Nos: 568-602), based on structural homology and PAM250 analysis.
Figure 12 (T) displays the is-HIT residue positions and type of replacing amino acids selected to generate modified protein sequences of stem cell factor (corresponding to SEQ ID Nos: 499-542), based on structural homology and PAM250 analysis.
DETAILED DESCRIPTION
OUTLINE

A. Definitions B. Directed Evolution 1 ) Pure Random Mutagenesis 2) Restricted Random Mutagenesis 3) Non-restricted Rational mutagenesis C. 2-Dimensional Rational Scanning (2D scanning) 1 ) Identifying In-silico HITS

2) Identifying Replacing Amino Acids (a) Percent Accepted Mutation (PAM) (i) PAM Analysis (ii) PAM250 (b) Jones and Gonnet (c) Fitch and Feng (d) McLachlan, Grantham and Miyata (e) Rao (f) Risler (g) Johnson (h) Block Substitution Matrix (BLOSUM) 3) Physical Construction of Mutant Proteins and Biological Assays D. 2-Dimensional Scanning of Proteins for Increased Resistance to Proteolysis E. Rational Evolution of IFNa-2b For Increased Resistance to Proteolysis 1 ) Modified IFNa-2b and IFNa-2a Proteins with Single Amino Acid Substitutions (is-HITs) 2) LEAD identification 3) N-glycosylation Site Addition F. Protein Redesign G. 3D-scanning and Its Use for Modifying Cytokines 1 ) Homology 2) 3D-scanning (Structural Homology) 3) Application of the 3D-scanning method to Cytokines (a) Structurally Homologous Interferon Mutants (b) Structurally Homologous Cytokine Mutants H. Rational Evolution of IFN,l3 For Increased Resistance to Proteolysis Modified IFN~3 Proteins with Single Amino Acid Substitutions I. Super-LEADs and Additive Directional Mutagenesis (ADM).
1 ) Additive Directional Mutagenesis 2) Multi-overlapped Primer Extensions J. Uses of the Mutant IFNa, IFN/3-2b Genes and Cytokines in Therapeutic Methods 1 ) Fusion Proteins 2) Nucleic Acid Molecules for Expression 3) Formulation of Optimized Cytokines IC. Examples A. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the inventions) belong. All patents, patent applications, published applications and publications, Genbank sequences, websites and other published materials referred to throughout the entire disclosure herein, unless noted otherwise, are incorporated by reference in their entirety. In the event that there is a plurality of definitions for terms herein, those in this section prevail. Where reference is made to a URL or other such identifier or address, it understood that such identifiers can change and particular information on the Internet can come and go, but equivalent information can be found by searching the Internet.
Reference thereto evidences the availability and public dissemination of such information.
As used herein, biological activity of a protein refers to any activity manifested by the protein in vivo.

As used herein, "a directed evolution method" refers to methods that "adapt" either natural proteins, synthetic proteins or protein domains to work in new or existing natural or artificial chemical or biological environments and/or to elicit new functions and/or to increase or decrease a given activity, and/or to modulate a given feature. Exemplary directed evolution methods include pure random mutageneis methods; restricted random mutagenesis methods; and non-restricted rational mutagenesis methods, such as the rational directed evolution method described in co-pending U.S. application Serial No. 10/022,249; and the 2-dimensional rational scanning method provided herein.
As used herein, two dirrrensional rational mutagenesis scanning (2D
scanning) refers to the processes provided herein in which two dimensions of a particular protein sequence are scanned: (1 ) one dimension is to identify specific amino acid residues along the protein sequence to replace with different amino acids, referred to as is-HIT
target positions, and (2) the second dimension is the amino acid type selected for replacing the particular is-HIT target, referred to as the replacing amino acid.
As used herein, in silieo refers to research and experiments performed using a computer. In silico methods include, but are not limited to, molecular modeling studies, and biomolecular docking experiments.
As used herein, "is-HIT" refers to an in siiico identified amino acid position along a target protein sequence that has been identified based on i~ the particular protein properties to be evolved, ii) the protein's amino acid sequence, and/or in) the known properties of the individual amino acids. These is-HIT loci on the protein sequence are identified without use of experimental biological methods. For example, once the protein features) to be optimized is (are) selected, diverse sources of information or previous knowledge (i.e., protein primary, secondary or tertiary structures, literature, patents) are exploited to determine those amino acid positions that may be amenable to improved protein fitness by replacement with a different amino acid. This step utilizes protein analysis "in silico." All possible candidate amino acid positions along a target proteins primary sequence that might be involved in the feature being evolved are referred to herein as "in silico HITs" ("is-HITs"). The collection (library), of all is-HITs identified during this step represents the first dimension (target residue position) of the two-dimensional scanning methods provided herein.
As used herein, "amenable to providing the evolved predetermined property or activity," in the context of identifying is-HITs, refers to an amino acid position on a protein that is contemplated, based on in silico analysis, to possess properties or features that when replaced would result in the desired activity being evolved. The phrase "amenable to providing the evolved predetermined property or activity," in the context of identifying replacement amino acids, refers to a particular amino acid type that is contemplated, based on in silico analysis, to possess properties or features that when used to replace the original amino acid in the unmodified starting protein would result in the desired activity being evolved.
As used herein, high-throughput screening (HTS) refers to processes that test a large number of samples, such as samples of test proteins or cells containing nucleic acids encoding the proteins of interest to identify structures of interest or the identify test compounds that interact with the variant proteins or cells containing them. HTS
operations are amenable to automation and are typically computerized to handle sample preparation, assay procedures and the subsequent processing of large volumes of data.

As used herein, the term "restricted," when used in the context of the identification of is-HIT amino acid positions along the protein sequence selected for amino acid replacement and/or the identification of replacing amino acids, means that fewer than all amino acids on the protein-backbone are selected for amino acid replacement; and/or fewer than all of the remaining 19 amino acids available to replace the original amino acid present in the unmodified starting protein are selected for replacement. In particular embodiments of the methods provided herein, the is-HIT amino acid positions are restricted, such that fewer than all amino acids on the protein-backbone are selected for amino acid replacement. In other embodiments, the replacing amino acids are restricted, such that fewer than all of the remaining 19 amino acids available to replace the native amino acid present in the unmodified starting protein are selected as replacing amino acids. (n a particular embodiment, both of the scans to identify is-HIT amino acid positions and the replacing amino acids are restricted, such that fewer than all amino acids on the protein-backbone are selected for amino acid replacement and fewer than all of the remaining 19 amino acids available to replace the native amino acid are selected for replacement.
As used herein, "candidate LEADs," are mutant proteins that are contemplated as potentially having an alteration in any attribute, chemical, physical or biological property in which such alteration is sought. In the methods herein, candidate LEADs are generally generated by systematically replacing is-HITS loci in a protein or a domain thereof with typically a restricted subset, or all, of the remaining 19 amino acids, such as obtained using PAM analysis. Candidate LEADs can be generated by other methods known to those of skill in the art tested by the high throughput methods herein.

As used herein, "LEADs" are "candidate LEADs" whose activity has been demonstrated to be optimized or improved for the particular attribute, chemical, physical or biological property. For purposes herein a "LEAD" typically has activity with respect to the function of interest that differs by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more from the unmodified and/or wild type (native) protein. In certain embodiments, the change in activity is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, of the activity of the unmodified target protein. In other embodiments, the change in activity is not more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, of the activity of the unmodified target protein. In yet other embodiments, the change in activity is at least about 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, or more greater than the activity of the unmodified target protein. The desired alteration, which can be either an increase or a reduction in activity, will depend upon the function or property of interest (e.g., ~ 10%, ~20%, etc.). The LEADs may be further optimized by replacement of a plurality (2 or more) of "is-HIT" target positions on the same protein molecule to generate "super-LEADs."
As used herein, the term "super-LEAD" refers to protein mutants (variants) obtained by combining the single mutations present in two or more of the LEAD molecules into a single protein molecule. Accordingly, in the context of the modified proteins provided herein, the phrase "proteins comprising one or more single amino acid replacements"
encompasses any combination of two or more of the mutations described herein for a respective protein. For example, the modified proteins provided herein having one or more single amino acid replacements can have can have any combination of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more of the amino acid replacements at the disclosed replacement positions. The collection of super-LEAD mutant molecules is generated, tested and phenotypically characterized one-by-one in addressable arrays. Super-LEAD mutant molecules are such that each molecule contains a variable number and type of LEAD mutations.
Those molecules displaying further improved fitness for the particular feature being evolved, are referred to as super-LEADs. Super-LEADs can be generated by other methods known to those of skill in the art and tested by the high throughput methods herein. For purposes herein a super-LEAD typically has activity with respect to the function of interest that differs from the improved activity of a LEAD by a desired amount, such as at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more from at least one of the LEAD mutants from which it is derived. As with LEADs, the change in the activity for super-LEADs is dependent upon the activity that is being "evolved." The desired alteration, which can be either an increase or a reduction in activity, will depend upon the function or property of interest.
As used herein, a recitation that modified protein has more antiviral activity (or other activity) than antiproliferative activity (or another activity) compared to the unmodified cytokine, is comparing the absolute value of the change in each activity compared to wild type.
As used herein, the phrase "altered loci" refers to the is-HIT amino acid positions in the LEADs or super-LEADs that are replaced with different replacing amino acids, resulting in the desired altered phenotype or activity.
As used herein, an exposed residue presents more than 15% of its surface exposed to the solvent.

As used herein, the phrase "structural homology" refers to the degree of coincidence in space between two or more protein backbones.
Protein backbones that adopt the same protein structure, fold and show similarity upon three-dimensional structural superposition in space can be considered structurally homologous. Structural homology is not based on sequence homology, but rather on three-dimension homology. Two amino acids in two different proteins said to be homologous based on structural homology between those proteins, do not necessarily need to be in sequence-based homologous regions. For example, protein backbones that have a root mean squared (RMS) deviation of less than 3.5, 3.0, 2.5, 2.0, 1.7 or 1.5 angstrom at a given space position or defined region between each other can be considered to be structurally homologous in that region, and are referred to herein as having a "high coincidence" between their backbones. It is contemplated herein that substantially equivalent (e.g., "structurally related") amino acid positions that are located on two or more different protein sequences that share a certain degree of structural homology will have comparable functional tasks; also referred to herein as "structurally homologous loci." These two amino acids can then be said to be "structurally similar" or "structurally related" with each other, even if their precise primary linear positions on the amino acid sequences, when these sequences are aligned, do not match with each other. Amino acids that are "structurally related" can be far away from each other in the primary protein sequences, when these sequences are aligned following the rules of classical sequence homology.
As used herein, a structural homolog is a protein that is generated by structural homology.
As used herein, the phrase "unmodified target protein,"
"unmodified protein" or "unmodified cytokine," or grammatical variations thereof, refers to a starting protein that is selected for optimization using the methods provided herein. The starting unmodified target protein can be the naturally occurring, wild type form of a protein. In addition, the starting unmodified target protein may have previously been altered or mutated, such that it differs from the native wild type isoform, but is nonetheless referred to herein as an starting unmodified target protein relative to the subsequently modified proteins produced herein. Thus, existing proteins known in the art that have previously been modified to have a desired increase or decrease in a particular biological activity compared to an unmodified reference protein can be selected and used herein as the starting "unmodified target protein." For example, a protein that has been modified from its native form by one or more single amino acid changes and possesses either an increase or decrease in a desired activity, such as resistance to proteolysis, can be utilized with the methods provided herein as the starting unmodified target protein for further optimization of either the same or a different biological activity.
Likewise, existing proteins known in the art that have previously been modified to have a desired increase or decrease in a particular biological activity compared to an unmodified reference protein can be selected and used herein for identification of structurally homologous loci on other structurally homologous target proteins. For example, a protein that has been modified by one or more single amino acid changes and possesses either an increase or decrease in a desired activity, such as resistance to proteolysis, can be utilized with the methods provided herein to identify on structurally homologous target proteins, corresponding structurally homologous loci that can be replaced with suitabale replacing amino acids and tested for either an increase or decrease in the desired biological actiity.

As used herein, the phrase "only one amino acid replacement occurs on each target protein" refers to the modification of a target protein, such that it differs from the unmodified form of the target protein by a single amino acid change. For example, in one embodiment, mutagenesis is performed by the replacement of a single amino acid residue at only one is-HIT target position on the protein backbone (e.g., "one-by-one" in addressable arrays), such that each individual mutant generated is the single product of each single mutagenesis reaction. The single amino acid replacement mutagenesis reactions are repeated for each of the replacing amino acids selected at each of the is-HIT target positions. Thus, a plurality of mutant protein molecules are produced, whereby each mutant protein contains a single amino acid replacement at only one of the is-HIT target positions.
As used herein, the phrase "pseudo-wild type," in the context of single or multiple amino acid replacements, are those amino acids that, while different from the original, such as native, amino acid at a given amino acid position, can replace the native one at that position without introducing any measurable change in a particular protein activity. A
population of sets of nucleic acid molecules encoding a collection of mutant molecules is generated and phenotypically characterized such that proteins with amino acid sequences different from the original amino acid, but that still elicit substantially the same level (i.e., at least 10%, 50%, 70%, 90%, 95%, 100%, depending upon the protein) and type of desired activity as the original protein are selected.
As used herein, biological and pharmacological activity includes any activity of a biological pharmaceutical agent and includes, but is not limited to, resistance to proteolysis, biological efficiency, transduction efficiency, gene/transgene expression, differential gene expression and induction activity, titer, progeny productivity, toxicity, cytotoxicity, immunogenicity, cell proliferation and/or differentiation activity, anti-viral activity, morphogenetic activity, teratogenetic activity, pathogenetic activity, therapeutic activity, tumor suppressor activity, ontogenetic activity, oncogenetic activity, enzymatic activity, pharmacological activity, cell/tissue tropism and delivery.
As used herein, "output signal" refers to parameters that can be followed over time and, if desired, quantified. For example, when a recombinant protein is introduced into a cell, the cell containing the recombinant protein undergoes a number of changes. Any such change that can be monitored and used to assess the transformation or transfection, is an output signal, and the cell is referred to as a reporter cell; the encoding nucleic acid is referred to as a reporter gene, and the construct that includes the encoding nucleic acid is a reporter construct.
Output signals include, but are not limited to, enzyme activity, fluorescence, luminescence, amount of product produced and other such signals. Output signals include expression of a gene or gene product, including heterologous genes (transgenes) inserted into the plasmid virus.
Output signals are a function of time ("t") and are related to the amount of protein used in the composition. For higher concentrations of protein, the output signal can be higher or lower. For any particular concentration, the output signal increases as a function of time until a plateau is reached. Output signals can also measure the interaction between cells, expressing heterologous genes, and biological agents As used herein, the activity of an IFNa-2b or IFNa-2a protein refers to any biological activity that can be assessed. In particular, herein, the activity assessed for the IFNa-2b or IFNa-2a proteins is resistance to proteolysis, antiviral activity and cell proliferation activity.

As used herein, the Hill equation is a mathematical model that relates the concentration of a drug (i.e., test compound or substance) to the response measured D"
~max~
y = [D]" + [Dso]"
where y is the variable measured, such as a response, signal, ymax is the maximal response achievable, [D] is the molar concentration of a drug, [D5o] is the concentration that produces a 50% maximal response to the drug, n is the slope parameter, which is 1 if the drug binds to a single site and with no cooperativity between or among sites. A Hill plot is logo of the ratio of ligand-occupied receptor to free receptor vs. log [D] (M). The slope is n, where a slope of greater than 1 indicates cooperativity among binding sites, and a slope of less than 1 can indicate heterogeneity of binding. This general equation has been employed for assessing interactions in complex biological systems (see, published International PCT application No. WO 01 /44809 based on PCT No. PCT/FR00/03503, see also, the EXAMPLES).
As used herein, in the Hill-based analysis (published International PCT application No. WO 01 /44809 based on PCT No. PCT/FR00/03503), the parameters, rr,K,r,E,ri,6, are as follows:
rr is the potency of the biological agent acting on the assay (cell-based) system;
K is the constant of resistance of the assay system to elicit a response to a biological agent;
E is the global efficiency of the process or reaction triggered by the biological agent on the assay system;
r is the apparent titer of the biological agent;
8 is the absolute titer of the biological agent; and r~ is the heterogeneity of the biological process or reaction.
In particular, as used herein, the parameters rr (potency) or K
(constant of resistance) are used to respectively assess the potency of a test agent to produce a response in an assay system and the resistance of the assay system to respond to the agent.
As used herein, E (efficiency), is the slope at the inflexion point of the Hill curve (or, in general, of any other sigmoidai or linear approximation), to assess the efficiency of the global reaction (the biological agent and the assay system taken together) to elicit the biological or pharmacological response.
As used herein, r (apparent titer) is used to measure the limiting dilution or the apparent titer of the biological agent.
As used herein, 8 (absolute titer), is used to measure the absolute limiting dilution or titer of the biological agent.
As used herein, r~ (heterogeneity) measures the existence of discontinuous phases along the global reaction, which is reflected by an abrupt change in the value of the Hill coefficient or in the constant of resistance.
As used herein, a population of sets of nucleic acid molecules encoding a collection (library) of mutants refers to a collection of plasmids or other vehicles that carry (encode) the gene variants, such that individual plasmids or other individual vehicles carry individual gene variants. Each element (member) of the collection is physically separated from the others, such as .individually in an appropriate addressable array, and has been generated as the single product of an independent mutagenesis reaction. When a collection (library) of such proteins is contemplated, it will be so-stated.
As used herein, a "reporter cell" is the cell that "reports," i.e., undergoes the change, in response to a condition, such as, for example, exposure to a protein or a virus or to a change it its external or internal environment.
As used herein, "reporter" or "reporter moiety" refers to any moiety.
that allows for the detection of a molecule of interest, such as a protein expressed by a cell. Reporter moieties include, but are not limited to, for example, fluorescent proteins, such as red, blue and green fluorescent proteins; LacZ and other detectable proteins and gene products. For expression in cells, nucleic acid encoding the reporter moiety can be expressed as a fusion protein with a protein of interest or under to the control of a promoter of interest.
As used herein, phenotype refers to the physical, physiological or other manifestation of a genotype (a sequence of a gene). In methods herein, phenotypes that result from alteration of a genotype are assessed.
As used herein, "activity" means in the largest sense of the term any change in a system (either biological, chemical or physical system) of any nature (changes in the amount of product in an enzymatic reaction, changes in cell proliferation, in immunogenicity, in toxicity) caused by a protein or protein mutarit when they interact with that system. In addition, the term "activity," "higher activity" or "lower activity" as used herein in reference to resistance to proteases, proteolysis, incubation with serum or with blood, means the ratio or residual biological (antiviral) activity between "after" protease/blood or serum treatment and "before"
protease/blood or serum treatment.
As used herein, activity refers to the function or property to be evolved. An active site refers to a sites) responsible or that participates in conferring the activity or function. The activity or active site evolved (the function or property and the site conferring or participating in conferring the activity) can have nothing to do with natural activities of a protein. For example, it could be an 'active site' for conferring immunogenicity (immunogenic sites or epitopes) on a protein.
As used herein, the amino acids, which occur in the various amino acid sequences appearing herein, are identified according to their known, three-letter or one-letter abbreviations (see, Table 1 ). The nucleotides, which occur in the various nucleic acid fragments, are designated with the standard single-letter designations used routinely in the art.
As used herein, amino acid residue refers to an amino acid formed upon chemical digestion (hydrolysis) of a polypeptide at its peptide linkages. The amino acid residues described herein are presumed to be in the "L" isomeric form. Residues in the "D" isomeric form, which are so-designated, can be substituted for any L-amino acid residue, as long as the desired functional property is retained by the polypeptide. NHS refers to the free amino group present at the amino terminus of a polypeptide.
COOH refers to the free carboxy group present at the carboxyl terminus of a polypeptide. In keeping with standard polypeptide nomenclature described in J. Biol. Chem., 243:3552-3559, 1969, and adopted at 37 C.F.R. ~ ~ 1.821 - 1.822, abbreviations for amino acid residues are shown in Table 1:
Table 1 Table of Correspondence SYMBOL

1-Letter 3-Letter AMINO ACID

Y Tyr tyrosine G Gly glycine F Phe phenylalanine M Met methionine A Ala alanine SYM BOL

S Ser serine I Ile isoleucine L Leu leucine T Thr threonine V Val valine P Pro proline K Lys lysine H His histidine Q Gln glutamine E Glu glutamic acid Z Glx Glu and/or Gln W Trp tryptophan R Arg arginine D Asp aspartic acid N Asn asparagine B Asx Asn and/or Asp C Cys cysteine X Xaa Unknown or other It should be noted that all amino acid residue sequences represented herein by formulae have a left to right orientation in the conventional direction of amino-terminus to carboxyl-terminus. In addition, the phrase "amino acid residue" is broadly defined to include the amino acids listed in the Table of Correspondence (Table 1 ) and modified and unusual amino acids, such as those referred to in 37 C.F.R. ~ ~
1.821-1.822, and incorporated herein by reference. Furthermore, it should be noted that a dash at the beginning or end of an amino acid residue sequence indicates a peptide bond to a further sequence of one or more amino acid residues or to an amino-terminal group such as NH2 or to a carboxyl-terminal group such as COOH.
As used herein, nucleic acids include DNA, RNA and analogs thereof, including protein nucleic acids (PNA) and mixture thereof.
Nucleic acids can be single or double stranded. When referring to probes or primers, optionally labeled, with a detectable label, such as a fluorescent or radiolabel, single-stranded molecules are contemplated.
Such molecules are typically of a length such that they are statistically unique of low copy number (typically less than 5, generally less than 3) for probing or priming a library. Generally a probe or primer contains at least 14, 7 6 or 30 contiguous of sequence complementary to or identical a gene of interest. Probes and primers can be 10, 14, 16, 20, 30, 50, 100 or more nucleic acid bases long.
Therefore, as used herein, the term "identity" represents a comparison between a test and a reference polypeptide or polynucleotide.
For example, a test polypeptide can be defined as any polypeptide that is 90% or more identical to a reference polypeptide.
As used herein, "corresponding structurally-related" positions on two or more proteins, such as the IFNa-2b protein and other cytokines, refers those amino acid positions determined based upon structural homology to maximize tri-dimensional overlapping between proteins.
As used herein, the term at least "90% identical to" refers to percent identities from 90 to 100% relative to the reference polypeptides.
Identity at a level of 90% or more is indicative of the fact that, assuming for exemplification purposes a test and reference polypeptide length of 100 amino acids are compared. No more than 10% (i.e., 10 out of 100) amino acids in the test polypeptide differ from that of the reference polypeptides. Similar comparisons can be made between a test and reference polynucleotides. Such differences can be represented as point mutations randomly distributed over the entire length of an amino acid sequence or they can be clustered in one or more locations of varying length up to the maximum allowable, e.g., 10/100 amino acid difference (approximately 90% identity). Differences are defined as nucleic acid or amino acid substitutions, or deletions.
As used herein, the phrase "sequence-related proteins" refers to proteins that have at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% amino acid identity or homology with each other.
As used herein, families of non-related proteins or "sequence-non-related proteins" refers to proteins that have less than 50%, less than 40%, less than 0%, less thant 20% amino acid identity or homology with each other.
As used herein, it also is understood that the terms "substantially identical" or "similar" varies with the context as understood by those skilled in the relevant art.
As used herein, heterologous or foreign nucleic acid, such as DNA
and RNA, are used interchangeably and refer to DNA or RNA that does not occur naturally as part of the genome in which it is present or which is found in a location or locations in the genome that differ from that in which it occurs in nature. Heterologous nucleic acid is generally not endogenous to the cell into which it is introduced, but has been obtained from another cell or prepared synthetically. Generally, although not necessarily, such nucleic acid encodes RNA and proteins that are not normally produced by the cell in which it is expressed. Heterologous DNA herein encompasses any DNA or RNA that one of skill in the art would recognize or consider as heterologous or foreign to the cell in which it is expressed. Heterologous DNA and RNA can also encode RNA

or proteins that mediate or alter expression of endogenous DNA by affecting transcription, translation, or other regulatable biochemical processes. Examples of heterologous nucleic acid include, but are not limited to, nucleic acid that encodes traceable marker proteins, such as a protein that confers drug resistance, nucleic acid that encodes therapeutically effective substances, such as anti-cancer agents, enzymes and hormones, and DNA that encodes other types of proteins, such as antibodies.
Hence, herein heterologous DNA or foreign DNA, includes a DNA
molecule not present in the exact orientation and position as the counterpart DNA molecule found in the genome. It can also refer to a DNA molecule from another organism or species (i.e., exogenous).
As used herein, a therapeutically effective dose refers to that amount of the compound sufficient to result in amelioration of symptoms of disease.
As used herein, isolated with reference to a nucleic acid molecule or polypeptide or other biomolecule means that the nucleic acid or polypeptide has separated from the genetic environment from which the polypeptide or nucleic acid were obtained. It can also mean altered from the natural state. For example, a polynucleotide or a polypeptide naturally present in a living animal is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated," as the term is employed herein. Thus, a polypeptide or polynucleotide produced and/or contained within a recombinant host cell is considered isolated. Also intended as an "isolated polypeptide" or an "isolated polynucleotide" are polypeptides or polynucleotides that have been purified, partially or substantially, from a recombinant host cell or from a native source. For example, a recombinantly produced version of a compound can be substantially purified by the one-step method described in Smith et al., Gene, 67:31-40, 1988. The terms isolated and purified are sometimes used interchangeably.
Thus, by "isolated" is meant that the nucleic is free of the coding sequences of those genes that, in the naturally-occurring genome of the organism (if any) immediately flank the gene encoding the nucleic acid of interest. Isolated DNA can be single-stranded or double-stranded, and can be genomic DNA, cDNA, recombinant hybrid DNA, or synthetic DNA.
It can be identical to a starting DNA sequence, or can differ from such sequence by the deletion, addition, or substitution of one or more nucleotides.
Isolated or purified as it refers to preparations made from biological cells or hosts means any cell extract containing the indicated DNA or protein including a crude extract of the DNA or protein of interest. For example, in the case of a protein, a purified preparation can be obtained following an individual technique or a series of preparative or biochemical techniques and the DNA or protein of interest can be present at various degrees of purity in these preparations. The procedures can include for example, but are not limited to, ammonium sulfate fractionation, gel filtration, ion exchange change chromatography, affinity chromatography, density gradient centrifugation and electrophoresis.
A preparation of DNA or protein that is "substantially pure" or "isolated" should be understood to mean a preparation free from naturally .occurring materials with which such DNA or protein is normally associated in nature. "Essentially pure" should be understood to mean a "highly" purified preparation that contains at least 95% of the DNA or protein of interest.
A cell extract that contains the DNA or protein of interest should be understood to mean a homogenate preparation or cell-free preparation obtained from cells that express the protein or contain the DNA of interest. The term "cell extract" is intended to include culture media, especially spent culture media from which the cells have been removed.
As used herein, "a targeting agent" refers to any molecule that can bind another target-molecule, such as an antibody, receptor, or ligand.
As used herein, receptor refers to a biologically active molecule that specifically binds to (or with) other molecules. The term "receptor protein" can be used to more specifically indicate the proteinaceous nature of a specific receptor.
As used herein, recombinant refers to any progeny formed as the result of genetic engineering.
As used herein, a promoter region refers to the portion of DNA of a gene that controls transcription of the DNA to which it is operatively linked. The promoter region includes specific sequences of DNA that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter. In addition, the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of the RNA polymerase. These sequences can be cis acting or can be responsive to traps acting factors. Promoters, depending upon the nature of the regulation, can be constitutive or regulated.
As used herein, the phrase "operatively linked" generally means the sequences or segments have been covalently joined into one piece of DNA, whether in single or double stranded form, whereby control or regulatory sequences on one segment control or permit expression or replication or other such control of other segments. The two segments are not necessarily contiguous. For gene expression a DNA sequence and a regulatory sequences) are connected in such a way to control or permit gene expression when the appropriate molecular, e.g., transcriptional activator proteins, are bound to the regulatory sequence(s).

As used herein, production by recombinant means by using recombinant DNA methods means the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA, including cloning expression of genes and methods, such as gene shuffling and phage display with screening for desired specificities.
As used herein, a splice variant refers to a variant produced by differential processing of a primary transcript of genomic DNA that results in more than one type of mRNA.
As used herein, a composition refers to any mixture of two or more products or compounds. It can be a solution, a suspension, liquid;
powder, a paste, aqueous, non-aqueous or any combination thereof.
As used herein, a combination refers to any association between two or more items.
As used herein, substantially identical to a product means sufficiently similar so that the property of interest is sufficiently unchanged so that the substantially identical product can be used in place of the product.
As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
One type of exemplary vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Exemplary vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors." In general, expression vectors of utility in recombinant DNA
techniques are often in the form of "plasmids" which refer generally to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. "Plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. Other such other forms of expression vectors that serve equivalent functions and that become known in the art subsequently hereto.
As used herein, vector also is used interchangeable with "virus vector" or "viral vector. In this case, which will be clear from the context, the "vector" is not self-replicating. Viral vectors are engineered viruses that are operatively linked to exogenous genes to transfer (as vehicles or shuttles) the exogenous genes into cells.
As used herein, transduction refers to the process of gene transfer into and expression in mammalian and other cells mediated by viruses.
Transfection refers to the process when mediated by plasmids.
As used herein, transformation refers to the process of gene transfer into and expression in bacterial cells mediated by plasmids.
As used herein, "allele," which is used interchangeably herein with "allelic variant" refers to alternative forms of a gene or portions thereof.
Alleles occupy the same locus or position on homologous chromosomes.
When a subject has two identical alleles of a gene, the subject is said to be homozygous for the gene or allele. When a subject has two different alleles of a gene, the subject is said to be heterozygous for the gene.
Alleles of a specific gene can differ from each other in a single nucleotide, or several nucleotides, and can include substitutions, deletions, and insertions of nucleotides. An allele of a gene also can be a form of a gene containing a mutation.
As used herein, the term "gene" or "recombinant gene" refers to a nucleic acid molecule comprising an open reading frame and including at least one exon and (optionally) an intron sequence. A gene can be either RNA or DNA. Genes can include regions preceding and following the coding region (leader and trailer).

As used herein, "intron" refers to a DNA sequence present in a given gene which is spliced out during mRNA maturation.
As used herein, "nucleotide sequence complementary to the nucleotide sequence set forth in SEQ ID NO:" refers to the nucleotide sequence of the complementary strand of a nucleic acid strand having the particular SEQ ID NO:. The term "complementary strand" is used herein interchangeably with the term "complement." The complement of a nucleic acid strand can be the complement of a coding strand or the complement of a non-coding strand. When referring to double stranded nucleic acids, the complement of a nucleic acid having a particular SEQ ID
NO: refers to the complementary strand of the strand set forth in the particular SEQ ID NO: or to any nucleic acid having the nucleotide sequence of the complementary strand of the particular SEQ ID NO:.
When referring to a single stranded nucleic acid having a nucleotide sequence corresponding to a particular SEQ ID NO:, the complement of this nucleic acid is a nucleic acid having a nucleotide sequence which is complementary to that of the particular SEQ ID NO:.
As used herein, the term "coding sequence" refers to that portion of a gene that encodes an amino acid sequence of a protein.
As used herein, the term "sense strand" refers to that strand of a double-stranded nucleic acid molecule that has the sequence of the mRNA that encodes the amino acid sequence encoded by the double-stranded nucleic acid molecule.
As used herein, the term "antisense strand" refers to that strand of a double-stranded nucleic acid molecule that is the complement of the sequence of the mRNA that encodes the amino acid sequence encoded by the double-stranded nucleic acid molecule.
As used herein, an array refers to a collection of elements, such as nucleic acid molecules, containing three or more members. An addressable array is one in which the members of the array are identifiable, typically by position on a solid phase support or by virtue of an identifiable or detectable label, such as by color, fluorescence, electronic signal (i.e., RF, microwave or other frequency that does not substantially alter the interaction of the molecules of interest), bar code or other symbology, chemical or other such label. In certain embodiments, the members of the array are immobilized to discrete identifiable loci on the surface of a solid phase or directly or indirectly linked to or otherwise associated with the identifiable label, such as affixed to a microsphere or other particulate support (herein referred to as beads) and suspended in solution or spread out on a surface.
As used herein, a support (also referred to as a matrix support, a matrix, an insoluble support or solid support) refers to any solid or semisolid or insoluble support to which a molecule of interest, typically a biological molecule, organic molecule or biospecific ligand is linked or contacted. Such materials include any materials that are used as affinity matrices or supports for chemical and biological molecule syntheses and analyses, such as, but are not limited to: polystyrene, polycarbonate, polypropylene, nylon, glass, dextran, chitin, sand, pumice, agarose, polysaccharides, dendrimers, buckyballs, polyacryl-amide, silicon, rubber, and other materials used as supports for solid phase syntheses, affinity separations and purifications, hybridization reactions, immunoassays and other such applications. The matrix herein can be particulate or can be in the form of a continuous surface, such as a microtiter dish or well, a glass slide, a silicon chip, a nitrocellulose sheet, nylon mesh, or other such materials. When particulate, typically the particles have at least one dimension in the 5-10 mm range or smaller. Such particles, referred collectively herein as "beads," are often, but not necessarily, spherical.
Such reference, however, does not constrain the geometry of the matrix, which can be any shape, including random shapes, needles, fibers, and elongated. Roughly spherical "beads," particularly microspheres that can be used in the liquid phase, also are contemplated. The "beads" can include additional components, such as magnetic or paramagnetic particles (see, e.g., Dynabeads (Dynal, Oslo, Norway)) for separation using magnets, as long as the additional components do not interfere with the methods and analyses herein.
As used herein, a mafirix or support particles refers to matrix materials that are in the form of discrete particles. The particles have any shape and dimensions, but typically have at least one dimension that is 100 mm or less, 50 mm or less, 10 mm or less, 1 mm or less, 100 ,um or less, 50 ,um or less and typically have a size that is 100 mm~ or less, 50 mm3 or less, 10 mm3 or less, and 1 mm3 or less, 100 ~m3 or less and can be order of cubic microns. Such particles are collectively called "beads."
As used herein, the abbreviations for any protective groups, amino acids and other compounds, are, unless indicated otherwise, in accord with their common usage, recognized abbreviations, or the IUPAC-IUB
Commission on Biochemical Nomenclature (see, Biochem., 11:942-944, 1972).
B. Directed Evolution To date, there have been three general approaches described for protein directed evolution based on mutagenesis.
1 ) Pure Random Mutagenesis Random mutagenesis methodology requires that the amino acids in the starting protein sequence are replaced by all (or a group) of the 20 amino acids. Either single or multiple replacements at different amino acid positions are generated on the same molecule, at the same time.
The random mutagenesis method relies on a direct search for fitness improvement based on random amino acid replacement and sequence changes at multiple amino acid positions. In this approach neither the amino acid position (first dimension) nor the amino acid type (second dimension) are restricted; and everything possible is generated and tested.
Multiple replacements can randomly happen at the same time on the same molecule. For example, random mutagenesis methods are widely used to develop antibodies with higher affinity for its ligand, by the generation of random-sequence libraries of antibody molecules, followed by expression and screening using filamentous phages.
2) Restricted Random Mutagenesis Restricted random mutagenesis methods introduce either all of the amino acids or DNA-biased residues, wherein the bias is based on the sequence of the DNA and not on that of the protein, in a stochastic or semi-stochastic manner, respectively, within restricted or predefined regions of the protein, known in advance to be involved in the biological 15 activity being "evolved." This method relies on a direct search for fitness improvement based on random amino acid replacement and sequence changes at either restricted or multiple amino acid positions. In this approach the scanning can be restricted to selected amino acid positions and/or amino acid types, while material changes continue to be random in 20 position and type. For example, the amino acid position can be restricted by prior selection of the target region to be mutated (selection of target region is based upon prior knowledge on protein structure/function); while the amino acid type is not primarily restricted as replacing amino acids are stochastically or at most "semi-stochastically" chosen. As an example, this method is used to optimize known binding sites on proteins, including hormone-receptor systems and antibody-epitope systems.

3) Non-restricted Rational mutagenesis Rational mutagenesis is a two-step process and is described in co-pending U.S. application Serial No. 10/022,249. Briefly, the first step requires amino acid scanning where all and each of the amino acids in the starting protein sequence are replaced by a third amino acid of reference (e.g., alanine). Only a single amino acid is replaced on each protein molecule at a time. A collection of protein molecules having a single amino acid replacement is generated such that molecules differ from each other by the amino acid position at which the replacement has taken place. Mutant DNA molecules are designed, generated by mutagenesis and cloned individually, such as in addressable arrays, such that they are physically separated from each other and such that each one is the single product of an independent mutagenesis reaction. Mutant protein molecules derived from the collection of mutant nucleic acid molecules also are physically separated from each other, such as by formatting in addressable arrays. Activity assessment on each protein molecule allows for the identification of those amino acid positions that result in a drop in activity when replaced, thus indicating the involvement of that particular amino acid position in the protein's biological activity and/or conformation that leads to fitness of the particular feature being evolved. Those amino acid positions are referred to as HITs. At the second step, a new collection of molecules is generated such that each molecule differs from each of the others by the amino acid present at the individual HIT
positions identified in step 1. All 20 amino acids (19 remaining) are introduced at each of the HIT positions identified in step 1; while each individual molecule contains, in principle, one and only one amino acid replacement. Mutant DNA molecules are designed, generated by mutagenesis and cloned individually, such as in in addressable arrays, such that they are physically separated from each other and such that each one is the single product of an independent mutagenesis reaction.
Mutant protein molecules derived from the collection of mutant DNA
molecules also are physically separated from each other, such as by formatting in addressable arrays. Activity assessment then is individually performed on each individual mutant molecule. The newly generafied mutants that lead to a desired alteration (such as an improvement) in a protein activity are referred to as LEADs. This method permits an indirect search for activity alteration, such as improvement, based on one rational amino acid replacement and sequence change at a single amino acid position at a time, in search of a new, unpredicted amino acid sequence at some unpredicted regions along a protein to produce a protein that exhibits a desired activity or altered activity, such as better performance than the starting protein.
In this approach, neither the amino acid position nor the replacing amino acid type are restricted. Full length protein scanning is performed during the first step to identify HIT positions, and then all 20 amino acids are tested at each of the H!T positions, to identify LEAD sequences;
while, as a starting point, only one amino acid at a time is replaced on each molecule. The selection of the target region (HITs and surrounding amino acids) for the second step is based upon experimental data on activity obtained in the first step. Thus, no prior knowledge of protein structure and/or function is necessary. Using this approach, LEAD
sequences have been found on proteins that are located at regions of the protein not previously known to be involved in the particular biologics( activity being optimized; thus emphasizing the power of this approach to discover unpredictable regions (HITs) as targets for fitness improvement.
C. 2-Dimensional Rational Scanning The 2-Dimensional rational scanning (or "2-dimensional scanning") methods for protein rational evolution provided herein (see, also copending U.S. application Serial No. Attorney docket no. 923, filed the same day herewith, based on U.S. provisional application Serial Nos.
60/457,063 and 60/410,258) are based on scanning aver two dimen-sions. The first dimension scanned is amino acid position along the protein sequence to identify is-HIT target positions, and the second dimension is the amino acid type selected for replacing a particular is-HIT
amino acid position. An advantage of the 2-dimensional scanning methods provided herein is that at least one, and typically both, of the amino acid position scan and/or the replacing amino acid scan can be restricted such that fewer than all amino acids on the protein-backbone are selected for amino acid replacement; and/or fewer than all of the remaining 19 amino acids available to replace an original, such as native, amino acid are selected for replacement.
In particular embodiments, based on i~ the particular protein properties to be evolved, ii7 the protein's amino acid sequence, and iii the known properties of the individual amino acids, a number of target positions along the protein sequence are selected, in silico, as "is-HIT
target positions." This number of is-HIT target positions is as large as possible such that all reasonably possible target positions for the particular feature being evolved are included. In particular, embodiments where a restricted number of is-HIT target positions are selected for replacement, the amino acids selected to replace the is-HIT target positions on the particular protein being optimized can be either all of the remaining 19 amino acids or, more frequently, a more restricted group comprising selected amino acids that are contemplated to have the desired effect on protein activity. In another embodiment, so long as a restricted number of replacing amino acids are used, all of the amino acid positions along the protein backbone can be selected as is-HIT target positions for amino acid replacement. Mutagenesis then is performed by the replacement of single amino acid residues at specific is-HIT target positions on the protein backbone (e.g., "one-by-one," such as in addressable arrays), such that each individual mutant generated is the single product of each single mutagenesis reaction. Mutant DNA
molecules are designed, generated by mutagenesis and cloned individually, such as in addressable arrays, such that they are physically separated from each other and that each one is the single product of an independent mutagenesis reaction. Mutant protein molecules derived from the collection of mutant DNA molecules also are physically separated from each other, such as by formatting in in addressable arrays. Thus, a plurality of mutant protein molecules are produced. Each mutant protein contains a single amino acid replacement at only one of the is-HIT target positions. Activity assessment is then individually performed on each individual protein mutant molecule, following protein expression and measurement of the appropriate activity. An example of practice of this this method is shown in the Example in which mutant IFNa molecules and IFN~3 moleucles are produced.
The newly generated proteins that lead to altered, typically improvement, in a target protein activity are referred to as LEADs. This method relies on an indirect search for protein improvement for a particular activity, such as increased resistance to proteolysis, based on a rational amino acid replacement and sequence change at single or, in another embodiment, a limited number of amino acid positions at a time.
As a result, optimized proteins that have new amino acid sequences at some regions along the protein that perform better (at a particular target activity or other property) than the starting protein are identified and isolated.

1 ) Identifying in-silico HITs Provided herein is a method for directed evolution that includes identifying and selecting {using in silico analysis) specific amino acids and amino acid positions (referred to herein as is-HITs) along the protein sequence that are contemplafied to be directly or indirectly involved in the feature being evolved. As noted, the 2-dimensional scanning methods provided include the following two-steps. The first step is an in silico search of a target protein's amino acid sequence to identify all possible amino acid positions that potentially can be targets for the activity being evolved. This is effected, for example, by assessing the effect of amino acid residues on the property{ies) to be altered on the protein, using any known standard software. The particulars of the in silico analysis is a function of the property to be modified. For example, in the example herein, a property that is altered resistance of the protein to proteolysis..
To determine aminoacid residues that are potential targets as is-HITs, in this example, all possible target residues for proteases were first identified. The 3-dimensional structure of the protein was then considered in order to identify surface residues. Comparison of exposed residues with proteolytically cleavable residues yields residues that are targets for change.
Once identified, these amino acid positions or target sequences are referred to as "is-HITs" (in silico HITsj. In silico HiTs are defined as those amino acid positions (or target positions) that potentially are involved in the "evolving" feature, such as increased resistance to proteolysis. In one embodiment, the discrimination of the is-HITs among all the amino acid positions in a protein sequence is made based on i7 the amino acid type at each position in addition to, whenever available but not necessarily, iii the information on the protein secondary or tertiary structure. In silico HITs constitute a collection of mutant molecules such that all possible amino acids, amino acid positions or target sequences potentially involved in the evolving feature are represented. No strong theoretical discrimination among amino acids or amino acid positions is made at this stage.
/n silico HIT positions are spread over the full length of the protein sequence. In one embodiment, only a single is-HIT amino acid at a time is replaced on the target protein. In another embodiment, a limited number of is-HIT amino acids are replaced at the same time on the same target protein molecule. The selection of target regions (is-HITs and surrounding amino acids) for the second step is based upon rational assumptions and predictions. No prior knowledge of protein structure/function is necessary. Hence, the 2-dimensional scanning methodology provided herein does not require any previous knowledge of the 3-dimensional conformational structure of the protein.
Any protein known or otherwise available to those of skill in the art is suitable for optimization using the directed evolution methods provided herein, including cytokines (e.g., IFNa-2b) or any other proteins that have previously been mutated or optimized.
A variety of parameters can be analyzed to determine whether or not a particular amino acid on a protein might be involved in the evolving feature. For example, the information provided by crystal structures of proteins can be rationally exploited in order to perform a computer-assisted (in silico) analysis fiowards the prediction of variants with desired features. In a particular embodiment, a limited number of initial premises (typically no more than 2) are used to determine the in silico HITs. In other embodiments, the number of premises used to determine the in silico hits can range from ~ to y 0 premises, including no more than 9, no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, but are typically no more than 2 premises. It is important to the methods provided herein that the number of initial premises be kept to a minimum, so as to maintain the number of potential is-HITs at a maximum (here is where the methods provided are not limited by too much prediction based on theoretical assumptions). When two premises are employed, the first condition is typically the amino acid type itself, which is directly linked to the nature of the evolving feature. For example, if the goal were to change the optimum pH for an enzyme, then the replacing amino acids selected at this step for the replacement of the original sequence would be only those with a certain plCa value. The second premise is typically related to the specific position of those amino acids along the protein structure. For example, some amino acids might be discarded if they are not expected to be exposed enough to the solvent, even when they might have appropriate pKa values.
During the first step of identification of is-HITs according to the methods provided herein, each individual amino acid along the protein sequence is considered individually to assess whether it is a candidate for is-H1T. This search is done one-by-one and the decision on whether the amino acid is considered to be a candidate for a is-HIT is based on (1) the amino acid type itself; (2) the position on the amino acid sequence and protein structure if known; and (3) the predicted interaction between that amino acid and its neighbors in sequence and space.
Using the 3D-scanning methods provided herein, once one protein within a family of proteins (e.g., IFNa-2b within the cytokine family) is optimized using the methods provided herein for generating LEAD
mutants, is-HITs can be identified on other or all proteins within a particular family by identifying the corresponding amino acid positions therein using structural homology analysis (based upon comparisons of the 3-D structures of the family members with original protein to identify corresponding residues for replacement) as described hereinafter. The is-HITs on family identified in this manner then can be subjected to the next step of identifying replacing amino acids and further assayed to obtain LEADs or super-LEADs as described herein.
2) Identifying Replacing Amino Acids Once the is-HITs target positions are selected, the next step is identifying those amino acids that will replace the original, such as native, amino acid at each is-HIT position to alter the activity level for the particular feature being evolved. The set of replacing amino acids to be used to replace the original, such as native, amino acid at each is-HIT
position can be different and specific for the particular is-HIT position.
The choice of the replacing amino acids takes into account the need to preserve the physicochemical properties such as hydrophobicity, charge and polarity, of essential (e.g., catalytic, binding, etc.) residues. The number of replacing amino acids, of the remaining 19 non-native (or non-original) amino acids, that can be used to replace a particular is-HIT target position ranges from 1 up to about 19, from 1 up to about 15, from 1 up to about 10, from 1 up to about 9, from 1 up to about 8, from 1 up to about 7, from 1 up to about 6, from 1 up to about 5, from 1 up to about 4, from 1 up to about 3, or from 1 to 2 amino acid replacements.
Numerous methods of selecting replacing amino acids (also referred to herein as "replacement amino acids") are well known in the art.
Protein chemists determined that certain amino acid substitutions commonly occur in related proteins from different species. As the protein still functions with these substitutions, the substituted amino acids are compatible with protein structure and function. Often, these substitutions are to a chemically similar amino acid, but other types of changes, although relatively rare, can also occur.
Knowing the types of changes that are most and least common in a large number of proteins can assist with predicting alignments and amino acid substitutions for any set of protein sequences. Amino acid substitution matrices are used for this purpose.
In amino acid substitution matrices, amino acids are listed across the top of a matrix and down the side, and each matrix position is filled with a score that reflects how often one amino acid would have been paired with the other in an alignment of related protein sequences. The probability of changing amino acid A into amino acid B is assumed to be identical to the reverse probability of changing B into A. This assumption is made because, for any two sequences, the ancestor amino acid in the phylogenetic tree is usually not known. Additionally, the likelihood of replacement should depend on the product of the frequency of occurrence of the two amino acids and on their chemical and physical similarities. A
prediction of this model is that amino acid frequencies will not change over evolutionary time (Dayhoff et al., Atlas of Protein Sequence and Structure, 5~3 ,:345-352, 1978). Below are several exemplary amino acid substitution matrices, including, but not limited to block substitution matrix (BLOSUM), Jones, Gonnet, Fitch, Feng, McLachlan, Grantham, Miyata, Rao, Risler, Johnson and percent accepted mutation (PAM). Any such method known to those of skill in the art can be employed.
(a) Percent accepted mutation (PAM) Dayhoff and coworkers developed a model of protein evolution that resulted in the development of a set of widely used replacement matrices (Dayhoff et al., Atlas of Protein Sequence and Structure, 5:345-352, 1978) termed percent accepted mutation matrices (PAM1. In deriving these matrices, each change in the current amino acid at a particular site is assumed to be independent of previous mutational events at that site.
Thus, the probability of change of any amino acid A to amino acid B is the same, regardless of the previous changes at that site and also regardless of the position of amino acid A in a protein sequence.

In the Dayhoff approach, replacement rates are derived from alignments of protein sequences that are at least 85% identical; this constraint ensures that the likelihood of a particular mutation being the result of a set of successive mutations is low. Because these changes are observed in closely related proteins, they represent amino acid substitutions that do not significantly change the function of the protein.
Hence, they are called "accepted mutations," as defined as amino acid changes that are accepted by natural selection.
(i) PAM Analysis In particular embodiments of the methods provided herein, "Percent Accepted Mutation" (PAM; Dayhoff et al., Atlas of Protein Sequence and Structure, 5:345-352, 1978 FIG2) PAM values are used to select an appropriate group of replacement amino acids. PAM matrices were originally developed to produce alignments between protein sequences based evolutionary distances. Because, in a family of proteins or homologous (related) sequences, identical or similar amino acids (85%
similarity) are shared, conservative substitutions for, or allowed point mutations of the corresponding amino acid residues can be determined throughout an aligned reference sequence. In this regard, "conservative substitutions" of a residue in a reference sequence are those substitutions that are physically and functionally similar to the corresponding reference residues, e.g., that have a similar size, shape, electric charge, chemical properties, including the ability to form covalent or hydrogen bonds, or the like. Particularly suitable conservative amino acid substitutions are those that show the highest scores and fulfill the PAM matrix criteria in the form of "accepted point mutations." For example, by comparing a family of scoring matrices, Dayhoff et al., Atlas of Protein Sequence and Structure, 5:345-352, 1978, found a consistently higher score significance when using PAM250 matrix to analyze a variety of proteins, known to be distantly related.
(ii) PAM 250 In a particular embodiment, the PAM250 matrix set forth in FIG2 is used for determining the replacing amino acids based on similarity criteria.
The PAM250 matrix uses data obtained directly from natural evolution to facilitate the selection of replacing amino acids for the is-HITs to generate conservative mutations without much affecting the overall protein function. By using the PAM250 matrix, candidate replacing amino acids are identified from related proteins from different organisms.
(b) Jones and Gonnet This method (see, e.g., Jones et al., Comput. App/. Biosci., 8:275-282, 1992 and Gonnet et al., Science, 256:1433-1445, 1992) uses much of the same methodology as Dayhoff (see below), but with modern databases. The matrix of Jones et ah, is extracted from Release 15.0 of the SWISS-PROT protein sequence database. Point mutations totaling 59,160 from 16,130 protein sequences were used to calculate a PAM250 (see below) matrix.
The matrix published by Gonnet et al., Science, 256:1433-1445, 1992, was built from a sequence database of 8,344,353 amino acid residues. Each sequence was compared against the entire database, such that 1.7 x 106 subsequent matches resulted for the significant alignments. These matches were then used to generate a matrix with a PAM distance of 250.
(c) FitcH and Feng Fitch, J. Mol. Evol., 16(11:9-16, 1966, used an exchange matrix that contained for each pair (A, B) of amino acid types the minimum number of nucleotides that must be changed to encode amino acid A
instead of amino acid B. Feng et al., J. Moi. Evol., 21:1 12-125, 1985, used an enhanced version of Fitch, J. Moi. Evol., 16(1 ):9-16, 1966, to build a Structure-Genetic matrix. In addition to considering the minimum number of base changes required to encode amino acid B instead of A, this method also considers the structural similarity of the amino acids.
(d) McLachlan, Grantham and Miyata McLachlan, J. Mo/. Biol., 61:409-424 1971, used 16 protein families, each with 2 to 14 members. The 89 sequences were aligned and the pairwise exchange frequency, observed in 9280 substitutions, was used to generate an exchange matrix with values varying from 0 to 9.
Grantham, Science, 185:862-864, 1974, considers composition, polarity and molecular volume of amino acid side-chains, properties that were highly correlated to the relative substitution frequencies tabulated by McLachlan, J. Mol. Biol., 61:409-424, 1971, to build the matrix.
Miyata, J. Mol. Evol., 12:219-236, 1979, uses the volume and polarity values of amino acids published by Grantham, Seience, 185:862-864, 1974. For every amino acid type pair, the difference for both properties was calculated and divided by the standard deviation of all the differences. The square root of the sum of both values is then used in the matrix.
(e) Rao Rao, J. Pept. Protein Res., 29:276-281, 1987, employs five amino acid properties to create a matrix; namely, alpha-helical, beta-strand and reverse-turn propensities as well as polarity and hydrophobicity. The standardized properties were summed and the matrix resealed to the same average as that for PAM (Dayhoff et al., Alas of Protein Sequence and Structure, 5:345-352, 1978).
(f) Risler Risler et al., J. Mol, Biol., 204:1019-1029, 1988, aligned 32 three-dimensional structures from 1 1 protein families by rigid-body superposition of the backbone topology. Only substitutions were considered where at feast three adjacent and equivalent main-chain C°
atom pairs in the compared structures were each not more than 1.2 A
apart. A Iota! of 2860 substitutions were considered and used to build a matrix based on X2 distance calculations.
(g) Johnson Johnson et al., J. Mol. Bial., 233:716-738, 1993, derived their matrix from the tertiary structural alignment of 65 families in a database of 235 structures created with the method of Sali et al., J. Mol. Biol., 212:403-428, 1990. Their examination of the substitutions was based on the expected and observed ratios of occurrences and the final matrix values were taken as logo of the ratios.
(h) Block Substitution Matrix (BLOSUM) One empirical approach (Henikoff et al., Proc. Nat/. Aead. Sci.
USA, 89:10915-10919, 1992) uses local, ungapped alignments of distantly related sequences to derive the blocks amino acid substitution matrix (BLOSUM) series of matrices. The matrix values are based on the observed amino acid substitutions in a larger set of about 2000 conserved amino acid patterns, termed blocks. These blocks act as signatures of families of related proteins. Matrices of this series are identified by a number after the matrix (e.g., BLOSUM50), which refers to the minimum percentage identity of the blocks of multiple aligned amino acids used to construct the matrix. It is noteworthy that these matrices are directly calculated without extrapolations, and are analogous to transition probability matrices P(T) for different values of T, estimated without reference to any rate matrix Q.

The outcome of these two steps set forth above, which is performed in silico is that: (1 ) the amino acid positions that will be the target for mutagenesis are identified; these positions are referred to as is-HITs; (2) the replacing amino acids for the original, such as native, amino acids at the is-HiTs are identified, to provide a collection of candidate LEAD mutant molecules that are expected to perform different from fihe native one. These are are assayed for a desired optimized (or improved or altered) biological activity.
3) Physical Construction of Mutant Proteins and Biological Assays Once is-HITs are selected as set forth above, replacing amino acids are introduced. Mutant proteins typically are prepared using recombinant DNA methods and assessed in appropriate biological assays for the particular biological activity (feature) optimized (see, e.g., Example 1 ).
An exemplary method of preparing the mutant proteins is by mutagenesis of the original, such as native, gene using methods well known in the art.
Mutant molecules are generated one-by-one, such as in addressable arrays, such that each individual mutant generated is the single product of each single and independent mutagenesis reaction. Individual mutagenesis reactions are conducted separately, such as in addressable arrays where they are physically separated from each other. Once a population of sets of nucleic acid molecules encoding the respective mutant proteins is prepared, each is separately introduced one-by-one into appropriate cells for the production of the corresponding mutant proteins. This can also be performed, for example, in addressable arrays where each set of nucleic acid molecules encoding a respective mutant protein is introduced into cells confined to a discrete location, such as in a well of a multi-well microtiter plate. Each individual mutant protein is individually phenotypically characterized and performance is puantitatively assessed using assays appropriate for the feature being optimized (i.e., feature being evolved). Again, this step can be performed in addressable arrays.
Those mutants displaying a desired increased or decreased performance compared to the original, such as native molecules are identified and designated LEADs. From the beginning of the process of generating the mutant DNA molecules up through the readout and analysis of the performance results, each candidate LEAD mutant is generated, produced and analyzed individually, such as from ifis own address in an addressable array. The process is amenable to automation.
D. 2-Dimensional Scanning of Proteins for Increased Resistance to Proteolysis The methods of 2-dimensional scanning permit preparation of proteins modified for a selected trait, activity or other phenotype. Among modifications of interest for therapeutic proteins are those that increase protection against protease digestion while maintaining the requisite biological activity. Such changes are useful for producing longer-lasting therapeutic proteins.
The delivery of stable peptide and protein drugs to patients is a major challenge for the pharmaceutical industry. These types of drugs in the human body are constantly eliminated or taken out of circulation by different physiological processes including internalization, glomerular filtration and proteolysis. The latter is often the limiting process affecting the half-life of proteins used as therapeutic agents in per-oral administration and either intravenous or intramuscular injections.
The 2-dimensional scanning process for protein evolution is used to effectively improve protein resistance to proteases and thus increase protein half-life in vitro and, ultimately in vivo. As noted, the methods provided herein for designing and generating highly stable, longer lasting proteins, or proteins having a longer half-life include: i~ identifying some or all possible target sites on the protein sequence that are susceptible to digestion by one or more specific proteases (these sites are referred to herein as is-H(Ts); iii identifying appropriate replacing amino acids, specific for each is-HIT, such that upon replacement of one or more of the original, such as native, amino acids at that specific is-HIT, they can be expected to increase the is-HIT's resistance to digestion by protease while at the same time, maintaining or improving the requisite biological activity of the protein (these proteins with replaced amino acids are the "candidate LEADs"); ii~~ systematically introducing the specific replacing amino acids (candidate LEADs) at every specific is-HIT target position to generate a collection containing the corresponding mutant candidate lead molecules. Mutants are generated, produced and phenotypically characterized one-by-one, such as in addressable arrays, such that each mutant molecule contains initially an amino acid replacement at only one is-HIT site.
in particular embodiments, such as in subsequent rounds, mutant molecules also can be generated that contain one or more amino acids at one or more is-HIT sites that have been replaced by candidate LEAD
amino acids. Those mutant proteins carrying one or more mutations at one or more is-HITs, and that display improved protease resistance are called LEADs (one mutation at one is-HIT) and super-LEADs (mutations at more than one is-HIT).
The first step of the process takes into consideration existing knowledge from different domains:
(1 ) About the galenic and the delivery environment (tissue, organ or corporal fluid) of the particular therapeutic protein in order to establish a list of proteases more likely to be found in that environment.
For example, a therapeutic protein in per-oral application is likely to encounter typical proteases of the fuminal gastrointestinal tract. In contrast, if this protein were injected in the blood circulation, serum proteases would be implicated in the proteolysis. Based on the specific list of proteases involved, the complete list of all amino acid sequences that potentially could be targeted by the proteases in the list is determined.
(2) Since protease mixtures in the body are quite complex in composition, almost all the residues in any target protein potentially are targeted for proteolysis (FIG6A). Nevertheless, proteins form specific tri-dimensional structures where residues are more or less exposed to the environment and protease action. It can be assumed that those residues constituting the core of a protein are inaccessible to proteases, while those more 'exposed' to the environment are better targets for proteases.
The probability for every specific amino acid to be 'exposed' and then to be accessible to proteases can be taken into account to reduce the number of is-HIT . Consequently, the methods herein consider the analysis with respect to solvent "exposure" or "accessibility" for each individual amino acid in the protein sequence. Solvent accessibility of residues can alternatively be estimated, regardless of any previous knowledge of specific protein structural data, by using an algorithm derived from empirical amino acid probabilities of accessibility, which is expressed in the following equation (Boger et al,, Reports of the Sixth International congress in Immunology, p. 250, 7 986):
s A(i) = f(l_~_~+a-; 1.(0.62]-s.
' - ' Briefly, these are fractional probabilities (eS ~;~) determined for an amino acid (i) found on the surface of a protein, which are based upon structural data from a set of several proteins. It is thus possible to calculate the solvent accessibility (A) of an amino acid (A(i)) at sequence position (i-2 to i+3, onto a sliding window of length equal to 6) that is within an average surface accessible to solvent of > 20 square angstroms (Az).
The protease accessible target amino acids along the protein sequence, i.e., the amino acids to be replaced, are thus identified and are referred to herein as in silico HiTs (is-HITs).
Amino acids at the is-HITs then are replaced by residues that render the sequence less vulnerable (by a factor, for example, of 1 %, 10%, 20%, 30%, 40%, 50%, . . . 100% depending upon the protein) or invulnerable (substantially no detectable digestion within a set time period) to protease digestion, while at the same time maintain a biological activity or activities of interest of the protein. The choice of the replacing amino acids is complicated by (1) the broad target specificity of certain proteases and (2) the need to preserve fihe physicochemical properties such as hydrophobicity, charge and polarity, of essential (e.g., catalytic, binding and/or other activities depending upon the protein) residues. For use in the methods herein, the "Percent Accepted Mutation" values (PAM
values; see, Dayhoff et al., Atlas of Protein Seguence and Structure, 5 3 :345-352, 1978), FIG2) can be used as desribed herein. PAM values, originally developed to produce alignments between protein sequences, are available in the form of probability matrices, which reflect an evolutionary distance. Since, in a family of proteins or homologous (related) sequences, identical or similar amino acids (85% similarity) are shared, conservative substitutions for, or "allowed point mutations" of the corresponding amino acid residues can be determined throughout an aligned reference sequence. In this regard, "conservative substitutions"
of a residue in a reference sequence are those substitutions that are physically and functionally similar to the corresponding reference residues, e.g., that have a similar size, shape, electric charge, chemical properties, including the ability to form covalent or hydrogen bonds, or the like. For example, conservative substitutions can be those that exhibit the highest scores and fulfill the PAM matrix criteria in the form of "accepted point mutations."
By comparing a family of scoring matrices, Dayhoff et al., Atlas of Protein Sequence and Structure, 5:345-352, 1978), found consistently higher score significance when using PAM250 matrix to analyze a variety of proteins, known to be distantly related. For methods herein, the PAM250 matrix was selected for use. The PAM250 matrix is used, by learning directly from natural evolution, to find replacing amino acids for the is-HITs to generate conservative mutations without affecting the protein function. By using PAM250, candidate replacing amino acids are identified from related proteins from different organisms.
An exemplary class of proteins that can be optimized according to the methods provided herein are the cytokines. For example, 2D-scanning methods provided herein can be used to modify the following cytokines to increase their stability as assessed by an increased resistance to proteolysis resulting in an increased protein half-life in the bloodstream or any other desired biological activity of the selected protein. Exemplary cytokines, include, but are not limited to: interleukin-10 (IL-10; SEQ 1D NO: 200), interferon beta (IFN,~; SEQ ID NO: 196), interferon alpha-2a (IFNa-2a; SEQ ID NO: 182), interferon alpha-2b (IFNa-2b; SEQ ID NO: 1 ), and interferon gamma (IFN-y; SEQ ID N0: 199), granulocyte colony stimulating factor (G-CSF; SEQ ID NO: 210), leukemia inhibitory factor (LIF; SEQ ID NO: 213), growth hormone (hGH; SEQ ID
NO: 216), ciliary neurotrophic factor (CNTF; SEQ ID NO: 212), leptin (SEQ ID NO: 21 1 ), oncostatin M (SEQ ID NO: 214), interleukin-6 (IL-6;
SEQ ID NO: 217), interleukin-12 (IL-12; SEQ ID NO: 215), erythropoietin (EPO; SEQ JD 1V0: 201 ), granulocyte-macrophage colony stimulating factor (GM-CSF; SEQ ID NO: 202), interleukin-2 (IL-2; SEQ ID NO: 204), interleukin-3 (IL-3; SEQ ID NO: 205), interleukin-4 (IL-4; SEQ ID NO:
207), interleukin-5 (IL-5; SEQ iD NO: 208), interleukin-13 (IL-13; SEQ ID
NO: 209), FIt3 ligand (SEQ ID NO: 203) and stem cell factor (SCF; SEQ
ID NO: 206).
Accordingly, provided herein are modified cytokines that exhibit increased resistance to proteolysis compared to the unmodified cytokine.
The modified cytokines can be selected from the group consisting of a member of the interferons/interleukin-10 protein family, a member of the long-chain cytokine family; and a member of the short-chain cytokine family. In particular embodiments, fihe modified cytokines provided herein are selected from the group consisting of: interleukin-10 (IL-10), interferon beta (IFN~3), interferon alpha-2a (IFNa-2a), interferon alpha-2b (IFNa-2b), and interferon gamma (IFN-y), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncostafiin M, interleukin-6 (IL-6) and interleukin-12 (IL-12), erythropoietin (EPO), granulocyte-macrophage colony stimulating factor (GM-CSF1, interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-(IL-13), FIt3 ligand and stem cell factor (SCF). In one embodiment, the modified cytokine is an interferon, including modified interferon a-2b (IFNa-2b).
E. Rational Evolution of IFNa-2b For Increased Resistance to Proteolysis IFNa-2b is used for a variety of applications. Typically it is used for treatment of type B and C chronic hepatitis. Additional indications include, but are not limited to, melanomas, herpes infections, Kaposi sarcomas and some leukemia and lymphoma cases. Patients receiving interferon are subject to frequent repeat applicafiions of the drug. Since such frequent injections generate uncomfortable physiological as weEl as undesirable psychological reactions in patients, increasing the half-life of interferons and thus decreasing the necessary frequency of interferon injections, would be extremely useful to the medical community. For example, after injection of native human IFNa-2b injection in mice, as a model system, its presence can be detected in the serum between 3 and hours with a half-life of only around 4 hours. The IFNa-2b completely disappears to undetectable levels by 18-24 hours after injection. Provided herein are mutant variants of the IFNa-2b protein that display altered 10 properties including: (a) highly improved stability as assessed by resistance to proteases in vitro and by pharmacokinetics studies in mice;
and (b) at least comparable biological activity as assessed by antiviral and antiproliferative action compared to both the unmodified and wild type native IFNa-2b protein and to at least one pegylated derivative of the wild type native IFNa. As a result, the IFNa-2b mutant proteins provided herein confer a higher half-life and at least comparable antiviral and antiproliferation activity (sufficient for a therapeutic effect) with respect to the native sequence and to the pegylated derivatives molecules currently being used for the clinical treatment of hepatitis C infection. See Figures 6(A)-6(N), 6(T) and 6(U). Thus, the optimized IFNa-2b protein mutants that possess increased resistance to proteolysis and/or glomerular filtration provided herein result in a decrease in the frequency of injections needed fio maintain a sufficient drug level in serum, leading to i7 higher comfort and acceptance by patients, iii lower doses necessary fio achieve comparable biological effects, and iii) as a consequence of (irk, an attenuation of the (dose-dependent) secondary effects observed in humans.
In particular embodiments, the half-life of the IFNa-2b and IFNa-2a mutants provided herein is increased by an amount selected from at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500% or more, when compared to the half-life of native human IFNa-2b and IFNa-2a in either human blood, human serum or an in vitro mixture containing one or more proteases. In other embodiments, the half-life of the IFNa-2b and IFNa-2a mutants provided herein is increased by an amount selected from at least 6 times,
7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, or more, when compared to the half-life of native human IFNa-2b and IFNa-2a in either human blood, human serum or an in vitro mixture containing one or more proteases.
Two methodologies were used herein to increase the stability of IFNa-2b by amino acid replacement: i7 amino acid replacement that leads to higher resistance to proteases by direct destruction of the protease target residue or sequence, while either maintaining or improving the requisite biological activity (e.g., antiviral activity, antiproliferation activity), and/or iii amino acid replacement that leads to a different pattern of N-glycosylation, thus decreasing both glomerular filtration and sensitivity to proteases, while either improving or maintaining the requisite biological activity (e.g., antiviral activity, antiproliferation activity).
The 2D-scanning methods provided herein were used to identify the amino acid changes on IFNa-2b that lead to an increase in stability when challenged either with proteases, human blood lysate or human serum.
Increasing protein stability to proteases, human blood lysate or human serum, and/or increasing the molecular size is contemplated herein to provide a longer in vivo half-life for the particular protein molecules, and thus to a reduction in the frequency of necessary injections into patients.
The biological activities that were measured for the IFNa-2b molecules are i) their capacity to inhibit virus replication when added to permissive cells previously infected with the appropriate virus, and i~~ their capacity to stimulate cell proliferation when added to the appropriate cells. Prior to the measurement of biological activity, IFNa-2b molecules were challenged with proteases, human blood lysate or human serum during different incubation times. The biological activity measured, corresponds then to the residual biological activity following exposure to the protease-containing mixtures.
As set forth above, provided herein are methods for the development of IFNa-2b and IFNa-2a molecules that, while maintaining the requisite biological activity intact, have been rendered less susceptible to digestion by blood proteases and therefore display a longer half-life in blood circulation. In this particular example, the method used included the following specific steps as set forth in Example 2:
1 ) Identifying some or all possible target sites on the protein sequence that are susceptible to digestion by one or more specific proteases (these sites are the is-HITs) and 2) identifying appropriate replacing amino acids, specific for each is-HIT, such that if used to replace one or more of the original amino acids at that specific is-HIT, they can be expected to increase the is-HIT's resistance to digestion by protease while at the same time, keeping the biological activity of the protein unchanged (these replacing amino acids are the "candidate LEADs") .
As set forth in Example 2, the 3-dimensional structure of IFNa-2b obtained from the NMR structure of IFNa-2a (PDB code 11TF) was used to select only those residues exposed to solvent from a list of residues along the IFNa-2b and IFNa-2a sequence which can be recognized as a sub-strate for different enzymes present in the serum. Residue 1 corresponds to the first residue of the mature peptide IFNa-2b encoded by nucleotides 580-1074 of sequence accession No. J00207, SEQ ID N0:1. Using this approach, the following 42 amino acid target positions were identified as is-HiTs on IFNa-2b or IFNa-2a, which numbering is that of the mature protein (SEQ ID N0:1 or SEQ 1D N0:182, respectively): L3, P4, R12, R13, M 16, R22, K23 or R23, F27, L30, K31, R33, E41, K49, E58, K70, E78, K83, Y89, E96, E 107, P 109, L 1 10, M 1 11, E 1 13, L 117, 8120, K 121, 8125, L128, K131, E132, K133, K134, Y135, P137, M148, 8149, E159, L161, 8162, K164, and E165. Each of fihese positions was replaced by residues defined as compatible by the substitution matrix PAM250 while at the same time not generating any new substrates for proteases. For these 42 is-HITs, the residue substitutions determined by PAM250 analysis were as follows:
RtoH,Q
E to H, Q
KtoQ,T
L to V, I
M to I, V
P to A, S
Y to I, H.
1 ) Modified IFNa-2b Proteins with Single Amino Acid Substitutions Among the mutant proteins provided herein, are mutant IFNa-2b proteins that have increased resistance proteolysis compared to the unmodified, typically wild-type, protein. The mutant IFNa-2b proteins include those selected from among proteins containing more single amino acid replacements in SEQ ID N0:1, corresponding to: L by V at position 3; L by I at position 3; P by S at position 4; P by A at position 4; R by H
at position 12; R by Q at position 12; R by H at position 13; R by Q at position 13; M by V at position 16; M by I at position 16; R by H at position 22; R by Q at position 22; R by H at position 23; R by Q at position 23; F by I at position 27; F by V at position 27; L by V at position 30; L by I at position 30; K by Q at position 31; K by T at position 31; R by H at position 33; R by Q at position 33; E by Q at position 41; E by H at position 41; K by Q at position 49; K by T at position 49; E by Q at position 58; E by H at position 58; K by Q at position 70; K by T at position 70; E by Q at position 78; E by H at position 78; K by Q at position 83; K by T at position 83; Y by H at position 89; Y by I at position 89; E by Q at position 96; E by H at position 96; E by Q at position 107; E by H at position 107; P by S at position 109; P by A at position 109; L by V at position 110; L by I at position 110;M by V at position1 1 1; M by I at 1 1 1; E
position by Q at position 1 E by H at position113; L by V at position1 17; L by 13; J at position 1 R by H at position120; R by Q at position120; K by 17; Q at position 121;K by T at position121; R by H at position125; R by Q at position125;L by V at position128; L by I at position28; K by 1 Q at position 131;K by T at position131; E by Q at position132; E by H at position 132;K by O at position133; K by T at position133; K by Q at position 134;K by T at position134; Y by H at position135; Y by I at position 135;P by S at position137; P by A at position137; M by V at position148;M by I at position148; R by H at position149; R by Q at position 149; E by Q at position 159; E by H at position 159; L by V at position 161; L by J at position 161; R by H at position 162; R by Q at position 162; K by Q at position 164; K by T at position 164; E by Q at position 165; and E by H at position 165.

2) LEAD Identification Next the specific replacing amino acids (candidate LEADs) are systematically introduced at every specific is-HIT position to generate a collection containing the corresponding mutant IFNa-2b DNA molecules, as set forth in Example 2. The mutant DNA molecules were used to produce the corresponding mutant IFNa-2b protein molecules by transformation or transfection into the appropriate cells. These protein mutants were assayed for (i) protection against proteolysis, (ii) antiviral and antiproliferation activity in vitro, (iii) pharmacokinetics in mice. Of particular interest are mutations that increase these activities of the IFNa-Zb mutant proteins compared to unmodified wild type IFNa-2b protein and to pegylated derivates of the wild type protein. Based on the results obtained from these assays, each individual IFNa-2b variant was assigned a specific activity. Those variant proteins displaying the highest stability and/or resistance to proteolysis were selected as LEADS. The candidate LEADs that possessed at least as much residual antiviral activity following protease treatment as the control, native IFNa-2b, before protease treatment were selected as LEADs. The results are set forth in Table 2 of Example 2.
Using this method, the following mutants selected as LEADs are provided herein and correspond to the group of proteins containing one or more single amino acid replacements in SEQ ID N0:1, corresponding to: F
by V at position 27; R by H at position 33; E by Q at position 41; E by H
at position 41; E by Q at position 58; E by H at position 58; E by Q at position 78; E by H at position 78; Y by H at position 89; E by Q at position 107; E by H at position 107; P by A at position 109; L by V at position 1 10; M by V at position 1 1 1; E by Q at position 1 13; E by H at position 1 13; L by V at position 117; L by I at position 117; K by 0. at position 121; K by T at position 121; R by H at position 125; R by Q at position 125; K by Q at position 133; K by T at position 133; and E by Q
at position 159; E by H at position 159. Among these are mutations that can have multiple effects. For exmple, among mutations described herein, are mutations that result in an increase of the IFNa-2b activity as assessed by detecting the requisite biological activity.
Also provided are IFNa-2b proteins that contain a plurality of mutations based on the LEADs (see, e.g., Tables fj and 7, EXAMPLE 5, which listscandidate LEADs and LEAD sites), are generated. These IFNa-2b proteins have activity that is further optimized. Examples of such proteins are described in the EXAMPLES. Other combinations of mutations can be prepared and tested as described herein to identify other LEADs of interest, particularly those that have further increased IFNa-2b antiviral activity or further increased resistance to proteolysis.
Also provided herein are modified IFNa-2b or IFNa-2a cytokines selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NOS:1 or 182, corresponding to the replacement of: N by D at position 45 (e.g., SEQ ID N0:978); D by G at position 94 (e.g, SEQ ID NO:979); G by R at position 102 (e.g., SEO.
1D N0:980); A by G at position 139 (e.g., SEQ ID N0:981 ); or any combination thereof. These particular proteins have also been found herein to have increased resistance to proteolysis.
In another embodiment, IFNa-2b and IFNa-2a proteins that contain a plurality of mutations based on the LEADs (see Tables in the EXAMPLES, listing the candidate LEADs and LEAD sites), are produced to produce JFNa-2b and IFNa-2a proteins that have activity that is further optimized. Examples of such proteins are described herein. Other combinations of mutations can be prepared and tested as described herein to identify other LEADs of interest, particularly those that have further increased IFNa-2b and IFNa-2a antiviral activity or further increased resistance to proteolysis.
3) N-glycosylation Site Addition In additional embodiments, N-glycosylation sites can be added to increase resistance to proteolysis while maintaining or improving the requisite biological activity. Exemplary N-glycosylation mutants containing duo-amino acid replacements corresponding to the N-X-S or N-X-T consensus sequences are set forth in Example 3. Accordingly, provided herein are IFNa-2b and IFNa-2a mutant proteins having an increased resistance to proteolysis compared to unmodified IFNa-2b and IFNa-2a, selected from the group consisting of proteins comprising one or more sets of duo-amino acid replacements in SEQ ID N0:1, corresponding to:
D by N at position 2 and P by S at position 4;
D by N at position 2 and P by T at position 4;
L by N at position 3 and Q by S at position 5;
L by N at position 3 and Q by T at position 5;
P by N at position 4 and T by S at position 6;
P by N at position 4 and T by T at position 6;
Q by N at position 5 and H by S at position 7;
Q by N at position 5 and H by T at position 7;
T by N at position 6 and S by S at position 8;
T by N at position 6 and S by T at position 8;
H by N at position 7 and L by S at position 9;
H by N at position 7 and L by T at position 9;
S by N at position 8 and G by S at position 10;
S by N at position 8 and G by T at position 10;
L by N at position 9 and S by S at position 1 1;
L by N at position 9 and S by T at position 1 1;

M by N at position 21 and K by S at position 23;
M by N at position 21 and K by T at position 23;
R by N at position 22 and I by S at position 24;
R by N at position 22 and I by T at position 24;
K or R by N at position 23 and S by S at position 25;
K or R by N at position 23 and S by T at position 25;
I by N at position 24 and L by S at position 26;
by N at position 24 and L by T at position 26;
S by N at position 25 and F by S at position 27;
S by N at position 25 and F by T at position 27;
L by N at position 26 and S by S at position 28;
L by N at position 26 and S by T at position 28;
S by N at position 28 and L by S at position 30;
S by N at position 28 and L by T at position 30;
L by N at position 30 and D by S at position 32;
L by N at position 30 and D by T at position 32;
K by N at position 31 and R by S at position 33;
K by N at position 31 and R by T at position 33;
D by N at position 32 and H by S at position 34;
D by N at position 32 and H by T at position 34;
R by N at position 33 and D by S at position 35;
R by N at position 33 and D by T at position 35;
H by N at position 34 and F by S at position 36;
H by N at position 34 and F by T at position 36;
D by N at position 35 and G by S at position 37;
D by N at position 35 and G by T at position 37;
F by N at position 36 and F by S at position 38;
F by N at position 36 and F by T at position 38;
G by N at position 37 and P by S at position 39;

_77 _ G by N at posifiion 37 and P by T at position 39;
F by N at position 38 and Q by S at position 40;
F by N at position 38 and Q by T at position 40;
P by N at position 39 and E by S at position 41;
P by N at position 39 and E by T at position 41;
Q by N at position 40 and E by S at position 42;
Q by N at position 40 and E by T at position 42;
E by N at position 41 and F by S at position 43;
E by N at position 41 and F by T at position 43;
E by N at position 42 and G by S at position 44;
E by N at position 42 and G by T at position 44;
F by N at position 43 and N by S at position 45;
F by N at position 43 and N by T at position 45;
G by N at position 44 and Q by S at position 46;
G by N at position 44 and Q by T at position 46;
N by N at position 45 and F by S at position 47;
N by N at position 45 and F by T at position 47;
Q by N at position 46 and Q by S at position 48;
Q by N at position 46 and Q by T at position 48;
F by N at position 47 and K by S at position 49;
F by N at position 47 and K by T at position 49;
Q by N at position 48 and A by S at position 50;
Q by N at position 48 and A by T at position 50;
K by N at position 49 and E by S at position 51;
K by N at position 49 and E by T at position 51;
A by N at position 50 and T by S at position 52;
A by N at position 50 and T by T at position 52;
S by N at position 68 and K by S at position 70;
S by N at position 68 and K by T at position 70;

K by N at position 70 and S by S at position 72;
K by N at position 70 and S by T at position 72;
A by N at position 75 and D by S at position 77;
A by N at position 75 and D by T at position 77;
D by N at position 77 and T by S at position 79;
D by N at position 77 and T by T at position.79;
I by N at position 100 and G by S at position 102;
I by N at position 100 and G by T at position 102;
Q by N at position 101 and V by S at position 103;
Q by N at position 101 and V by T at position 103;
G by N at position102 and G by S at position104;

G by N at position102 and G by T at position104;

V by N at position103 and V by S at position105;

V by N at position103 and V by T at position105;

G by N at position104 and T by S at position106;

G by N at position104 and T by T at position106;

V by N at position105 and E by S at position107;

V by N at position105 and E by T at position107;

T by N at position106 and T by S at position108;

T by N at position106 and T by T at position108;

E by N at position107 and P by S at 109;
position E by N at position107 and P by T at 109;
position T by N at position108 and I by S at 110;
position T by N at position108 and I by T at 110;
position K by N at position134 and S by S at 136;
position K by N at position 134 and S by T at position 136;
S by N at position 154 and N by S at position 156;
S by N at position 154 and N by T at position 156;
T by N at position 155 and L by S at position 157;

T by N at position155 and L by T at position 157;

N by N at position156 and Q by S at position 158;

N by N at position156 and Q by T at position 158;

L by N at position157 and E by S at position 159;

L by N at position157 and E by T at position 159;

Q by N at position158 and S by S at position 160;

Q by N at position158 and S by T at position 160;

E by N at position159 and L by S at position 161;

E by N at position159 and L by T at position 161;

S by N at position160 and R by S at position 162;

S by N at position 160 and R by T at position 162;
L by N at position 161 and S by S at position 163;
L by N at position 161 and S by T at position 163;
R by N at position 162 and K by S at position 164;
R by N at position 162 and K by T at position 164;
S by N at position 163 and E by S at position 165; and S by N at position 163 and E by T at position 165, wherein residue 1 corresponds to residue 1 of the mature IFNa-2b or IFNa-2a protein set forth in SEQ ID N0:1 or SEQ ID N0:182, respectively. In particular embodiments, the IFNa-2b or IFNa-2a mutant protein has increased resistance to proteolysis compared to unmodified IFNa-2b or IFNa-2a, and is selected from the group consisting of proteins comprising one or more sets of duo-amino acid replacements in SEQ ID
N0:1, corresponding to:
Q by N at position 5 and H by S at position 7;
P by N at position 39 and E by S at position 41;
P by N at position 39 and E by T at position 41;
Q by N at position 40 and E by S at position 42;
Q by N at position 40 and E by T at position 42;

E by N at position 41 and F by S at position 43;
E by N at position 41 and F by T at position 43;
F by N at position 43 and N by S at position 45;
G by N at position 44 and Q by T at position 46;
N by N at position 45 and F by S at position 47;
N by N at position 45 and F by T at position 47;
Q. by N at position 46 and Q by S at position 48;
F by N at position 47 and K by S at position 49;
F by N at position 47 and K by T at position 49;
I by N at position 100 and G by S at position 102;
i by N at position100 and G by T at position102;

V by N at position105 and E by S at position107;

V by N at position105 and E by T at position107;

T by N at position106 and T by S at position108;

T by N at position106 and T by T at position108;

E by N at position 107 and P by S at position 109;
E by N at position 107 and P by T at position 109;
L by N at position 157 and E by S at position 159;
L by N at position 157 and E by T at position 159;
E by N at position 159 and L by S at position 161; and E by N at position 159 and L by T at position 161.
F. Protein Redesign Provided herein are methods for designing and generating new versions of native or modified cytokines, such as IFNa-2b and IFNa-2a.
Using these methods, the redesigned cytokine maintains either sufficient, typically equal or improved levels of a selected phenotype, such as a biological activity, of the original protein, while at the same time its amino acid sequence is changed by replacement of up to: afi least 1 %, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 12%, at least 14%, at least 16%, at least 18%, at least 20%, at least 30%, at least 40% up to 50%
or more of its native amino acids by the appropriate pseudo-wild type amino acids. Pseudo-wild type amino acids are those amino acids such that when they replace an original, such as native, amino acid at a given position on the protein sequence, the resulting protein displays substantially the same levels of biological activity (or sufficient activity for its therapeutic or other use) compared to the original, such as native, protein. In other embodiments, pseudo-wild type amino acids are those amino acids such that when they replace an original, such as native, amino acid at a given position on the protein sequence, the resulting protein displays the same phenotype, such as levels of biological activity, compared to an original, typically a native, protein. Pseudo-wild type amino acids and the appropriate replacing positions can be detected and identified by any analytical or predictive means; such as for example, by performing an Alanine-scanning. Any other amino acid, particularly another amino acid that has a neutral effect on structure, such as Gly or Ser, also can be used for the scan. All those replacements of original, such as native, amino acids by Ala that do not lead to the generation of a HIT (a protein that has lost the desired biological activity), have either led to the generation of a LEAD (a protein with increased biological activity);
or the replacement by Ala will be a neutral replacement, i.e., the resulting protein will display comparable levels of biological activity compared to the original, such as native, protein. The methods provided herein for protein redesign of cytokines, such as IFNa-2b and IFNa-2a, are intended to design and generate "artificial" (versus naturally existing) proteins, such that they consist of amino acid sequences not existing in Nature, but that display biological activities characteristic of the original, such as native, protein. These redesigned proteins are contemplated herein to be useful for avoiding potential side effects that might otherwise exist in other forms of cytokines in treatment of disease. Other uses of redesigned proteins provided herein are to establish cross-talk between pathways triggered by different proteins; to facilitate structural biology by generating mutants that can be crystallized while maintaining activity; and to destroy an activity of a protein without changing a second activity or multiple additional activities.
In one embodiment, a method for obtaining redesigned proteins comprises y identifying some or ail possible target sites on the protein sequence that are susceptible to amino acid replacement without losing protein activity (protein activity in a largest sense of the term: enzymatic, binding, hormone, etc.) (These sites are the pseudo-wild type, 4'-wt sites); irk identifying appropriate replacing amino acids (4'-wt amino acids), specific for each 4'-wt site, such that if used to replace the native amino acids at that specific 4'-wt site, they can be expected to generate a protein with comparable biological activity compared to the original, such as native, protein, thus keeping the biological activity of the protein substantially unchanged; iii systematically introducing the specific ~-wt amino acids at every specific ~-wt position so as to generate a collection containing the corresponding mutant molecules. Mutants are generated, produced and phenotypically characterized one-by-one, in addressable arrays, such that each mutant molecule contains initially amino acid replacements at only one 4'-wt site. In subsequent rounds mutant molecules also can be generated such that they contain one or more 4~-wt amino acids at one or more 4~-wt sites. Those mutant proteins carrying several mutations at a number of 4~-wt sites, and that display comparable or improved biological activity are called redesigned proteins or 4~-wt proteins. In particular embodiments, at least 1 %, at feast 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at _77_ least 9%, at least 10%, at least 15%, at least 20%, at least 25%, or more of the amino acid residue positions on a particular cytokine, such as IFNa-2b and IFNa-2a are replaced with an appropriate pseudo-wild fiype amino acid.
The first step is an amino acid scan over the full length of the protein. At this step, each and every one of the amino acids in the protein sequence is replaced by a selected reference amino acid, such as alanine. This permits the identification of "redesign-HIT" positions, i.e., positions that are sensitive to amino acid replacement. All of the other positions that are not redesign-HIT positions (i.e., those at which the replacement of the original, such as native, amino acid by the replacing amino acid, for example Ala, does not lead to a drop in profiein fitness or biological activity) are referred to herein as "pseudo-wild type" positions.
When the replacing amino acid, for example Ala, replaces the original, such as native, amino acid at a non-HIT position, then the replacement is neutral, in terms of protein activity, and the replacing amino acid is said to be a pseudo-wild type amino acid at that position. Pseudo-wild type positions appear to be less sensitive than redesign-HIT positions since they tolerate the amino acid replacement without affecting the protein activity that is being either maintained or improved. Amino acid replacement at the pseudo-wild type positions, result in a non-change in the protein fitness (e.g., possess substantially the same biological activity), while at the same time to a divergence in the resulting protein sequence compared to the original, such as native, sequence.
To first identify those amino acid positions on the IFNa-2b and IFNa-2a protein that are involved or not involved in IFNa-2b and IFNa-2a protein activity, such as binding activity of IFNa-2b and IFNa-2a to its receptor, an Ala-scan was performed on the IFNa-2b sequence as set forth in Example 4. For this purpose, each amino acid in the IFNa-2b _78_ protein sequence was individually changed to Alanine. Any other amino acid, particularly another amino acid that has a neutral effect on structure, such as Gly or Ser, also can be used. Each resulting mutant IFNa-2b protein was then expressed and the activity of the interferon molecule was then assayed. These particular amino acid positions, referred to herein as HITs would in principle nofi be suitable targets for amino acid replacement to increase protein stability, because of their involvement in the recognition of IFN-receptor or in the downstream pathways involved in IFN activity. For the Ala-scanning, the biological activity measured for the IFNa-2b molecules was: y their capacity to inhibit virus replication when added to permissive cells previously infected with the appropriate virus and, i~~ their capacity to stimulate cell proliferation when added to fihe appropriate cells. The relative activity of each individual mutant compared to the native protein is indicated in FIG10A through C. HITs are those mutants that produce a decrease in the activity of the protein (in the example: all the mutants with activities below about 30% of the native activity.
In addition, the Alanine-scan was used to identify the amino acid residues on IFNa-2b that when replaced with alanine correspond to 'pseudo-wild type' activity, i.e., those that can be replaced by alanine without leading to a decrease in biological activity. Knowledge of these amino acids is useful for the re-design of the IFNa-2b and IFNa-2a proteins. The results are set forth in Table 5, and include pseudo-wild type amino acid positions of IFNa-2b corresponding to SEQ ID N0:1, amino acid residues: 9, 10, 17, 20, 24, 25, 35, 37, 41, 52, 54, 56, 57, 58, 60, 63, 64, 65, 76, 89, and 90.
Accordingly, provided herein are IFNa-2b and IFNa-2a mutant proteins comprising one or more pseudo-wild type mutations at amino acid positions of IFNa-2b or IFNa-2a corresponding to SEQ lD N0:1 or _79_ SEQ ID N0:182, respectively, amino acid residues: 9, 10, 17, 20, 24, 25, 35, 37, 41, 52, 54, 56, 57, 58, 60, 63, 64, 65, 76, 89, and 90. The mutations can be either one or more of insertions, deletions and/or replacements of the native amino acid residue(s). Iri one embodiment, the pseudo-wild type replacements are mutations with alanine at each position. In another embodiment, the pseudo-wild type replacements are one or more mutations in SEQ ID N0:1 corresponding to:
L by A at position 9, L by A at position 17, Q by A at position 20, I by A at position 24, S by A at position 25, D by A at position 35, G by A at position 37, E by A at position 41, T by A at position 52, P by A at position 54, L by A at position 56, H by A at position 57, E by A at position 58, I by A at position 60, I by A at position 63, F by A at position 64, N by A at position 65, W by A at position 76, Y by A at position 89, and Q by A at position 90.
In addition, the IFNa-2b alanine scan revealed the following redesign-HITs having decreased antiviral activity at amino acid positions of IFNa-2b corresponding to SEQ ID N0:1, amino acid residues: 2, 7, 8, 1 1, 13, 15, 16, 23, 26, 28, 29, 30, 31, 32, 33, 53, 69, 91, 93, 98, and 101. Accordingly, in particular embodiments where it is desired to decrease the viral activity of IFNa-2b or IFNa-2a, either one or more of insertions, deletions and/or replacements of the native amino acid residues) can be carried out at one or more of amino acid positions of IFNa-2b or IFNa-2a corresponding to SEQ ID N0:1, amino acid residues:
2, 7, 8, 11, 13, 15, 16, 23, 26, 28, 29, 30, 31, 32, 33, 53, 69, 91, 93, 98, and 101.

Each of the redesign mutations set forth above can be combined with one or more of the IFNa-2b or IFNa-2a candidate LEAD mutations or one or more of the IFNa-2b or IFNa-2a LEAD mutants provided herein.
G. 3D-scanning and Its Use for Modifying Cytokines Also provided herein is a method of structural homology analysis for comparing proteins regardless of their underlying amino acid sequences. For a subset of proteins families, such as the family of human cytolcines, this information is rationally exploited to produce modified proteins. This method of structural homology analysis can be applied to proteins that are evolved by any method, including the 2D
scanning method described herein. When used with the 2D method in which a particular phenotype, activity or characteristic of a protein is modified by 2D analysis, the method is referred to as 3D-scanning.
The use of "structural homology" analysis in combination with the directed evolution methods provided herein provides a powerful technique for identifying and producing various new protein mutants, such as cytokines, having desired biological activities, such as increased resistance to proteolysis. For example, the analysis of the "structural homology" between an optimized mutant version of a given protein and "structurally homologous" proteins allows identification of the corresponding structurally related or structurally similar amino acid positions (also referred to herein as "structurally homologous loci") on other proteins. This permits identification of mutant versions of the latter that have a desired optimized features) (biological activity, phenotype) in a simple, rapid and predictive manner (regardless of amino acid sequence and sequence homology). Once a mutant version of a protein is developed, then, by applying the rules of structural homology, the corresponding structurally related amino acid positions (and replacing amino acids) on other "structurally homologous" proteins readily are identified, thus allowing a rapid and predictive discovery of the appropriate mutant versions for the new proteins.
3-dimensionally structurally equivalent or similar amino acid positions that are located on two or more different protein sequences that share a certain degree of structural homology, have comparable functional tasks (activities and phenotypes). These two amino acids that occupy substantially equivalent 3-dimensional structural space within their respective proteins can then be said to be "structurally similar" or "structurally related" with each other, even if their precise positions on the amino acid sequences, when these sequences are aligned, do not match with each other. The two amino acids also are said to occupy "structurally homologous loci." "Structural homology" does not take into account the underlying amino acid sequence and solely compares 3-dimensional structures of proteins. Thus, two proteins can be said to have some degree of structural homology whenever they share conformational regions or domains showing comparable structures or shapes with 3-dimensional overlapping in space. Two proteins can be said to have a higher degree of structural homology whenever they share a higher amount of conformational regions or domains showing comparable structures or shapes with 3-dimensional overlapping in space.
Amino acids positions on one or more proteins that are "structurally homologous" can be relatively far way from each other in the protein sequences, when these sequences are aligned following the rules of primary sequence homology. Thus, when two or more protein backbones are determined to be structurally homologous, the amino acid residues that are coincident upon three-dimensional structural superposition are referred to as "structurally similar" or "structurally related" amino acid residues in structurally homologous proteins (also referred to as "structurally homologous loci"). Structurally similar amino acid residues are located in substantially equivalent spatial positions in structurally homologous proteins.
For example, for proteins of average size (approximately 180 residues), two structures with a similar fold will usually display rms deviations not exceeding 3 to 4 angstroms. For example, structurally similar or structurally related amino acid residues can have backbone positions less than 3.5, 3.0, 2.5, 2.0, 1.7 or '1.5 angstrom from each other upon protein superposition. RMS deviation calculations and protein superposition can be carried out using any of a number of methods known in the art. For example, protein superposition and RMS deviation calculations can be carried out using all peptide backbone atoms (e.g., N, C, C(C=O), O and CA (when present)). Alternatively, protein superposition can be carried out using jusfi one or any combination of peptide backbone atoms, such as, for example, N, C, C(C=0), O and CA
(when present). In addition, one skilled in the art will recognize that protein superposition and RMS deviation calculations generally can be performed on only a subset of the entire protein structure. For example, if the protein superposition is carried out using one protein that has many more amino acid residues than another protein, protein superposition can be carried out on the subset (e.g., a domain) of the larger protein that adopts a structure similar to the smaller protein. Similarly, only portions of other proteins can be suitable for superimposition. For example, if the position of the C-terminal residues from two structurally homologous proteins differ significantly, the G-terminal residues can be omitted from the structural superposition or RMS deviation calculations.
Accordingly, provided herein are methods of rational evolution of proteins based on the identification of potential target sites for mutagenesis (is-HITs) through comparison of patterns of protein backbone folding between structurally related proteins, irrespective of the underlying sequences of the compared proteins. Once the structurally related amino acid positions are identified on the new protein, then suitable amino acid replacement criteria, such as PAM analysis, can be employed to identify candidate LEADs for construction and screening as described herein.
For example, analysis of "structural homology" between and among a number of related cytokines was used to identify on various members of the cytokine family, other than interferon alpha, those amino acid positions and residues that are structurally similar or structurally related to those found in the IFNa-2b mutants provided herein that have been optimized for improved stability. The resulting modified cytokines are provided. This method can be applied to any desired phenotype using any protein, such as a cytokine, as the starting material to which an evolution procedure, such as the rational directed evolution procedure of U.S. application Serial No. 10/022,249 or fihe 2-dimensional scanning method provided herein, is applied. The structurally corresponding residues are then altered on members of the family to produce additional cytokines with similar phenotypic alterations.
1 ) Homology Typically, homology between proteins is compared at the level of their amino acid sequences, based on the percent or level of coincidence of individual amino acids, amino acid per amino acid, when sequences are aligned starting from a reference, generally the residue encoded by the start codon. For example, two proteins are said to be "homologous" or to bear some degree of homology whenever their respective amino acid sequences show a certain degree of matching upon alignment comparison. Comparative molecular biology is primarily based on this approach. From the degree of homology or coincidence between amino acid sequences, conclusions can be made on the evolutionary distance between or among two or more protein sequences and biological systems.
The concept of "convergent evolution" is applied to describe the phenomena by which phylogenetically unrelated organisms or biological systems have evolved to share features related to their anatomy, physiology and structure as a response to common forces, constraints, and evolutionary demands from the surrounding environment and living organisms. Alternatively, "divergent evolution," is applied to describe the phenomena by which strongly phylogenetically related organisms or biological systems have evolved to diverge from identity or similarity as a response to divergent forces, constraints, and evolutionary demands from the surrounding environment and living organisms.
In the typical tradifiional analysis of homologous proteins there are two conceptual biases corresponding to: i) "convergent evolution," and ii) "divergent evolution." Whenever the aligned amino acid sequences of two proteins do not match well with each other, these proteins are considered "not related" or "less related" with each other and have different phylogenetic origins. There is no (or low) homology between these proteins and their respective genes are not homologous (or show little homology). If these two "non-homologous" proteins under study share some common functional features (e.g., interaction with other specific molecules, activity), they are determined to have arisen by "convergent evolution," i.e., by evolution of their non-homologous amino acid sequences, in such a way that they end up generating functionally "related" structures.
On the other hand, whenever the aligned amino acid sequences of two proteins do match with each other to a certain degree, these proteins are considered to be "related" and to share a common phylogenetic origin. A given degree of homology is assigned between these two proteins and their respective genes likewise share a corresponding degree of homology. During the evolution of their initial highly homologous amino acid sequence, enough changes can be accumulated in such a way that they end up generating "less-related" sequences and less related function. The divergence from perfect matching between these two "homologous" proteins under study is said come from "divergent evolution."
2) 3D-scanning (Structural Homology) methods Structural homology refers to homology between the topology and three-dimensional structure of two proteins. Structural homology is not necessarily related to "convergent evolution" or to "divergent evolution," nor is it related to the underlying amino acid sequence. Rather, structural homology is likely driven (through natural evolution) by the need of a protein to fit specific conformational demands imposed by its environment. Particular structurally homologous "spots"
or "loci" would not be allowed to structurally diverge from the original structure, even when its own underlying sequence does diverge. This structural homology is exploited herein to identify loci for mutation.
Within the amino acid sequence of a protein resides the appropriate biochemical and structural signals to achieve a specific spatial folding in either an independent or a chaperon-assisted manner. Indeed, this specific spatial folding ultimately determines protein traits and activity.
Proteins interact with other proteins and molecules in general through their specific topologies and spatial conformations. in principle, these interactions are not based solely on the precise amino acid sequence underlying the involved topology or conformation. If protein traits, activity (behavior and phenotypes) and interactions rely on protein fiopology and conformation, then evolutionary forces and constraints acting on proteins can be expected to act on topology and conformation.

Proteins sharing similar functions will share comparable characteristics in their topology and conformation, despite the_ underlying amino acid sequences that create those topologies and conformations.
3) Application of 3D Scanning to Cytokines The method based on structural homology, including the 3D-scanning method provided herein can be applied to any related proteins.
For exemplary purposes herein it is applied to cytokines. In exemplary embodiments, methods for altering phenotypes of members of families of cytokines by altering one member such as by employing the 2-dimensional rational scanning method are provided. As provided herein, other members of these cytokine families then can be similarly modified by identifying and changing structurally homologous residues to similarly alter the phenotypes of such proteins.
In an exemplary embodiment herein, IFNa-2b mutants with increased resistance to proteolysis are generated by the 2-dimensional rational scanning method; IFN,~ mutants also were generated. The corresponding residues on members of cytokine families that possess structural homology to IFNa-2b were identified and the identifeid residues on the other cytokines were similarly modified to produce cytokines with increased resistance to proteolysis. Hence also provided herein are cytokine mutants that display increased resistance to proteolysis and/or glomerular filtration containing one or more amino acid replacements.
Provided herein are mutant (modified) cytokines that display altered features and properties, such as a resistance to proteolysis. Methods for producing such modified cytokines also are provided.
Also provided herein is a method of structural homology analysis for comparing proteins regardless their underlying amino acid sequences.
For a subset of proteins families, such as the family of human cytokines, this information is rationally exploited herein. Human cytokines all share a _87_ common helix bundle fold, which is used to structurally define the 4-helical cytokine superfamily in the structural classification of the protein database SCOP~ (Structural Classification of Proteins; see, e.g., Murzin et al., J. Mol. Biol., 247:536-540, 1995 and "http://scop.mrc-lmb.cam.ac.uk/scop/"). This superfamily includes three different families:
1 ) the interferons/interleukin-10 protein family (SEQ ID NOS: 1 and 182-200); 2) the long-chairs cytokine family (SEQ ID NOS: 210-217); and 3) the short-chain cytokine family {SEQ ID NOS: 201-209).
For example, a distinct feature of cytokines from the inter-ferons/interleukin-10 family is an additional (fifth) helix. This family includes interleukin-10 (IL-10; SEQ ID N0:200, interferon beta (IFN,~; SEQ
ID NO: 196), interferon alpha-2a (IFNa-2a; SEQ ID NO: 182), interferon alpha-2b (IFNa-2b; SEQ ID N0:1 ), and interferon gamma (IFN-y; SEQ ID
NO: 199). The long-chain cytokine protein family includes, among others, granulocyte colony stimulating factor (G-CSF; SEQ ID NO: 210), leukemia inhibitory factor (LIF; SEQ ID NO: 213), growth hormone (hGH; SEQ ID
NO: 216), ciliary neurotrophic factor (CNTF; SEQ ID N0: 212), leptin (SEQ ID NO: 211 ), oncostatin M (SEQ ID NO: 214), interleukin-6 (IL-6;
SEQ ID NO: 217) and interleukin-12 (IL-12; SEQ ID NO: 215). The short-chain cytokine protein family includes, among others, erythropoietin (EPO;
SEQ ID N0: 201 ), granulocyte-macrophage colony stimulating factor (GM-CSF; SEQ ID NO: 202), interleukin-2 {IL-2; SEQ ID NO: 204), interleukin-3 (IL-3; SEQ ID NO: 205), interleukin-4 {IL-4; SEQ ID NO: 207), interleukin-5 (IL-5; SEQ ID NO: 208), interleukin-13 {iL-13; SEQ ID NO: 209), FIt3 ligand (SEQ ID N0: 203) and stem cell factor (SCF; SEQ ID N0: 206).
Although the degree of similarity among the underlying amino acid sequences of these cytokines does not appear high, their corresponding 3-dimensional structures present a high level of similarity (see, e.g., FIGSBB through D). Effectively, the best structural similarity is obtained _$g_ between two 3-dimensional protein structures of the same family in the 4-helical cytokine superfamily.
The methods provided herein for producing mutant cytokines are exemplified with reference to production of cytokines that display a substantially equivalent increase in resistance to proteolysis relative to the optimized IFNa-2b mutants. It is understood that this method can be applied to other families of proteins and for other phenotypes.
In one embodiment, proteins of the 4-helical cytokine superfamily are provided herein that are structurally homologous IFNa-2b LEAD
mutants set forth herein. For example, by virtue of the knowledge of the 3-dimensional structural amino acid positions within the LEAD IFNa-2b mutants provided herein that confer higher resistance to a challenge with either proteases or blood lysate or serum, while maintaining or improving the requisite biological activity, the corresponding structurally related (e.g., structurally similar) amino acid residues on a variety of other cytokines are identified (FIG9).
Numerous methods are well known in the art for identifying structurally related amino acid positions with 3-dimensionally structurally homologous profieins. Exemplary methods include, but are not limited to:
CATH (Class, Architecture, Topology and Homologous superfamily) which is a hierarchical classification of protein domain structures based on four different levels (Orengo et al., Structure, x:1093-1108, 1997); CE
(Combinatorial Extension of the optimal path), which is a method that calculates pairwise structure alignments (Shindyaiov et al., Protein Engineering, 1 1 9 :739-747, 1998); FSSP (Fold classification based on Structure-Structure alignment of Proteinsl, which is a database based on the complete comparison of all 3-dimensional protein structures that currently reside in the Protein. Data Bank (PDB) (Holm et al., Science, 273:595-602, 1996); SCOP (Structural Classification of Proteins), which _89_ provides a descriptive database based on the structural and evolutionary relationships between ail proteins whose structure is known (Murzin et al., J. lillol, Biol., 247:536-540, 1995); and VAST (Vector Alignment Search Tool), which compares newly determined 3-dimensional protein structure coordinates to those found in the MMDB/PDB dafiabase (Gibrat et al., Current Opinion in Struetural Biology, 6:377-385, 1995).
In a particular embodiment, the step-by-step process including the use of a program referred to as TOP (see FIG8A and Lu, G., J. Appl.
Cryst., 33:176-189, 2000; publicly available at "www.bioinfo1.mbfys.lu.se/TOP") is used for protein structure comparison. This program runs two steps for each protein structure comparison. In the first step topology of secondary structure in the two strucfiures is compared. The program uses two points to represent each secondary structure element (alpha helices or beta strands) then systematically searches all the possible super-posifiions of these elements in 3-dimensional space (defined as the root mean square deviation -rmsd, the angle between the two lines formed by the two points and the line-line distance). The program searches to determine whether additional secondary structure elements can fit by the same superposition operation.
If secondary structures that can fit each other exceed a given number, the program identifies the two structures as similar. The program gives as an output a comparison score called "Structural Diversity" that considers the distance between matched a-carbon atoms and the number of matched residues. The lower the "Structural Diversity" score, the more the two structures are similar. In various embodiments herein, the Structural Diversity scores range from 0 up to about 67.
In the exemplified embodiment, all the cytokines were first structurally aligned against the IFNa-2b structure. For the proteins within the same family as IFNa-2b (e.g., the interferons/interleukin-10 cytokine family), this alignment was directly used to identify the structurally related is-HIT target amino acid positions and/or regions corresponding to the structurally homologous positions and/or regions on IFNa-2b where LEAD
mutants were found (FIGBB). For the other cytokines, the protein of the family (either long- or short-chain cytokines) with the best 3-dimensional structural alignment with IFNa-2b was selected using the lowest "Structural Diversity" score as the representative for that family. From the short-chain cytokine protein family, erythropoietin (EPO; see FIGBC) was identified as the best structural homologue of IFNa-2b (rmsd =1.9 angstroms; number of aligned residues=62; Structural Diversity=13.8).
From the long-chain cytokine protein family, granulocyte-colony stimulating factor (G-CSF; see FIG8D) was identified as the best structural homologue of IFNa-2b (rmsd=1.7 angstroms; number of aligned 7 5 residues = 77; Structural Diversity = 7.8).
Next, the amino acid positions and/or regions corresponding to the LEAD mutant regions on IFNa-2b were identified on these two proteins.
These two best structural homologues of IFNa-2b (e.g., EPO and G-CSF;
see FIGS12L and 12E, respectively) were structurally aligned to each of the other cytokines within their respective cytokine protein families. As a result, protein regions likely to be targets for serum protease resistance were identified on al! cytokines (see FIGS12A through T). Amino acids in these target regions were then checked for their exposure to the solvent and their susceptibility to be protease substrate. Exposed and substrate residues are then subjected to PAM250 analysis as set forth above, so that a group of non-substrate and functionally conservative amino acid residues are selected as replacements. The results of the above structural homology analysis for each of the cytokines provided herein are set forth in FIGS12A through T.

Accordingly, provided herein are modified cytokines that exhibit greater resistance to proteolysis compared to the unmodified cytokine protein, comprising one or more amino acid replacements at one or more target positions on the cytokine corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of an IFNa-2b modified protein provided herein. The resistance to proteolysis can be measured by mixing it with a protease in vitro, incubation with blood or incubation with serum. Also provided herein are cytokine structural homologues of an IFNa-2b modified protein provided herein, comprising one or more amino acid replacements in the cytokine structural homologue at positions corresponding to the 3-dimensional-structurally-similar modified positions within the 3-dimensional structure of the modified IFNa-2b. In one embodiment, the cytokine homologue has increased resistance to proteolysis compared to its unmodified and/or wild type cytokine counterpart, wherein the resistance to proteolysis is measured by mixture with a protease in vitro, incubation with blood, or incubation with serum.
a) Structurally Homologous Interferon Mutants Also provided herein are modified cytokines or cytokine structural homologues of IFNa-2b that are IFNa cytokines. These IFNa cytokines can be selected from the group consisting of IFNa-2a, IFNa-c, IFNa-2c, IFNa-d, IFNa-5, IFNa-6, IFNa-4, IFNa-4b, IFNa-1, IFNa-J, IFNa-H, IFNa-F, IFNa-8, and IFNa-consensus cytokine. Accordingly, the modified IFNa cytokines provided herein comprise one or more amino acid replacements at one or more target positions in either IFNa-2a, IFNa-c, IFNa-2c, IFNa-d, IFNa-5, IFNa-6, IFNa-4, IFNa-4b, IFNa-I, IFNa-J, IFNa-H, IFNa-F, IFNa-8, or IFNa-consensus cytokine corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of the IFNa-2b modified proteins provided herein, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN alpha-2a.
In particular embodiments, the modified IFNa cytokines are selected from the group consisting of:
the modified IFNa-2a that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 182, corresponding to amino acid positions:
41, 58, 78, 107, 117, 125, 133 and 159;
the modified IFNa-c that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 183, corresponding to amino acid positions:
41, 59, 79, 108, 118, 126, 134 and 160;
the modified IFNa-2c cytokine that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 185, corresponding to amino acid positions: 41, 58, 78, 107, 117, 125, 133 and 159;
the IFNa-d modified protein that is human and is selected from fihe group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 186, corresponding to amino acid positions:
41, 59, 79, 108, 1 18, 126, 134 and 160;
the IFNa-5 modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 187, corresponding to amino acid positions:
41, 59, 79, 108, 118, 126, 134 and 160;
the IFNa-6 modified protein that is human and is selected from fihe group consisting of proteins comprising one or more single amino acid replacements in SEQ ID N0: 188, corresponding to amino acid positions:
41, 59, 79, 108, 1 18, 126, 134 and 160;
the IFNa-4 modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 189, corresponding to amino acid positions:
41, 59, 79, 1 O8, 118, 126, 134 and 160;
the IFNa-4b modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 190, corresponding to amino acid positions:
41, 59, 79, 108, 118, 126, 134 and 160;
the IFNa-I modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 191, corresponding to amino acid positions:
41, 59, 79, 108, 118, 126, 134 and 160;
the IFNa-J modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 192, corresponding to amino acid positions:
41, 59, 79, 108, 118, 126, 134 and 160;
the IFNa-H modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 193, corresponding to amino acid positions:
41, 59, 79, 108, 1 18, 126, 134 and 160;
the IFNa-F modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 194, corresponding to amino acid positions:
41, 59, 79, 108, 1 18, 126, 134 and 160;
the IFNa-8 modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 195, corresponding to amino acid positions:
41, 59, 79, 108, 1 18, 126, 134 and 160; and the IFNa-consensus modified protein that is human and is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NO: 232, corresponding to amino acid positions: 41, 58, 78, 107, 1 17, 125, 133 and 159.
b) Structurally Homologous Cytokine Mutants As set forth above, provided herein are modified cytokines that comprise one or more amino acid replacements at one or more target positions in either interleukin-10 (IL-10), interferon beta (IFN~3), IFN~3-1, IFN~3-2a, interferon gamma (IFN-y), granulocyte colony stimulating factor (G-CSF), and human erythropoietin (EPO); corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of the IFNa-2b modified proteins provided herein, wherein the replacements Lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified cytokine.
Also provided herein are modified cytokines that comprise one or more amino acid replacements at one or more target positions in either granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-51, interleukin-13 (iL-13), FIt3 ligand and stem cell factor (SCF);
corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of the human EPO modified proteins provided herein, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified cytokine.
Also provided herein are modified cytokines that comprise one or more amino acid replacements at one or more target positions in either interleukin-10 (IL-10), interferon beta (IFN/3), interferon gamma (IFN-y), human granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncostatin M, interleukin-6 (iL-6) and interieukin-12 (IL-12); corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of the human G-CSF modified proteins provided herein, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified cytokine.
In particular embodiments, the modified cytokines are selected from the following.
A modified IFN,l3 cytokine, comprising mutations at one or more amino acid residues of IFN~3 corresponding to SEQ ID NO: 196: 39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110, 1 1 1, 1 13, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID
N0: 196 set forth in FIG12A corresponding to SEQ ID NOS: 233-289, wherein the first amino acid indicated is substituted by the second at the position indicated for all of the substitutions set forth in FIG12A through T.
A modified IFN~3-1 cytokine, comprising mutations at one or more amino acid residues of IFN~3-1 corresponding to SEQ ID NO: 197: 39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110, 1 11, 1 13, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).

A modified IFN~3-2a cytokine, comprising mutations at one or more amino acid residues of IFN/3-2a corresponding to SEQ ID N0:198: 39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110, 111, 113, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
A modified IFN-gamma cytokine, comprising mutations at one or more amino acid residues of IFN-gamma corresponding to SEQ ID
N0:199: 33, 37, 40, 41, 42, 58, 61, 64, 65 and 66, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are.
selected from the group consisting of amino acid substitutions in SEQ ID
N0:199 set forth in FIG12B corresponding to SEQ ID NOS: 290-31 1.
A modified IL-10 cytokine, comprising mutations at one or more amino acid residues of IL-10 corresponding to SEQ ID N0:200: 49, 50, 52, 53, 54, 55, 56, 57, 59, 60, 67, 68, 71, 72, 74, 75, 78, 81, 84, 85, 86, and 88, wherein the mutations comprise insertions, deletions or replacements of the nafiive amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID N0:200 set forth in FIG 12C
corresponding to SEQ ID NOS: 312-361.
A modified erythropoietin cytokine, comprising mutations at one or more amino acid residues of erythropoietin corresponding to SEQ ID
N0:201: 43, 45, 48, 49, 52, 53, 55, 72, 75, 76, 123, 129, 130, 131, 162, and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 201 set forth in FiG12L
corresponding to SEQ ID NOS: 940-977.

_97_ A modified GM-CSF cytokine, comprising mutations at one or more amino acid residues of GM-CSF corresponding to SEQ ID NO: 202: 38, 41, 45, 46, 48, 49, 51, 60, 63, 67, 92, 93, 1 19, 120, 123, and 124, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 202 set forth in FIG12N corresponding to SEQ JD NOS: 362-400.
A modified FIt3 ligand cytokine, comprising mutations at one or more amino acid residues of FIt3 ligand corresponding to SEQ iD NO:
203: 3, 40, 42, 43, 55, 58, 59, 61, 89, 90, 91, 95, and 96, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID
NO: 203 set forth in FIG12M corresponding to SEQ ID NOS: 401-428.
A modified IL-2 cytokine, comprising mutations at one or more amino acid residues of IL-2 corresponding to SEQ ID NO: 204: 43, 45, 48, 49, 52, 53, 60, 61, 65, 67, 68, 72, 100, 103, 104, 106, 107, 109, 110, and 132, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 204 set forth in FIG12P and SEQ
ID NOS: 429-476.
A modified IL-3 cytokine, comprising mutations at one or more amino acid residues of iL-3 corresponding to SEQ ID NO: 205: 37, 43, 46, 59, 63, 66, 96, 100, 101, and 103, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
In particular embodiments, the replacements are selected from the group _98_ consisting of amino acid substitutions in SEQ ID N0:205 set forth in FIG12Q corresponding to SEQ ID NOS: 477-498.
A modified SCF cytokine, comprising mutations at one or more amino acid residues of SCF corresponding to SEQ ID N0: 206: 27, 31, 34, 37, 54, 58, 61, 62, 63, 96, 98, 99, 100, 102, 103, 106, 107, 108, 109, 134, and 137, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 205 set forth in FIG12T
corresponding to SEQ ID NOS: 499-542.
A modified IL-4 cytokine, comprising mutations at one or more amino acid residues of IL-4 corresponding to SEQ ID NO: 207: 26, 37, 53, 60, 61, 64, 66, 100, 102, 103, and 126, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 207 set forth in FIG12R corresponding to SEQ ID NOS: 543-567.
A modified IL-5 cytokine, comprising mutations at one or more amino acid residues of IL-5 corresponding to SEQ ID NO: 208: 32, 34, 39, 46, 47, 56, 84, 85, 88, 89, 90, 102, 110, and 1 1 1, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID
NO: 208 set forth in FIG12S corresponding to SEQ ID NOS: 568-602.
A modified IL-13 cytokine, comprising mutations at one or more amino acid residues of iL-13 corresponding to SEQ ID N0: 209: 32, 34, 38, 48, 79, 82, 85, 86, 88, 107, 108, 1 10, and 11 1, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are _99_ selected from the group consisting of amino acid substitutions in SEQ ID
NO: 209 set forth in FIG 120 corresponding to SEQ ID NOS: 603-630.
A modified G-CSF cytokine, comprising mutations at one or more amino acid residues of G-CSF corresponding to SEQ ID NO: 210: 61, 63, 68, 72, 86, 96, 100, 101, 131, 133, 135, 147, 169, 172, and 177, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID N0: 210 set forth in FIG12E corresponding to SEQ ID NOS: 631-662.
A modified leptin cytokine, comprising mutations at one or more amino acid residues of leptin corresponding to SEQ ID NO: 211: 43, 49, 99, 100, 104, 105, 107, 108, 141 and 142, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 21 1 set forth in FIG121 corresponding to SEQ ID NOS: 663-683.
A modified CNTF cytokine, comprising mutations at one or more amino acid residues of CNTF corresponding to SEQ ID N0: 212: 62, 64, 66, 67, 86, 89, 92, 100, 102, 104, 131, 132, 133, 135, 136, 138, 140, 143, 148, and 151, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 212 set forth in FiGl2D
corresponding to SEQ ID NOS: 684-728.
A modified LIF cytokine, comprising mutations at one or more amino acid residues of LIF corresponding to SEQ ID NO: 213: 69, 70, 85, 99, 102, 104, 106, 109, 137, 143, 146, 148, 149, 153, 154, and 156, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 213 set forth in FIG12J corresponding to SEQ ID NOS: 729-760.
A modified oncostatin M cytokine, comprising mutations at one or more amino acid residues of oncostatin M corresponding to SEQ ID NO:
214: 59, 60, 63, 65, 84, 87, 89, 91, 94, 97, 99, 100, 103, and 106, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 214 set forth in FIG12K corresponding to SEQ ID NOS: 761-793.
A modified IL-12 cytokine, comprising mutations at one or more amino acid residues of IL-12 corresponding to SEQ ID NO: 215: 56, 61, 66, 67, 68, 70, 72, 75, 78, 79, 82, 89, 92, 93, 107, 110, 1 11, 115, 1 17, 124, 125, 127, 128, 129, and 189, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 215 set forth in FIG12G corresponding to SEQ ID NOS: 794-849.
A modified hGH cytokine, comprising mutations at one or more amino acid residues of hGH corresponding to SEQ ID NO: 216: 56, 59, 64, 65, 66, 88, 92, 94, 101, 129, 130, 133, 134, 140, 143, 145, 146, 147, 183, and 186, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 216 set forth in FIG12F
corresponding to SEQ ID NOS: 850-895.

A modified IL-6 cytokine, comprising mutations at one or more amino acid residues of IL-6 corresponding to SEQ ID NO: 217: 64, 65, 66, 68, 69, 75, 77, 92, 98, 103, 105, 108, 133, 138, 139, 140, 149, 156, 178, and 181, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s). In particular embodiments, the replacements are selected from the group consisting of amino acid substitutions in SEQ ID NO: 217 set forth in FIG12H
corresponding to SEQ ID NOS: 896-939.
In certain embodiments, the modified cytokines provided herein possess increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication or to stimulate cell proliferation in appropriate cells, after incubation with either mixtures 9f proteases, individual proteases, blood lysate or serum.
In other embodiments, the modified cytokines provided herein possess decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
In yet other embodiments, the modified cytokines provided herein possess increased biological activity compared to the unmodified cytokine, wherein activity is assessed by measuring the capacity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.

H. Rational evolution of IFN~(3 for increased resistance to proteolysis and/or higher conformational stability Treatment with interferon b (IFN,~) is a well established therapy.
Typically it is used for treatment of multiple sclerosis (MS). Patients receiving interferon ,Q are subject to frequent repeat applications of the drug. The instability of IFN,~ in the blood stream and under the storage conditions is well known. Hence it would be useful to increasing stability (half-life) of IFN,~ in serum and also in vitro would improve it as a drug.
The 2D-scanning method and the 3D-scanning method (using structural homology) provided herein (see, copending ) were each applied to interferon ~3. Provided herein are mutant variants of the IFN,~ protein that display improved stability as assessed by resistance to proteases (thereby possessing increased protein half-life) and at least comparable biological activity as assessed by antiviral or antiproliferation activity compared to the unmodified and wild type native IFN,~ protein (SEQ ID
N~: 196). The IFN~3 mutant proteins provided herein confer a higher half-life and at least comparable biological activity with respect to the native sequence. Thus, the optimized IFN,~ protein mutants provided herein that possess increased resistance to proteolysis result in a decrease in the frequency of injections needed to maintain a sufficient drug level in serum, thus leading to, for example: i7 higher comfort and acceptance by patients, iii lower doses necessary to achieve comparable biological effects, and iii) as a consequence of (iy, likely attenuation of any secondary effects.
In particular embodiments, the half-life of the IFN~3 mutants provided herein is increased by an amount selected from at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500% or more, when compared to the half-life of native human IFN~3 in either human blood, human serum or an in vitro mixture containing one or more proteases. In other embodiments, the half-life of the IFN/3 mutants provided herein is increased by an amount selected from at least 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, or more, when compared to the half-life of native human IFN/3 in either human blood, human serum or an in vitro mixture containing one or more proteases.
Two approaches were used herein to increase the stability of IFN~3 by amino acid replacement: i) Resistance to proteases: amino acid replacement that leads to higher resistance to proteases by direct destruction of the protease target residue or sequence, while either maintaining or improving the requisite biological activity (e.g., antiviral and anti-proliferation activity), and/or iii Conformational stability: amino acid replacement that leads to an increase in conformational stability (i.e.
half-life at room temperature or at 37°C), while either improving or maintaining the requisite biological activity (e.g., antiviral and anti-proliferation activity).
Two methodologies were used to address the improvements described above: (a) 2D-scanning methods were used to identify aminoacid changes that lead to improvement in protease resistance and to improvement in conformational stability, and (b) 3D-scanning, which employs structural homology methods methods also were used to identify aminoacid changes that lead to improvement in protease resistance. The 2D-scanning and 3D-scanning methods each were used to identify the amino acid changes on IFN,~ that lead to an increase in stability when challenged either with proteases, human blood lysate or human serum.

Increasing protein stability to proteases, human blood lysate or human serum is contemplated herein to provide a longer in vivo half-life for the particular protein molecules, and thus a reduction in the frequency of necessary injections into patients. The biological activities that have been measured for the IFN,~ molecules are i) their capacity to inhibit virus replication when added to permissive cells previously infected with the appropriate virus, and iii their capacity to stimulate cell proliferation when added to the appropriate cells. Prior to the measurement of biological activity, IFN~3 molecules were challenged with proteases, human blood lysate or human serum during different incubafiion times. The biological activity measured, corresponds then to the residual biological activity following exposure to the proteolytic mixtures.
As set forth above, provided herein are methods for the generating IFN~3 molecules (or any target protein, particularly cytokines) that, while maintaining a requisite biological activity without substantial change (sufficient for therapeutic app(ication(s)), have been rendered less susceptible to digestion by blood proteases and therefore display a longer half-life in blood circulation. In this particular example, the method used included the following specific steps as exemplified in fihe Examples:
For the improvement of resistance to proteases, by 2D-scanning, the method included:
1 ) Identifying some or all possible target sites on the protein sequence that are susceptible to digestion by one or more specific proteases (these sites are the is-HITs); and 2) Identifying appropriate replacing amino acids, specific for each is-HIT, such that if used to replace one or more of the original amino acids at that specific is-HIT, they can be expected to increase the is-HIT's resistance to digestion by protease while at the same time, keeping the biological activity of the protein unchanged (these replacing amino acids are the candidate LEADs).
For the improvement of resistance to proteases, by 3D-scanning (structural homologyl:
1 ) Identifying some or all possible target sites (is-HITS) on the protein sequence that display an acceptable degree of structural homology around the aminoacid positions mutated in the LEAD molecules previously obtained for IFNa using 2D-scanning, and that are susceptible to digestion by one or more specific proteases; and 2) Identifying appropriate replacing amino acids, specific for each is-HIT, such that if used to replace one or more of the original amino acids at that specific is-HIT, they can be expected to increase the is-HIT's resistance to digestion by protease while at the same time, keeping the biological activity of the protein unchanged (these replacing amino acids are the candidate LEADs).
For the improvement of conformational stability, by 2D-scanning, as provided herein:
1 ) Identifying some or all possible target sites on the protein sequence that are susceptible to being directly involved in the intramolecular flexibility and conformational change (these sites are the is-HITs); and 2) Identifying appropriate replacing amino acids, specific for each is-HIT, such that if used to replace one or more of the original amino acids at that specific is-HIT, they can be expected to increase the thermal stability of the molecule while at the same time, keeping the biological activity of the protein unchanged (these replacing amino acids are the candidate LEADs).
See Figures 6(O)-6(S) and Figure 8(A).

Using the 2D-scanning and 3D-scanning methods and the 3-dimensional structure of IFN,l3, the following amino acid target positions were identified as is-HITs on IFN~3, which numbering is that of the mature protein (SEQ ID
N0:196):
By 3D-scanning (see, SEQ ID Nos. 234-289, 989-1015): D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by ! at position 47, L by T at position 47, L by Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by H at position 73, D by G at position 73, D by Q at position 73, E by Q at position 81, E by H at position 81, E by Q at position 107, E by H at position 107, K by Q at position 108, K by T at 108, K by S at position108, K by position H at position 108, E by Q at 109, E by H at position109, D by position Q at position 110, D by H at 1 10, D by G at 1 10, F by position position I at position 11 1, F by V at 1 11, R by H at 113, R by position position Q at position113, L by V at 116, L by I at position16, L by position 1 T at position 116, L by Q at 1 L by H at position 1 16, position 16, L by A at position 116, L by V at 120,L by I at position 120, L
position by T at position 120, L by Q at 120,L by H at position 120, L
position by A at position 120, K by Q at 123,K by T at position 123, K
position by S at position123, K by H at 123,R by H at position 124" R
position by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136" K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 163, Y by I at position 1631, R by H at position 165, R by Q at position 165.
By 2D-scanning (see SEQ ID Nos.1016-1302) : M by V at position 1, M by 1 at position 1, M by T at position 1, M by Q at position 1 , M by A at position 1 , L by V at position 5 , L by ! at position 5 , L by T at position 5 , L by Q at position 5 , L by H at position 5 , L by A at position 5 , F by I at position 8, F by V at position 8, L by V at position 9, L by t at position 9, L by T at position 9, L by Q at position 9, L by H at position 9, L by A at position 9, R by H at position 11, R by Q at position 1 1, F by I at position 15 , F by V at position 15 , K by Q at position 19, K by T at position 19, K by S at position 19, K by H at position 19, W by S at position 22, W by H at position 22, N by H at position 25, N by S at position 25, N by Q at position 25, R by H position 27, R by Q position 27, L by V at position 28, L by I at position 28, L by T at position 28, L
by Q at position 28, L by H at position 28, L by A at position 28, E by Q
at position 29, E by H at position 29, Y by H at position 30, Y by I at position 30, L by V at position 32, L by I at position 32, L by T at position 32, L by Q at position 32, L by H at position 32, L by A at position 32, K by Q at position 33, K by T at position 33, IC by S at position 33, K by H at position 33, R by H at position 35, R by Q at position 35, M by V at position 36, M by I at position 36, M by T at position 36, M by Q at position 36, M by A at position 36, D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by, Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by Q at position 73, D by H at position 73, D by G at position 73, E by Q at position 81, E by H at position 81, E by Q at position 85, E by H at position 85, Y fey H at position 92, Y by I at position 92 , K by Q at position 99, K by T at position 99, K by S at position 99, K by H at position 99, E by Q at position 103, E by H at position 103, E by Q at position 104, E by H at position 104, K by Q at position 105, IC by T at position 105, K by S at position 105, K by H at position 105, E by Q at position 107, E by H at position 107, K by Q. at 108, K by T at position108, K by position S at position 108, K by H at position108, E by Q at position109, E by H at position 109, D by Q at position110, D by H at position1 10, D by G at position 110, F by I at position1 1, F by V at position1 1, R by 1 1 H at position113, R by Q at position113, L by V at position1 16, L by I at position 1 L by T at position1 L by Q at position1 16, L by 16, 16, H at position 1 L by A at position116,L by V at position120, L by 16, ! at position 120, L by T at position120,L by Q at position120, L by H at position 120, L by A at position120,K by Q at position123, K by T at position123, K by S at position123,K by H at position123, R by H at position 124, R by Q at 124, R by H at position128, R by position Q at position 128, L by V at 130, L by 1 at position30, L by position 1 T at position 130, L by Q at 130, L by H at position130, L by position A at position 130, K by Q at 134, K by T at position134, K by position S at position134, K by H at 134, K by Q at position136, K by position T at position 136, K by S at position 136, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 138, Y by I at position 138, R by H at position 152, R by Q at position 152, Y by H at position 155, Y by i at position 155, R by H at position 159, R by Q at position 159, Y by H at position 163, Y by I at position 163, R by H at position 165, R by Q at position 155, M by D at position 1, M by E at position 1, M by K at position 1, M by N at position 1, M by R at position 1, M by S at position 1, L by D at position 5, L by E at position 5, L by K
at position 5, L by N at position 5, L by R at position 5, L by S at position 5, L by D at position 6, L by E at position 6, L by K at position 6, L by N
at position 6, L by R at position 6, L by S at position 6, L by. Q at position 6, L by T at position 6, F by E at position 8, F by K at position 8, F by R
at position 8, F by D at position 8, L by D at position 9, L by E at position 9, L by K at position 9, L by N at position 9, L by R at position 9, L by S
at position 9, Q by D at position 10 , Q by E at position 10 , Q by K at position 10 , Q by N at position 10 , Q by R at position 10 , Q by S at position 10 , Q by T at position 10 , S by D at position 12, S by E at position 12, S by K at position 12, S by R at position 12, S by D at position 13, S by E at position 13, S by K at position 13, S by R at position 13, S by N at position 13, S by Q at position 13, S by T at position 13, N by D at position 9 4, N by E at position 14, N by K at position 14, N by Q at position 14, N by R at position 14, N by S at position 14, N by T at position 14, F by D at position 15, F by E at position 15, F by K at position 15, F by R at position 15, Q by D at position 16, Q by E at position 16 , Q by K at position 16 , Q by N at position 16 , Q by R at position 16 , Q by S at position 16 , Q by T at position 16 , C by D at position 17, C by E at position 17, C by K at position 17, C by N at position 17, C by Q at position 17, C by R at position 17, C by S at position 17, C by T at position 17, L by N at position 20, L by Q at position 20, L by R at position 20, L by S at position 20, L by T at position 20, L by D at position 20, L by E at position 20, L by K at position 20, W by D at position 22, W by E at position 22, W by K at position 22, W by R at position 22, Q by D at position 23, Q by E at position 23, Q by K at position 23, Q by R at position 23, L by D at position 24, L by E at position 24, L by K at position 24, L by R at position 24, W by D at position 79, W by E at position 7g, W by K at position 79, W by R at position 79, N by D at position 80, N by E at position 80, N by K at position 80, N by R at position 80, T by D at position 82, T by E at position 82, T by K at position 82, T by R at position 82, J by D at position 83, I by E at position 83, I by K at position 83, I by R at position 83, I by N at position 83, I by Q at position 83, I by S at position 83, I by T at position 83, N by D at position 86, N by E at position 86, N by K at position 86, N by R at position 86, N by Q at posifiion 86, N by S at position 86, N by T at position 86, L by D at position 87, L by E at position 87, L by K at position 87, L by R at position 87, L by N at position 87, L by Q at position 87, L by S at position 87, L by T at position 87, A by D at position 89, A by E at position 89, A by K at position 89, A by R at position 89, N by D at position 90, N by E at position 90, N by K at position 90, N by Q at position 90, N by R at position 90, N by S at position 90, N by T at position 90, V by D at position 91, V by E at position 91, V by K at position 91, V by N at position 91, V by Q at position 91, V by R at position 91, V by S at position 91, V by T at position 91, Q by D at position 94, Q by E at position 94, Q by Q at position 94, Q by N at position 94, Q by R at position 94, Q by S at position 94, Q by T at position 94, I by D at position 95, I by E at position 95, I by K at position 95, I by N at position 95, I by Q at position 95, I by R at position 95, I by S at position 95, I by T at position 95, H by D at position 97, H by E at position 97, H by K at position 97, H by N at position 97, H by Q at position 97, H by R at position 97, H by S at position 97, H by T at position 97, L by D at position 98, L by E at position 98, L by K at position 98, L by N at position 98, L by Q at position 98, L by R at position 98, L by S at position 98, L by T at position 98, V by D at position 101, V by E at position 101, V by K at position 101, V by N at position 101, V by Q at position 101, V by R at position 101, V by S at position 101, V by T at position 101, M by C at position 1, L by C at position 6, Q by C at position 10, S by C at position 13, Q by C at position 16, L by C at position 17, V by C at position 101, L by C at position 98, H by C at position 97, Q by C at posifiion 94, V by C at position 91, N by C at position 90.
SEQ ID N0. Mutant SEQ ID N 1016 (M1V) SEQ ID N 1017 (M11) SEQ ID N 1018 (M1T) SEQ ID N 1019 (M1A) SEQ ID N 1020 (L5V) SEQ fD N 1021 (L5I) SEQ iD N 1022 (L5T) SEQ ID N 1023 (L5Q) SEQ !D N 1024 (L5H) SEQ ID N 1025 (L5A) SEQ ID N 1026 (F81) SEQ ID N 1027 (F8V) SEQ ID N 1028 (L9V) SEQ 1D N 1029 (L91) SEQ ID N 1030 (L9T) SEQ ID N 1031 (L9Q) SEQ ID N 1032 (L9H) SEO ID N 1033 (L9A) SEQ ID N 1034 (R11H) SEQ ID N 1035 (R110) SEQ ID N 1036 (F151) SEQ !D N 1037 (F15V) SEQ ID N 1038 (K19Q) SEQ ID N 1039 (K19T) SEQ ID N 1040 (K19S) SEQ JD N 1041 (K19H) SEQ JD N 1042 (W22S) SEQ ID N 1043 (W22N) SEQ iD N 1044 (N25H) SEQ ID N 1045 (N25S) SEQ ID N 1046 (N25Q) SEQ ID N 1047 (R27H) SEQ ID N 1048 (R27Q) SEQ iD N 1049 (LZBV) SEQ ID N 1050 (L281) SEQ ID N 1051 (L28T) SEQ ID N 1052 (L28Q) SEQ ID N 1053 (L28H) SEQ ID N 1054 (L28A) SEQ ID N 1055 (E29Q) SEQ ID N 1056 (E29H) SEQ ID N 1057 (Y30H) SEQ ID N 1058 (Y301) SEQ ID N 1059 (L32V) SEQ ID N 1060 (L321) SEQ ID N 1061 (L32T) SEQ ID N 1062 (L32Q) SEQ ID N 1063 (L32H) SEQ ID N 1064 (L32A) SEQ ID N 1065 (M1Q.) SEQ ID N 1066 (K33Q) SEQ ID N 1067 (K33T) SEQ iD N 1068 (K33S) SEQ 1D N 1069 (K33H) SEQ ID N 1070 (R35H) SEQ ID N 1071 (R35Q) SEQ ID N 1072 (M36V) SEQ ID N 1073 (M361) SEQ ID N 1074 (M36T) SEQ ID N 1075 (M36Q) SEQ ID N 1076 (M36A) SEQ ID N 1077 (E85Q) SEQ ID N 1078 (E85H) SEQ ID N 1079 (Y92H) SEQ ID N 1080 (Y92() SEQ ID N 1081 (K99Q) SEO. ID N 1082 (K99T) SEQ ID N 1083 (K99S) SEQ ID N 1084 (K99H) SEQ ID N 1085 (E103Q) SEQ ID N 1086 (E103H) SEQ ID N 108? (E104Q) SEQ ID N 1088 (E104H) SEQ ID N 1089 (K105Q) SEQ ID N 1090 (K105T) SEQ ID N 1091 (K105S) SEQ ID N 1092 (K105H) SEQ ID N 1093 (Y138H) SEQ ID N 1094 (Y1381) SEQ ID N 1095 (R152H) SEQ ID N 1096 (R152Q) -1 '! 4-SEQ iD N 1097 (Y155H) SEQ ID N 1098 (Y1551) SEQ ID N 1099 (R159N) SEQ ID N 1100 (R159Q) SEQ ID N 1101 (M1D) SEQ ID N 1102 (M1E) SEQ ID N 1103 (M1 K) SEQ ID N 1104 (M1N) SEQ ID N 1105 (M1R) SEQ ID N 1106 (M1S) SEQ ID N 1107 (L5D) SEQ ID N 1108 (L5E) SEQ ID N 1109 (L5K) SEQ ID N 1110 (L5R) SEC2 ID N 1111 (L5N) SEQ !D N 11 12 (L5S) SEQ ID N 1113 (L6D) SEQ ID N 1114 (L6E) SEQ ID N 1115 (L6K) SEQ ID N 1116 (L6N) SEQ ID N 1117 (L6Q) SEQ ID N 1118 (L6R) SEQ ID N 1119 (L6S) SEQ ID N 1120 (L6T) SEQ ID N 1121 (F8D) SEQ ID N 1122 (F8E) SEQ ID N 1123 (F8K) SEQ ID N 1124 (F8R) SEQ ID N 1125 (L9D) SEQ 1D N 1 126 (L9E) SEQ ID N 1127 (L9K) SEQ ID N 1128 (L9N) SEQ !D N 1129 (L9R) SEQ ID N 1130 (L9S) SEQ ID N 1131 (Q10D) SEQ ID N 1132 (Q10E) SEQ ID N 1133 (Q10K) SEQ ID N 1134 (Q10N) SEQ ID N 1135 (Q10R) SEQ ID N 1136 (Q10S) SEQ ID N 1137 (Q10T) SEQ ID N 1138 (S12D) SEQ ID N 1139 (S12E) SEQ iD N 1140 (S12K) SEQ ID N 1141 (S12R) SEQ ID N 1142 (S13D) SEQ ID N 1143 (S13E) SEQ ID N 1144 (S13K) SEQ ID N 1145 (S13N) SEQ ID N 1146 (S13Q) SEQ ID N 1147 (S13R) SEQ ID N 1148 (S13T) SEQ ID N 1149 (N14D) SEQ ID N 1150 (N14E) SEQ ID N 1151 (N14K) SEQ ID N 1152 (N14Q) SEQ ID N 1153 (N14R) SEQ ID N 1154 (N14S) SEQ ID N 1155 (N14T) SEQ ID N 1156 (F15D) SEQ ID N 1157 (F15E) SEQ ID N 1158 (F15K) SEQ ID N 1159 (F15R) SEQ ID N 1160 (Q16D) SEQ ID N 1161 (Q16E) SEQ ID N 1162 (Q16K) SEQ ID N 1163 (Q16N) SEQ ID N 1164 (Q16R) SEQ ID N 1165 (Q16S) SEQ ID N 1166 (Q16T) SEQ ID N 1167 (C17D) SEQ ID N 1168 (C17E) SEQ ID N 1169 (C17K) SEQ ID N 1170 (C17N) SEQ ID N 1171 (C17Q) SEQ ID N 1172 (C17R) SEQ ID N 1173 (C17S) SEQ ID N 1 174 (C17T) SEQ ID N 1175 (L20N) SEQ ID N 1176 (L20Q) SEQ ID N 1177 (L20R) SEQ ID N 1178 (L20S) SEQ ID N 1179 (L20T) SEQ ID N 1180 (L20D) SEQ ID N 1181 (L20E) SEQ ID N 1182 (L20K) SEQ ID N 1183 (W22D) SEQ ID N 1184 (W22E) SEQ ID N 1 185 (W22K) SEQ ID N 1186 (W22R) SEQ ID N 1187 (Q23D) SEQ ID N 1188 (Q23E) SEQ ID N 1189 (Q23K) SEQ ID N 1190 (Q23R) SEQ ID N 1191 iL24D) SEQ ID N 1192 (L24E) SEQ ID N 1193 {L24K) SEQ ID N 1194 (L24R) SEO. ID N 1195 (G78D) SEQ ID N 1196 {G78E) SEQ ID N 1197 iG78K) SEQ ID N 1198 (G78R) SEQ ID N 1199 (W79D) SEQ ID N 1200 (W79E) SEQ ID N 1201 (W79K) SEQ ID N 1202 {W79R) SEQ ID N 1203 {N80D) SEQ ID N 1204 (N80E) SEQ ID N 1205 (N80K) SEQ ID N 1206 (N80R) SEQ ID N 1207 (T82D) SEQ ID N 1208 (T82E) SEQ ID N 1209 (T82K) SEQ ID N 1210 (T82R) SEQ ID N 1211 (183D) SEQ ID N 1212 (183E) SEQ ID N 1213 (183K) SEQ ID N 1214 (183R) SEQ ID N 1215 {183N) SEQ ID N 1216 {183Q) SEQ ID N 1217 (183S) SEQ ID N 1218 (183T) SEQ ID N 1219 (N86D) SEQ ID N 1220 (N86E) SEQ ID N 1221 (N86K) SEQ ID N 1222 (N86R) SEQ ID N 1223 (N86Q) SEQ ID N 1224 (N86S) SEQ ID N 1225 (N86T) SEQ ID N 1226 (L87D) SEQ ID N 1227 (L87E) SEQ ID N 1228 (L87K) SEQ ID N 1229 (L87R) SEQ ID N 1230 (L87N) SEQ ID N 1231 (L87Q) SEQ ID N 1232 (L87S) SEQ ID N 1233 (L87T) SEQ ID N 1234 (A89D) SEQ ID N 1235 (A89E) SEQ !D N 1236 (A89K) SEQ ID N 1237 (A89R) SEQ ID N 1238 (N90D) SEQ ID N 1239 (N90E) SEQ ID N 1240 (N90K) SEQ ID N 1241 (N90Q) SEQ ID N 1242 (N90R) SEQ ID N 1243 (N90S) SEQ ID N 1244 (N90T) SEQ ID N 1245 (V91D) SEQ ID N 1246 (V91 E) SEQ ID N 1247 (V91 K) SEQ ID N 1248 (V91N) SEQ ID N 1249 (V91Q) SEQ ID N 1250 (V91 R) SEQ ID N 1251 (V91 S) SEQ ID N 1252 (V91 T) SEQ ID N 1253 (Q94D) SEQ ID N 1254 (Q94E) SEQ ID N 1255 (Q94K) SEQ ID N 1256 (Q94N) SEQ ID N 1257 (Q94R) SEQ ID N 1258 (Q94S) SEQ ID N 1259 (Q94T) SEQ ID N 1260 (195D) SEQ ID N 1261 (195E) SEQ ID N 1262 (195K) SEQ ID N 1263 (195N) SEQ ID N 1264 (195Q) SEQ ID N 1265 (195R) SEQ ID N 1266 (195S) SEQ ID N 1267 (195T) SEQ ID N 1268 (H97D) SEQ ID N 1269 (H97E) SEQ ID N 1270 (H97K) SEQ ID N 1271 (H97N) SEQ ID N 1272 (H97Q) SEQ ID N 1273 (H97R) SEQ ID N 1274 (H97S) SEQ ID N 1275 (H97T) SEQ ID N 1276 (L98D) SEQ ID N 1277 (L98E) SEQ ID N 1278 (L98K) SEQ ID N 1279 (L98N) SEQ ID N 1280 (L98Q) SEQ ID N 1281 (L98R) SEQ ID N 1282 (L98S) SEQ ID N 1283 (L98T) SEQ ID N 1284 (V101 D) SEQ ID N 1285 (V101E) SEQ ID N 1286 (V101K) SEQ ID N 1287 (V101 N) SEQ ID N 1288 (V101 Q) SEQ ID N 1289 (V101R) SEQ ID N 1290 (V101S) SEQ ID N 1291 (V101T) SEQ ID N 1292 (M1 C) SEQ ID N 1293 (V101C) SEQ ID N 1294 (L6C) SEQ ID N 1295 (L98C) SEQ ID N 1296 (Q10C) SEQ ID N 1297 (H97C) SEQ ID N 1298 (S13C) SEQ ID N 1299 (Q94C) SEQ ID N 1300 (Q16C) SEQ ID N 1301 (N90C) SEQ ID N 1302 (V91 C) I. Super-LEADs and Additive Directional Mutagenesis (ADM)$
Also provided herein are super-LEAD mutant proteins comprising a combination of single amino acid mutations present in two or more of the respective LEAD mutant proteins. Thus, the super-LEAD mutant proteins have two of more of the single amino acid mutations derived from two or more of the respective LEAD mutant proteins. As described herein, LEAD
mutant proteins provided herein are defined as mutants whose performance or fitness has been optimized with respect to the native protein. LEADs typically contain one single mutation relative to its respective native protein. This mutation represents an appropriate amino acid replacement that takes place at one is-HIT position. Further super-LEAD mutant proteins are created such that they carry on the same protein molecule, more than one LEAD mutation, each at a different is-HIT
position. Once the LEAD mutant proteins have been identified using the 2D-scanning methods provided herein, super-LEADs can be generated by combining two or more individual LEAD mutant mutations using methods well-known in the art, such as recombination, mutagenesis and DNA
shuffling, and by methods, such as additive directional mutagenesis and Multi-Overlapped Primer Extensions, provided herein.
1 ) Additive Directional Mutagenesis.
Also provided herein are methods for assembling on a single mutant protein multiple mutations present on the individual LEAD
molecules, so as to generate super-LEAD mutant proteins. This method is referred to herein as "Additive Directional Mutagenesis" (ADM). ADM
comprises a repetitive multi-step process where at each step after the creation of the first LEAD mutant protein a new LEAD mutation is added onto the previous LEAD mutant protein to create successive super-LEAD
mutant proteins. ADM is not based on genetic recombination mechanisms, nor on shuffling methodologies; instead it is a simple one-mutation-at-a-time process, repeated as many times as necessary until the total number of desired mutations is introduced on the same molecule.
To avoid the exponentially increasing number of all possible combinations that can be generated by putting together on the same molecule a given number of single mutations, a method is provided herein that, although it does not cover all the combinatorial possible space, still captures a big part of the combinatorial potential. The word "combinatorial" is used here in its mathematical meaning (i.e., subsets of a group of elements, containing some of the elements in any possible order) and not in the molecular biological or directed evolution meaning (i.e., generating pools, or mixtures, or collections of molecules by randomly mixing their constitutive elements).
A population of sets of nucleic acid molecules encoding a collection of new super-LEAD mutant molecules is generated, tested and phenotypically characterized one-by-one in addressable arrays. super-LEAD mutant molecules are such that each molecule contains a variable number and type of LEAD mutations. Those molecules displaying further improved fitness for the particular feature being evolved, are referred to as super-LEADs. Super-LEADs may be generated by other methods known to those of skill in the art and tested by the high throughput methods herein. For purposes herein a super-LEAD typically has activity with respect to the function or biological activity of interest that differs from the improved activity of a LEAD by a desired amount, such as at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 7 50%, 200% or more from at least one of the LEAD mutants from which it is derived. In yet other embodiments, the change in activity is at least about 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, or more greater than at least one of the LEAD molecules from which it is derived. As with LEADs, the change in the activity for super-LEADs is dependent upon the activity that is being "evolved." The desired alteration, which can be either an increase or a reduction in activity, will depend upon the function or property of interest.
In one embodiment provided herein, the ADM method employs a number of repetitive steps, such that at each step a new mutation is added on a given molecule. Although numerous different ways are possible for combining each LEAD mutation onto a super-LEAD protein, an exemplary way the new mutations (e.g., mutation 1 (m1 ), mutation 2 (m2), mutation 3 (m3), mutation 4 (m4), mutation 5 (m5), mutation n (mn)) can be added corresponds to the following diagram:
m1 m1 +m2 m1 +m2+m3 m1 +m2+m3+m4 m1 +m2+m3+m4+m5 m1 +m2+m3+m4+m5+...+mn m1 +m2+m4 m1 +m2+m4+m5 m1 +m2+m4+m5+...+mn m1 +m2+m5 m1 +m2+m5+...+mn m2 m2+m3 m2+m3+m4 m2+m3+m4+m5 m2+m3+m4+m5+...+mn m2+m4 m2+m4+m5 m2+m4+m5+...+mn m2+m5 m2+m5+...+mn ..., etc....
2) Multi-Overlapped Primer Extensions In another embodiment, provided herein is a method for the rational evolution of proteins using oligonucleotide-mediated mutagenesis referred to as "multi overlapped primer extensions." This method can be used for the rational combination of mutant LEADs to form super-LEADS. This method allows the simultaneous introduction of several mutations throughout a small protein or protein-region of known sequence.
Overlapping oligonucleotides of typically around 70 bases in length (since longer oligonucleotides lead to increased error) are designed from the DNA sequence (gene) encoding the mutant LEAD proteins in such a way that they overlap with each other on a region of typically around 20 bases. These overlapping oligonucleotides (including or not point mutations) act as both template and primers in a first step of PCR (using a proofreading polymerase, e.g., Pfu DNA polymerase, to avoid unexpected mutations) to create small amounts of full-length gene. The full-length gene resulting from the first PCR is then selectively amplified in a second step of PCR using flanking primers, each one tagged with a restriction site in order to facilitate subsequent cloning. One multi overlapped extension process yields a full-length (multi-mutated) nucleic acid molecule encoding a candidate super-LEAD protein having multiple mutations therein derived from LEAD mutant proteins.
Although typically about 70 bases are used to create the overlapping oligonucleotides, the length of additional overlapping oligonucleotides for use herein can range from about 30 bases up to about 100 bases, from about 40 bases up to about 90 bases, from about 50 bases up to about 80 bases, from about 60 bases up to about 75 bases, and from about 65 bases up to about 75 bases. As set forth above, typically about 70 bases are used herein.
Likewise, although typically the overlapping region of the overlapping oligonucleotides is about 20 bases, the length of other overlapping regions for use herein can range from about 5 bases up to about 40 bases, from about 10 bases up to about 35 bases, from about 15 bases up to about 35 bases, from about 15 bases up to about 25 bases, from about 16 bases up to about 24 bases, from about 17 bases up to about 23 bases, from about 18 bases up to about 22 bases, and from about 19 bases up to about 21 bases. As set forth above, typically about 20 bases are used herein for the overlapping region.
J. Uses of the Mutant IFNa, IFN/3 Genes and Cytokines in Therapeutic Methods The optimized cytokines provided herein, such as the IFNa-2b and IFN~3 proteins and other modified cytokines, are intended for use in various therapeutic as well as diagnostic methods. These include all methods for which the unmodified proteins are used. By virtue of their improved phenotypes and activities, the proteins provided herein should exhibit improvement in the corresponding in vivo phenotype.
In particular, the optimized cytokines, such as the IFNa-2b and IFN~3 proteins, are intended for use in therapeutic methods in which cytokines have been used for treatment. Such methods include, but are not limited to, methods of treatment of infectious diseases, allergies, microbial diseases, pregnancy related diseases, bacterial diseases, heart diseases, viral diseases, histological diseases, genetic diseases, blood related diseases, fungal diseses, adrenal diseases, cancers, liver diseases, autoimmune diseases, growth disorders, diabetes, neurodegenerative diseases, including mulitiple sclerosis, Parkinson's disease and Alzheimer's disease.
1 ) Fusion Proteins Fusion proteins containing a targeting agent and mutant IFNa, including IFNa-2b and IFNa-2a, and IFN~3 mutant proteins, or cytokine protein also are provided. Pharmaceutical compositions containing such fusion proteins formulated for administration by a suitable route are provided. Fusion proteins are formed by linking in any order the mutant protein and an agent, such as an antibody or fragment thereof, growth factor, receptor, ligand and other such agent for directing the mutant protein to a targeted cell or tissue. Linkage can be effected directly or indirectly via a linker. The fusion proteins can be produced recombinantly or chemically by chemical linkage, such as via heterobifunctional agents or thiol linkages or other such linkages. The fusion proteins can contain additional components, such as E. coli maltose binding protein (MBP) that aid in uptake of the protein by cells (see, International PCT application No.
WO 01 /3271 1 ).
2) Nucleic Acid Molecules for Expression Nucleic acid molecules encoding the mutant cytokines including the mutant IFNa proteins and iFN a proteins, such as the IFNa-2b and IFNa-2a proteins, provided herein, or the fusion protein operably linked to a promoter, such as an inducible promoter for expression in mammalian cells also are provided. Such promoters include, but are not limited to, CMV and SV40 promoters; adenovirus promoters, such as the E2 gene promoter, which is responsive to the HPV E7 oncoprotein; a PV promoter, such as the PBV p89 promoter that is responsive to the PV E2 protein;
and other promoters that are activated by the H!V or PV or oncogenes.

The mutant cytokines infcuding the mutant interferons (IFNa's and 1FN~3') proteins provided herein, also can be delivered to the cells in gene transfer vectors. The transfer vectors atso can encode encode additional other therapeutic agents) for treatment of the disease or disorder, such cancer or HIV infection, for which the cytokine is administered.
3) Formulation of Optimized Cytokines Pharmaceutical compositions containing an optimized cytokine produced herein, such as IFNa-2b, IFNa-2a and IFN/3, fusion proteins or encoding nucleic acid molecules can be formulated in any conventional manner by mixing a selected amount of an optimized cytokine with one or more physiologically acceptable carriers or excipients. Selection of the carrier or excipient depends upon the mode of administration (i.e., systemic, local, topical or any other mode) and disorder treated. The pharmaceutical compositions provided herein can be formulated for single dosage administration. The concentrations of the compounds in the formulations are effective for delivery of an amount, upon administration, that is effective for the intended treatment. Typically, the compositions are formulated for single dosage administration. To formulate a composition, the weight fraction of a compound or mixture thereof is dissolved, suspended, dispersed or otherwise mixed in a selected vehicle at an effective concentration such that the treated condition is relieved or ameliorated. Pharmaceutical carriers or vehicles suitable for administration of the compounds provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.
In addition, the compounds may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients. Liposomal suspensions, including tissue-targeted liposomes, may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art. For example, liposome formulations may be prepared as described in U.S. Patent No. 4,522,811.
The active compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated.
The therapeutically effective concentration may be determined empirically by testing the compounds in known in vitro and in vivo systems, such as the assays provided herein. The active compounds can be administered 90 by any appropriate route, for example, orally, parenterally, intravenously, intradermally, subcutaneously, or topically, in liquid, semi-liquid or solid form and are formulated in a manner suitable for each route of administration.
The optimized cytokine and physiologically acceptable salts and solvates can be formulated for administration by inhalation (either through the mouth or the nose) or for oral, buccal, parenteral or rectal administration. For administration by inhalation, the optimized cytokine can be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluorethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g., gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of a therapeutic compound and a suitable powder base such as lactose or starch.
For oral administration, the pharmaceutical compositions can take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starch glycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets can be coated by methods well known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup, cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl or propyl-p-hydroxybenzoates or sorbic acid). The preparations can also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.
Preparations for oral administration can be suitably formulated to give controlled release of the active compound. For buccal administration the compositions can take the form of tablets or lozenges formulated in conventional manner.
The optimized cytokine can be formulated for parenteral administration by injection e.g., by bolus injection or continuous infusion.
Formulations for injection can be presented in unit dosage form e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions can take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient can be in powder-lyophilized form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
In addition to the formulations described previously, the optimized cytokine also can be formulated as a depot preparation. Such long acting formulations can be administered by implantation (for example, subcutaneously or intramuscularly) or by intramuscular injection. Thus, for example, the therapeutic compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
The active agents can be formulated for local or topical application, such as for topical application to the skin and mucous membranes, such as in the eye, in the form of gels, creams, and lotions and for application to the eye or for intracisternal or intraspinal application. Such solutions, particularly those intended for ophthalmic use, can be formulated as 0.01 % - 10% isotonic solutions, pH about 5-7, with appropriate salts.
The compounds can be formulated as aerosols for topical application, such as by inhalation (see, e.g., U.S. Patent Nos. 4,044,126, 4,414,209, and 4,364,923, which describe aerosols for delivery of a steroid useful for treatment inflammatory diseases, particularly asthma).
The concentration of active compound in the drug composition will depend on absorption, inactivation and excretion rates of the active compound, the dosage schedule, and amount administered as well as other factors known to those of skill in the art. For example, the amount that is delivered is sufficient to treat the symptoms of hypertension.
The compositions may, if desired, be presented in a pack or dispenser device which can contain one or more unit dosage forms containing the active ingredient. The pack can for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser device can be accompanied by instructions for administration.
The active agents can be packaged as articles of manufacture containing packaging material, an agent provided herein, and a label that indicates the disorder for which the agent is provided.
K. Examples The following examples are included for illustrative purposes only and are not intended to limit the scope of the invention. The specific methods exemplified can be practiced with other species. The examples are intended to exemplify generic processes.

This example describes a plurality of chronological steps including steps from (i) to (viii):
(i) cloning of IFNa cDNA in a mammalian cell expression plasmid (section A.1 ) (ii) generation of a collection of targeted mutants on the IFNa cDNA in the mammalian cell expression plasmid (section B) (iii) production of IFNa mutants in mammalian cells (section C.1 ) (iv) screening and partial in vitro characterization of IFNa mutants produced in mammalian cells in search of lead mutants (section D) (v) cloning of the lead mutants into a bacterial cell expression plasmid (section A.2) (vi) expression of lead mutants in bacterial cells (section C.2) (vii) in vitro characterization of lead mutants produced in bacteria (section D) (viii) in vivo characterization of lead mutants produced in bacteria (section E) .

A. Cloning of IFNa-2b encoding cDNA
A.1. Cloning of (FN a-2b cDNA in a mammalian cell expression plasmid The IFN a-2b cDNA was first cloned into an mammalian expression vector, prior to the generation of the selected mutations. A collection of mutants was then generated such that each individual mutant was created and processed individually, physica((y separated form each other and in addressable arrays. The mammalian expression vector pSSV9 CMV
0.3 pA was engineered as follows:
The pSSV9 CMV 0.3 pA was cut by Pvull and religated (this step gets rid of the ITR functions), prior to the introduction of a new EcoRl restriction site by Quickchange mutagenesis (Stratagene). The oligonucleotides primers were:
EcoRl forward primer 5'-GCCTGTATGATTTATTGGATGTTGGAATTCC-CTGATGCGGTATTTTCTCCTTACG-3' (SEQ ID NO: 218) EcoRl reverse primer 5'-CGTAAGGAGAAAATACCGCATCAGGGAATT-CCAACATCCAATAAATCATACAGGC-3' (SEQ ID NO: 219).
The construct sequence was confirmed by using the following oligonucleotides:
Seq Clal forward primer: 5'-CTGATTATCAACCGGGGTACATATGATTGAC-ATGC-3' (SEQ ID N0: 2201 Seq Xmnl reverse primer 5'-TACGGGATAATACCGCGCCACATAGCAGAA-C-3' (SEQ ID NO: 22'i ).
Then, the ~Cmnl-Clal fragment containing the newly introduced EcoRl site was cloned into pSSV9 CMV 0.3 pA (SSV9 is a clone containing the entire adeno-associated virus (AAV) genome inserted into the Pvull site of plasmid pEMBL (see, Du et al. (1996) Gene Ther 3:254-261 )) to replace the corresponding wild-type fragment and produce construct pSSV9-2EcoRl.
The DNA sequence of the IFNa-2b cDNA, which was inserted into the mammalian vector pDG6 (ATCC accession No. 53169), was confirmed using a pair of internal primers. The sequences of the IFNa-2b-related oligonucleotides for sequencing follow:
Seq forward primer: 5'-CCTGATGAAGGAGGACTC-3' (SEQ ID NO: 222) Seq reverse primer: 5'-CCAAGCAGCAGATGAGTC-3' (SEO ID NO: 223).
Since the beginning of the IFNa-2b encoding cDNA (the signal peptide encoding sequence) is absent in pDG6, it was added using the oligonucleotide (see below)to the amplified gene. First, the IFNa-2b cDNA
was amplified by PCR using pDG6 as template using the following oligonucleotides as primers:
IFNa-2b 5' primer 5'-TCAGCTGCAAGTCAAGCTGCTCTGTGGGCTG-3° (SEQ
ID NO: 224) IFNa-2b 3' primer 5'-GCTCTAGATCATTCCTTACTTCTTAAACTTTC-TTGCAAGTTTGTTGAC-3' (SEQ JD NO: 225) The PCR product was fihen used in an overlapping PCR using the following oligonucleotide sequences, having Hind III or Xbal restriction sites (underlined) or the DNA sequence missing in pDG6 (underlined):
IFNa-2b Hindlll primer 5'-CCCAAGCTTATGGCCTTGACCTTTGCTTTACT-GGTG-3' (SEQ ID NO: 226) IFNa-2b Xbal primer 5'-GCTCTAGATCATTCCTTACTTCTTAAACTTTC-TTGCAAGTTTGTTGAC-3' (SEQ JD NO: 227) IFNa-2b 80bp 5' primer 5'-CCCAAGCTTATGGCCTTGACCTTTGCTTTA-CTGGTGGCCCTCCTGGTGCTCAGCTGCAAGTCAAGCTGCTCTGTGGGCTG-3' (SEQ ID
NO: 228).
The entire IFNa-2b cDNA was cloned into the pTOPO-TA vector (Invitrogen). After checking gene sequence by automatic DNA
sequencing, the Hindlll-Xbal fragment containing the gene of interest was subcloned into the corresponding sites of pSSV9-2EcoRl to produce pAAV-EcoRl-IFNalpha-2b (pNB-AAV-IFN alpha-2b).
A.2 Cloning of the IFN a-2b leads in an E. coli expression plasmid A.2.1 Characterization of the bacterial cells BL21-CodonPlus(DE3)-RP~ competent Escherichia coli cells are derived from Stratagene's high-performance BL21-Gold competent cells.
These cells enable efficient high-level expression of heterologous proteins in E. toll. Efficient production of heterologous proteins in E. coli is frequently limited by the rarity, in E.coli, of certain tRNAs that are abundant in the organisms from which the heterologous proteins are derived. Availability of tRNAs allows high-level expression of many heterologous recombinant genes in BL21-Codon Plus cells that are poorly expressed in conventional BL21 strains.BL21-CodonPLus(DE3)-RP cells contain a ColE1-compatible, pACYC-based plasmid containing extra copies of the argU and proL tRNA genes.
A.2.2 Cloning of wild-type IFN a To express IFN a-2b in E.coli cDNA encoding the mature form of IFN-2 a-2b was finally cloned into the plasmid pET-1 1 (Novagen). Briefly, this cDNA fragment was amplified by PCR using the primers SEQ ID Nos.
1306 and 1305, respectively:
FOR-IFNA-5' AACATATGTGTGATCTGCCTCAAACCCACAGCCTGGGTAGC 3' REV-IFNA-5' AAGGATCCTCATTCCTTACTTCTTAAACTTTCTTGCAAGTTTGTTG3', from pSSV9-EcoR!-IFN a-2b (see above), which contains full-length IFN-2 alpha cDNA as a matrix, using Herculase DNA-polymerase (Stratagene).
The PCR fragment was subcloned into pTOPO-TA vector (Invitrogen) yielding pTOPO-IFN a-2b. The sequence was verified by sequencing.
pET1 1 IFN a-2b was prepared by insertion of the Ndel-Bam Hl (Biolabs) fragment from pTOPO-IFN a-2b into the Ndel-Bam HI sites of pET 11. The DNA sequence of fihe resulting pET 11-IFN a-2b construct was verified by sequencing and the plasmid was used for IFN a-2b expression in E.coli.
A.2.3 Cloning of IFN a-2b mutants from the mammalian expression plasmid into the E.coli expression plasmid Lead mufiants of Infierferon alpha were first generated in the pSSV9-IFNa-EcoRl plasmid. With the only exception of E159H and E159Q, all mutants were amplified using the primers below. Primers contained Ndel (in Forward) and BamHl (in Reverse) restriction sites:
FOR-IFNA-5' AACATATGTGTGATCTGCCTCAAACCCACAGCCTGGGTAGC 3' (SEQ ID
No. 1306; and REV-IFNA-5' AAGGATCCTCATTCCTTACTTCTTAAACTTTCTTGCAAGTTTGTTG 3' (SEQ
ID No. 1305) Mutants E159H and E159Q were amplified using the following primers on reverse side (primer forward was the same than described above):
REV-IFNA-E159H-5' AAGGATCCTCATTCCTTACTTCTTAAACTGTGTTGCAAGTTTGTTG 3' SEQ ID No. 1304 above; and REV-IFNA-E159Q-5' AAGGATCCTCATTCCTTACTTCTTAAACTCTGTTGCAAGTTTGTTG 3' SEQ ID No. 1305.
Mutants were amplified with Pfu Turbo Polymerase (Stratagene) according. PCR products were cloned into pTOPO plasmid (Zero Blunt TOPO PCR cloning kit, Invitrogen). The presence of fihe desired mutations was checked by automatic sequencing. The Ndel + BamHl fragment of the pTOPO-IFNa positive clones was then cloned into Ndel + BamHl sites of the pET11 plasmid.
B. Construction of a collection of IFNa-2b mutants in a mammalian expression plasmid A series of mutagenic primers was designed to generate the appropriate site-specific mutations in the IFNa-2b cDNA. Mutagenesis reactions were performed wifih the Chameleon~ mutagenesis kit (Stratagene) using pNB-AAV-IFNa-2b as the template. Each individual mutagenesis reaction was designed to generate one single mutant protein.

Each individual mutagenesis reaction contains one and only one mutagenic primer. For each reaction, 25 pmoles of each (phosphorylated) mutagenic primer were mixed with 0.25 pmoles of template, 25 pmoles of selection primer (introducing a new restriction site), and 2 ,cal of 1 OX
mutagenesis buffer ( 100 mM Tris-acetate pH 7.5; 100 mM MgOAc; 500 mM KOAc pH 7.5) into each well of 96 well-plates. To allow DNA
annealing, PCR plates were incubated at 98 °C during 5 min and immediately placed 5 min on ice, before incubating at room temperafiure during 30 min. Elongation and ligation reactions were allowed by addition of 7 ~I of nucleotide mix (2.86 mM each nucleotide; 1.43 X mutagenesis buffer) and 3 ,cal of a freshly prepared enzyme mixture of dilution buffer (20 mM Tris HCI pH7.5; 10 mM KCI; 10 mM ,Q-mercaptoethanol; 1 mM
DTT; 0.1 mM EDTA; 50 % glycerol), native T7 DNA polymerase (0.025 U/,ul), and T4 DNA ligase (1 U/~al) in a ratio of 1:10, respectively.
Reactions were incubated at 37 °C for 1 h before inactivation of ligase at 72 °C during 15 min. In order to eliminate the parental plasmid, 30 ,ul of a mixture containing 1 X enzyme buffer and 10 U of restriction enzyme was added to the mutagenic reactions followed by incubation at 37 °C for at least 3 hours, Next, 90,1 aliquots of XLmutS competent cells (Stratagene) containing 25 mM /3-mercaptoethanol were place in ice-chilled deep-well plates. Then, plates were incubated on ice for 10 min with gentle vortex every 2 min. Transformation of competent cells was performed by adding aliquots of the restriction reactions (1/10 of reaction volume) and incubating on ice for 30 min. A heat pulse was performed in a 42 °C water bath for 45 s, followed by incubation on ice for 2 minutes.
Preheated SOC medium (0.45 ml) was added to each well and plates were incubated at 37 °C for 1 h with shaking. In order to enrich for mutated plasmids, 1 ml of 2 X YT broth medium supplemented with 100 ~ag/ml ampicillin was added to each transformation mixture followed by overnight incubation at 37 °C with shaking. Plasmid DNA isolation was performed by alkaline lysis using Nucleospin Multi-96 Plus Plasmid Kit (Macherey-Nagel) according to the manufacturer's instructions. Selection of mutated plasmids was performed by digesting 500,~g of plasmid preparation with 10 U of selection endonuclease in an overnight incubation at 37 °C. A fraction of the digested reactions (1 /10 of the total volume) was transformed into 40,c~1 of Epicurian coli XL1-Blue competent cells (Stratagene) supplemented with 25 mM ~3-mercaptoethanol.
Transformation was performed was as described above.
Transformants were selected on LB-ampicillin agar plates incubated overnight at 37 °C. Isolated colonies were picked up and grown overnight at 37 °C into deep-well plates. Four clones per reaction were screened by endonuclease digestion of a new restriction site introduced by the selection primer. Finally, each mutation that was introduced to produce this collection of candidate LEAD IFNa-2b mutant plasmids encoding the proteins set forth in Table 2 of Example 2 was confirmed by automatic DNA sequencing.
C. Production of IFNa-2b mutants C.1 In mammalian cells IFNa-2b mutants were produced in 293 human embryo kidney (HEK) cells (obtained from ATCC), using Dubelcco's modified Eagle's medium supplemented with glucose (4.5 g/L; Gibco-BRL) and fetal bovine serum (10%, Hyclone). Cells were transiently transfected with the plasmids encoding the IFNa-2b mutants as follows: 0.6 x 105 cells were seeded into 6 well-plates and grown for 36 h before transfection Confluent cells at about 70%, were supplemented with 2.5 ,gig of plasmid (IFNa-2b mutants) and 10 mM poly-ethylene-imine (25 KDa PEI, Sigma-Aldrich). After gently shaking, cells were incubated for 16 h. Then, the culture medium was changed with 1 ml of fresh medium supplemented with 1 % of serum. IFNa-2b was measured on culture supernatants obtained 40 h after transfection and stored in aliquots at -80 °C until use.
Supernatants containing IFNa-2b from transfected cells were screened following sequential biological assays as follows. Normalization of IFNa-2b concentration from culture supernatants was performed by enzyme-linked immunoabsorbent assay (ELISA) using a commercial kit (R
& D) and following the manufacturer's instructions. This assay includes plates coated with an IFNa-2b monoclonal antibody that can be developed by coupling a secondary antibody conjugated to the horseradish peroxidase (HRP). IFNa-2b concentrations on samples containing (i) wild type IFNa-2b produced under comparable conditions as the mutants, (ii) the IFNa-2b mutants and (iii) control sampies(produced from cells expressing GFP) were estimated by using an international reference standard provided by the NIBSC, UK.
C.2 In bacteria A volume of 200 ml of culture medium (LB/Ampicillin/
Chloramphenicol) was inoculated with 5 ml of pre-culture BL21-pCodon +-pET-IFN a-2b muta overnight at 37 °C with constant shaking (225 rpm). The production of IFN a-2b was induced by the addition of 50 ,ul of 2M IPTG at DOsoo~m ~--0.6.
The culture was continued for 3 additional hours and was centrifuged at 4°C and 5000 g for 15 minutes. The supernatant (culture medium) was discarded and bacteria were lysed in 8 ml of lysis buffer by thermal shock (freezing - thawing: 37°C - 15 min; -80°C - 10 min;
37°C - 15 min; -80°C - 10 min; 37°C - 15 min). After centrifugation (10000 g, 15 min, 4°C), the supernatant (soluble proteins fraction) was discarded, and the precipitated material (insoluble protein fraction containing the IFN a -2b protein as inclusion bodies) was purified.

C.3 Pre-purification of IFN a-2b as inclusion bodies in E. coli C.3.1 Washing of inclusion bodies by sonication Pellets containing the inclusion bodies were suspended in 10 ml of buffer and sonicated (80 watts) on ice, 1 second "on," 1 second "off" for a total of 4 min. Suspensions were then centrifuged (4°C, 10000 g, 15 min), and supernatants were recovered. Pellets were resuspended in 10 ml of buffer for a new sonication/centrifugation cycle. Triton X-100 was then eliminated by two additional cycles of sonication/centrifugation with buffer. Pellets containing the inclusion bodies were recovered and dissolved. The washed supernatants were stored at 4°C.
C.3.2 Solubilization of inclusion bodies by denaturation Once washed, the inclusion bodies were solubilized in buffer at a concentration estimated in 0.3 mg/ml measuring the OD28o (considering the coefficient of molar extinction of IFN a-2b). Solubilization was carried out overnight at 4°C, under shaking.
C.3.3 Renaturation of IFN a-2b by dialysis of GdnHCI
Samples contained 1 mg of protein at 0.3 mg/ml (5 ml in total) in buffer. The GdnHCI (Hydrochloride Guanidium) present in the samples was eliminated by dialysis (minimum membrane cut = 10 kDa) overnight at 4°C against buffer (1iitre) (final concentration of GdnHCI : 43 Mm).
Next, samples were further dialysed against llitre of buffer during 2:30h.
This step was repeated two additional times. After dialysis, very little precipitate was visible.
D. Screening and in vitro charaterization of IFN a-2b mutants Two activities were measured directly on IFN samples: antiviral and antiproliferation activities. Dose (concentration) - response (activity) experiments for antiviral or antiproliferation activity permitted calculation of the 'potency' for antiviral and antiproliferation activities, respectively.
Antiviral and antiproliferation activities also were measured after incubation with proteolytic samples, such as specific proteases, mixtures of selected proteases, human serum or human blood. Assessment of activity following incubation with proteolytic samples allowed to determine the residual (antiviral or antiproliferation) activity and the respective kinetics of half-life upon exposure to proteases.
D.1. Antivira! activity IFNa-2b protects cells against viral infection by a complex mechanism devoted to create an unfavorable environment for viral proliferation. Cellular antiviral response due to IFNa-2b (IFN anti-viral assay) was assessed using an interferon-sensitive HeLa cell line (ATCC
accession no. CCL-2) treated with the encephalomyocarditis virus (EMCV). The assessment of either the virus-induced cytopathic effects (CPE) or the amount of EMCV mRNA in extracts of infected cells by RT-PCR was used to determine IFNa activity in samples.
D.1.1 Antiviral activity - measure by RT-qPCR
Confluent cells were trypsinized and plated at density 2 x 104 cells/well in DMEM 5% SVF medium (Day 0). Cells were incubated with IFN a-2b (at a concentration of 500 U/ml) to get 500 pg/ml and 150 pg/well (100,ca1 of IFN solution), during 24 h at 37 °C prior to be challenged with EMCV (1/1000 dilution; M01 100). After an incubation of 16 h, when virus-induced CPE was near maximum in untreated cells, the number of EMCV particles in each well was determined by RT-PCR
quantification of EMCV mRNA, using lysates of infected cells. RNA from cell extracts was purified after a DNAse/proteinase IC treatment (Applied Biosystems). The CPE was evaluated using bath Uptibleu (Interchim~ and MTS (Promega) methods, which are based on detecting bio-reductions produced by the metabolic activity of cells in a flourometric and coiorimetric manner, respectively. In order to produce a standard curve for EMCV quantification, a 22 by DNA fragment of the capsid protein-cDNA was amplified by PCR and cloned into pTOPO-TA vector (Invitrogen). Next, RT-PCR quantification of known amounts of pTOPO-TA-EMCV capsid gene was performed using the One-step RT-PCR kit (Applied Biosystems) and the following EMCV-related (cloning) oligonucleotides and probe:
EMCV forward primer 5'-CCCCTACATTGAGGCATCCA-3' (SEQ ID NO: 229) EMCV reverse primer 5'-CAGGAGCAGGACAAGGTCACT-3' (SEO ID NO: 230) EMCV probe 5'-(FAM)CAGCCGTCAAGACCCAACCGCT(TAMR A)-3' (SEO ID
NO: 231 ).
D.1.2 Antiviral activity - measure by CPE
Antiviral activity of IFN a-2b was determined by the capacity of the cytokine to protect Hela cells against EMC (mouse encephalomyocarditis) virus-induced cytopathic effects. The day before, Hela cells (2x105 cells/ml) were seeded in flat-bottomed 96-well plates containing 100 ,~I/well of Dulbecco's MEM-Glutamaxl-sodium pyruvate medium supplemented with 5% SVF and 0.2% of gentamicin. Cells were growth at 37°C in an atmosphere of 5% CO~ for 24 hours.
Two-fold serial dilutions of interferon samples were made with MEM complete media into 96-Deep-Well plates with final concentration ranging from 1600 to 0.6 pglml. The medium was aspirated from each well and 100 ,~I of interferon dilutions were added to Hela cells. Each interferon sample dilution was assessed in triplicate. The two last rows of the plates were filled with 100,1 of medium without interferon dilution samples in order to serve as controls for cells with and without virus.
After 24 hours of growth, a 1 /1000 EMC virus dilution solution was placed in each well except for the cell control row. Plates were returned to the C02 incubator for 48 hours. Then, the medium was aspirated and the cells were stained for 1 hour with 100 ,~I of Blue staining solutio to determine the proportion of intact cells. Plates were washed in a distilled water bath. The cell bound dye was extracted using 100 ,~I of ethylene-glycol mono-ethyl-ether (Sigma). The absorbance of the dye was measured using an Elisa plate reader (Spectramax). The antiviral activity of IFN a-2b samples (expressed as number of IU/rrrg of proteins) was determined as the concentration needed for 50% protection of the cells against EMC virus-induced cytopathic effects. For proteolysis experiments, each point of for the kinetic measurements was assessed at 500 and 166 pg/ml in triplicate.
D.2 Antiproliferation activity Anti-proliferative activity of interferona-2b was determined by the capacity of the cytokine to inhibit proliferation of Daudi cells. Daudi cells (1x104 cells) were seeded in flat-bottomed 96-well plates containing 50,u1/well of RPMI 1640 medium supplemented with 10% SVF, 1 X
glutamin and 1 ml of gentamicin. No cell was added to the last row ("H"
row) of the flat-bottomed 96-well plates in order to evaluate background absorbance of culture medium.
At the same time, two-fold serial dilutions of interferon samples were made with RPMI 1640 complete media into 96-Deep-Well plates with final concentration ranging from 6000 to 2.9 pg/ml. Interferon dilutions (50,u1) were added to each well containing 50,1 of Daudi cells.
The total volume in each well should now be 100,u1. Each interferon sample dilution was assessed in triplicate. Each well of the "G" row of the plates was filled with 50,ci1 of RPMI 1640 complete media in order to be used as positive control. The plates are incubated for 72 hours at 37°C
in a humidified, 5% C02 atmosphere.
After 72 hours of growth, 20 ,ul of Cell titer 96 Aqueous one solution reagent (Promega) was added to each well and incubated 1 H30 at 37°C in an atmosphere of 5% CO2. To measure the amount of colored soluble formazan produced by cellular reduction of the MTS, the absorbance of the dye was measured using an Elisa plate reader (spectramax) at 490nm.
The corrected absorbances ("H" row background value subtracted) obtained at 490nm were plotted versus concentration of cytokine. The ED50 value was calculated by determining the X-axis value corresponding to one-half the difference between the maximum and minimum absorbance values. (ED50 = the concentration of cytokine necessary to give one-half the maximum response).
D.3 Treatment of IFN a-2b with proteolytic preparations Mutants were treated with proteases in order to identify resistant molecules. The resistance of the mutant IFN a-2b molecules compared to wild-type IFN a-2b against enzymatic cleavage (30 min, 25 °C) by a mixture of proteases (containing 1.5 pg of each of the following proteases (1 % wt/wt, Sigma): a-chymotrypsin, carboxypeptidase, endoproteinase Arg-C, endoproteinase Asp-N, endoproteinase Glu-C, endoproteinase Lys-C, and trypsin) was determined. At the end of the incubation time, 10 ~I of anti-proteases complete, mini EDTA free, Roche (one tablet was dissolved in 10 ml of DMEM and then diluted to 1 /1000) was added to each reaction in order to inhibit protease activity. Treated samples were then used to determine residual antiviral or antiproliferation activities.
D.4 Protease resistance - Kinetic analysis The percent of residual IFN a-2b activity over time of exposure to proteases was evaluated by a kinetic study using either (a) 15 pg of chymotrypsin (10%wt/wt), (b) a lysate of human blood at dilution 1 /100, (c) 1.5 pg of protease mixture, or (d) human serum. Incubation times were: 0 h, 0.5 h, 1 h, 4 h, 8 h, 16 h, 24 h and 48 h. Briefly, 20 ~I of each proteolytic sample (proteases, serum, bnlood) was added to 100 ,ul of IFN a-2b at 1500 pg/ml (500U/ml) and incubated for variable times, as indicated. At the appropriate time points, 10 NI of anti-proteases mixture, mini EDTA free, Roche (one tablet was dissolved in 10 ml of DMEM and then diluted to 1 /500) was added to each well in order to stop proteolysis reactions. Biological activity assays were then performed as described for each sample in order to determine the residual activity at each time point.
D.5 Performance The various biological activities, protease resistance and potency of each individual mutant were analyzed using a mathematical model and algorithm (NautScanT""; described in French Patent No. 9915884;
(published as International PCT application No. WO 01 /44809 based on PCT n° PCT/FR00/03503). Data was processed using a Hill equation-based model that uses key feature indicators of the performance of each individual mutant. Mutants were ranked based on the values of their individual performance and those on the top of the ranking list were selected as leads.
E. Pharmacokinetics of selected lead mutants in mice IFNa -2b mutants selected on the basis of their overall performance in vitro, were tested for pharmacokinetics in mice in order to have an indication of their half-life in blood in vivo. Mice were treated by subcutaneous (SC) injection with alicuots of each of a number of selected lead mutants. Blood was collected at increasing time points between 0.5 and 48 hs after injection. Inmediatedly after collection, 20 ml of anti-protease solution were added to each blood sample. Serum was obtained for further analysis.Residual IFN-a activity in blood was determined using the tests described in the precedent sections for in vitro characterization.
Wild-type IFN a (that had been produced in bacteria under comparable conditions as the lead mutants) as well as a pegylated derivative of IFN a, Pegasys (Roche), also were tested for pharmacokinetics in the same experiments.

This example demonstrates the 2-dimensional (2D)scanning of IFNa-2b for increased resistance to proteolysis. For results, see Figures 6(A)-6(N), 6(T) and 6(U).
A) Identifying some or all possible target sites on the protein sequence that are susceptible to digestion by one or more specific proteases (these sites are the is-HITs).
Because IFNa-2b is administered as a therapeutic protein in the blood stream, a set of proteases was identified that were expected to broadly mimic the protease contents in serum. From that list of proteases, a list of the corresponding target amino acids was identified (shown in parenthesis) as follows: a-chymotrypsin (F, L, M, W, and Y), endoproteinase Arg-C (R), endoproteinase Asp-N (D), endoproteinase Glu-C (E), endoproteinase Lys-C (K), and trypsin (IC and R) Carboxypeptidase Y, which cleaves non-specifically from the carboxy-terminal ends of proteins, was also included in the protease mixture. The distribution of the target amino acids over the protein sequence spreads over the complete length of the protein, suggesting that the protein is potentially sensitive to protease digestion all over its sequence (FIG6A). In order to restrict the number of is-HITs to a lower number of candidate positions, the 3-dimensional structure of the IFNa-2b molecule (PDB code 1 RH2) was used to identify and select only those residues exposed on the surface, while discarding from the candidate list those which remain buried in the structure, and therefore stay less susceptible to proteolysis (FIG6B).
B) Identifying appropriate replacing amino acids, specific for each is-HIT, such that if used to replace one or more of the original, such as native, amino acids at that specific is-HIT, they can be expected to increase the is-HIT amino acid position's resistance to digestion by protease while at the same time, maintaining or improving the requisite biological activity of the protein (these replacing amino acids are the candidate LEADs).

To select the candidate replacing amino acids for each is-HIT
position, PAM250 matrix based analysis was used (FIG7). In one embodiment, the two highest values in PAM250 matrix, corresponding to the highest occurrence of substitutions between residues ("conservative substitutions" or "accepted point mutations"), were chosen (FIGB).
Whenever only a conservative substitution was available for a given high value of the PAM250, the following higher value was selected and the totality of conservative substitutions for this value was considered. The replacement of amino acids that are exposed on the surface by cysteine residues (as shown in FIGB, while replacing Y by H or I) was explicitly avoided, since this change would potentially lead to the formation of intermolecular disulfide bonds.
Thus, based on the nature of the challenging proteases, and on evolutionary considerations as well as protein structural analysis, a strategy was defined for the rational design of human IFNa-2b mutants having increased resistance to proteolysis which could produce therapeutic proteins having a longer half-life. By using the algorithm PROTEOL (http://www.infobiogen.fr), a list of residues along the IFNa-2b sequence was established, which can be recognized as a substrate for different enzymes present in the serum. Because the number of residues in this particular list was high, the 3-dimensional structure of IFNa-2b obtained from the NMR structure of IFNa-2a (PDB code 11TF) was used to select only those residues exposed to the solvent. Using this approach, 42 positions were identified, which numbering is that of the mature 2~ protein (SEQ ID N0:1 ): L3, P4, R12, R13, M16, R22, K23, F27, L30, K31, R33, E41, K49, E58, K70, E78, K83, Y89, E96, E107, P109, L1 10, M111, E113, L117, 8120, K121, 8125, L128, K131, E132, K133, K134, Y135, P137, M148, 8149, E159, L161, 8162, K164, and E165. Each of these positions was replaced by amino acid residues, such that they are defined as compatible by the substitution matrix PAM250 while at the same time the replacement amino acids do not generate new sites for proteases.
The list of performed residue substitutions as determined by PAM250 analysis is as follows:
RtoH,Q
EtoH,Q
KtoQ,T
LtoV,l MtoI,V
P to A, S
Y to I, H.
C) Systematically introducing the specific replacing amino acids (candidate LEADs) at every specific is-HIT position to generate a collection containing the corresponding mutant molecules.
The individual IFNa-2b mutants are generated, produced and phenotypically characterized one-by-one, in addressable arrays as set forth in Example 1, such that each mutant molecule contains initially amino acid replacements at only one is-HIT site. LEAD positions were obtained in IFNa-2b variants after a screening for protection against proteases, and comparing protease-untreated and protease-treated variant preparations with the corresponding conditions for the wild-type IFNa-2b.
The percent of residual (anti-viral) activity for the IFNa-2b E113H variant after treatment with chymotrypsin, protease mixture, blood lysate or serum was compared to the treated wild-type IFNa-2b. Selected IFNa-2b LEADs are shown in Table 2.
A top and side view of IFNa-2b structure in ribbon representation (obtained from NMR structure of IFNa-2b, PDB code 1 ITF) depict residues in "space filling" defining (1 ) the "receptor binding region" as deduced either by "alanine scanning" data and studies by Piehler et al., J. Biol.
Chem., 275:40425-40433, 2000, and Roisman et al., Proc. Nat/. Acad.
Sci USA, 98:13231-13236, 2001, and (2) replacing residues (LEADs) for resistance to proteolysis.
Table 2 Selected LEADs of IFNa-2b following protease resistance Mutant SEQ ID Proteolysis protectionIFN antiviral No. activity F27V 83 Pseudo wt Pseudo wt R33H 86 Pseudo wt Pseudo wt E41 87 Increased Increased Q

E41 88 Pseudo wt Increased H

E58Q 89 Increased Pseudo wt E58H 90 Increased Increased E78Q 92 Increased Increased E78H 93 Increased Increased Y89H 1303 Pseudo wt Pseudo wt E107Q 95 Increased Pseudo wt E107H 96 Increased Pseudo wt P109A 97 Pseudo wt Pseudo wt L110V 98 Pseudo wt Pseudo wt M111V 978 Pseudo wt Pseudo wt E113H 101 Increased Pseudo wt L117V 102 Increased Pseudo wt L1171 103 Increased Pseudo wt K121 104 Increased Pseudo wt Q

R125H 106 Increased Increased R125Q 107 Increased Increased K133Q 114 Increased Increased E159H 125 Increased Pseudo wt E159Q 124 Increased Pseudo wt Stabilization of IFNa-2b by Creation of N-Glycosylation Sites The creation of N-glycosylation sites on the protein was a second strategy that was used to stabilize IFNa-2b Natural human IFNa-2b contains a unique O-glycosylation site at position 129 (the numbering corresponds to the mature protein; SEQ ID N0:1 ), however, no N-glycosylation sites are found in this sequence. N-glycosylation sites are defined by the N-X-S or N-X-T consensus sequences. Glycosylation has been found to play a role in protein stability. For example, glycosylation has been found to increase bioavailability via higher metabolic stability and reduced clearance. In order to generate more stable IFNa-2b variants, the N-glycosylation consensus sequences indicated above were introduced in the IFNa-2b sequence by mutagenesis. Variants of IFNa-2b carrying new glycosylation sites were assessed as previously described.
The structure of IFNa-2b is characterized by a helix bundle composed of 5 helices {A, B, C, D and E) connected with each other by a series of loops {a large AB loop and three shorter BC, CD, DE loops). The helices are joined together by two disulfide bridges between residues 1 /98 and 29/138 of SEQ ID N0:1. The loops are contemplated herein to represent preferential sites for glycosylation given their exposure.
Therefore, N-glycosylation sites {N-X-S or N-X-T) were created in each of the loop sequences {Table 3). Selected LEADs and pseudo wild-type IFNa-2b mutants after screening for addition of glycosylation sites are shown in Table 4.
Table 3 In silico HITs for addition of glycosylation sites on IFNa-2b Codon No. SEQ ID N-X-S SEQ ID -N-X-T
No. No.

c2-4 D2N/P4S D2N/P4T

c3-5 L3N/Q5S L3N/Q5T

c4-6 P4N/T6S P4N/T6T

Codon No. SEQ 1D N-X-S SEQ ID N-X-T
No. No.

c5-7 127 Q5N/H7S 128 Q5N/H7T

c6-8 129 T6N/S8S T6N/S8T

c7-9 H7N/L9S H7N/L9T

c8-10 130 S8N/G 1 OS 131 SBNIG 1 OT

c9-11 L9NlS11S L9N/S11T

c10-12 132 M21 NlR23S M21 N/R23T

c22-24 R22N/124S R22N/124T

c23-25 R23N/S25S 133 R23N/S25T

c24-26 134 124N/L26S 124N/L26T

c25-27 135 S25N/F27S 136 S25N/F27T

c26-28 137 L26N/S28S 138 L26N/S28T

c28-30 S28N/L30S S28N/L30T

c30-32 139 L30N/D32S L30N/D32T

c31-33 K31 N/R33S K31 N/R33T

c32-34 D32N/H34S D32N/H34T

c33-35 140 R33N/D35S 141 R33N/D35T

c34-36 142 H34N/F36S 143 H34N/F36T

c35-37 144 D35N/G37S D35N/G37T

c36-38 145 F36N/F38S 146 F36N/F38T

c37-39 147 G37N/P39S G37N/P39T

c38-40 148 F38N/Q40S 149 F38N/Q40T

c39-41 150 P39N/E41 1 51 P39N/E41 T
S

c40-42 152 Q40N/E42S 153 Q40N/E42T

c41-43 E41 N/F43S 1 55 E41 N/F43T
, c42-44 E42N/G44S E42N/G44T

c43-45 F43N/N45S F43N/N45T

c44-46 156 G44N/Q46S 157 G44N/Q46T

c45-47 158 N45N/F47S 159 N45N/F47T

c46-48 160 Q46N/Q48S 161 Q46N/Q48T

c47-49 162 F47N/K49S 163 F47N/K49T

c48-50 Q48N/A50S Q48N/A50T

c49-51 164 K49N/E51S K49N/E51T

c50-52 A50N/T52S A50N/T52T

Codon No. SEQ ID N-X-S SEQ ID N-X-T
No. No.

c68-70 S68N/K70S S68N/K70T

c70-72 K70N/S72S K70N/S72T

c75-77 165 A75N/D77S A75N/D77T

c77-7g D77N/T79S D77N/T79T

C161-163 L161 NlS163S L161 N/S163T

Table 4 Selected LEADs and pseudo wild-type IFNa-2b mutants after screening for addition of glycosylation sites Mutant SEQ ID No. Proteolysis protectionIFN antiviral activity Q5N/H7S 127 Increased Pseudo wt Q5N/H7T 128 ND~ ND

P39N/E41 150 Increased Pseudo wt S

P39N/E41 151 Increased Pseudo wt T

Q40N/E42S 152 Increased Pseudo wt Q40N/E42T 153 Increased Pseudo wt E41 N/F43S 154 Increased Pseudo wt Mutant SEQ ID No. Proteolysis protectionIFN antiviral activity E41 N/F43T155 Increased Pseudo wt F43N1N45S Increased Pseudo wt G44N/Q46T 157 Increased Pseudo wt N45N/F47S 158 Increased Pseudo wt N45N/F47T 159 Increased Pseudo wt Q46N/Q48S 160 Increased Pseudo wt F47N/K49S 162 Increased Pseudo wt F47N/K49T 163 Increased Pseudo wt 1100N/G102S166 ~ Pseudo wt Increased 1100N/G102T167 Pseudo wt Increased V105N/E107S171 Pseudo wt Increased V105N/E107T Pseudo wt Increased T106N/T108S172 Pseudo wt Increased T106N1T108T173 Pseudo wt Increased E107N/P109S174 Pseudo wt Increased E107N/P109T175 Pseudo wt Increased L157N/E159S177 Pseudo wt Increased L157N/E159T178 Pseudo wt Increased E159N/L1.61180 Pseudo wt Increased S

F15AN/I161T181 Pseudo wt Increased ~ND, not determined Example 4 Redesign of Interferon a-2b Proteins The use of the protein redesign approach provided herein permits the generation of proteins such that they maintain requisite levels and types of biological activity compared to the native protein while their underlying amino acid sequences have been significantly changed by amino acid replacement. To first identify those amino acid positions on the IFNa-2b protein that are involved or not involved IFNa-2b protein activity, such as binding activity of IFNa-2b to its receptor, an Ala-scan was performed on the IFNa-2b sequence. For this purpose, each amino acid in the IFNa-2b protein sequence was individually changed into Alanine. Any other amino acid, particularly another amino acid that has a neutral effect on structure, such as Gly or Ser, also can be used. Each resulting mutant IFNa-2b protein was then expressed and the antiviral activity of the individual mutants was assayed. The particular amino acid positions that are sensitive to replacement by Ala, referred to herein as HITs would in principle not be suitable targets for amino acid replacement to increase protein stability, because of their involvement in the activity of the molecule. For the Ala-scanning, the biological activity measured for the IFNa-2b molecules was: i~ their capacity to inhibit virus replication when added to permissive cells previously infected with the appropriate virus and, iy their capacity to stimulate cell proliferation when added to the appropriate cells. The relative activity of each individual mutant compared to the native protein was assayed. HITS are those mutants that produce a decrease in the activity of the protein (e.g., in this example, all the mutants with activities below about 30% of the native activity) .
In addition, to identify the HIT positions, the Alanine-scan was used to identify the amino acid residues on IFNa-2b that when replaced with alanine lead to a 'pseudo-wild type' activity, i.e., those that can be replaced by alanine without leading to a decrease in biological activity.
A collection of mutant molecules was generated and phenotypically characterized such that IFNa-2b proteins with amino acid sequences different from the native ones but that still elicit the same level and type of activity as the native protein were selected. HITs and pseudo wild-type amino acid positions are shown in Table 5.
Table 5 HITs and pseudo wild-type positions to IFNa-2b redesign MutantsSEQ ID HITs (viral Pseudo wt (viral No. activity) activity) D2A 2 Decreased P4A 3 Pseudo wt Q5A 4 Pseudo wt T6A 5 Pseudo wt H7A 6 Decreased MutantsSEQ ID HITs (viral Pseudo wt (viral No. activity) activity) S8A 7 Decreased L9A 8 Pseudo wt G10A 9 Pseudo wt S11 10 Decreased A

R12A 11 Decreased R13A 12 Decreased T14A 13 Decreased L15A 14 Decreased M 16A 15 Decreased L17A 16 Pseudo wt Q20A 17 Pseudo wt R23A 18 Decreased 124A 19 Pseudo wt S25A 20 Pseudo wt L26A 21 Decreased S28A 22 Decreased C29A 23 Decreased L30A 24 Decreased K31 25 Decreased A

D32A 26 Decreased R33A 27 Decreased D35A 28 Pseudo wt G37A 29 Pseudo wt G39A 30 Pseudo wt E41 31 Pseudo wt A

E42 32 Pseudo wt F43A 33 Decreased N45A 34 Decreased F47A 35 Decreased E51 36 Pseudo wt A

T52A 37 Pseudo wt 153A 38 Decreased P54A 39 Pseudo wt V55A 40 Pseudo wt MutantsSEQ ID HITs (viral Pseudo wt (viral No. activity) activity) L56A 41 Pseudo wt H57A 42 Pseudo wt E58A 43 Pseudo wt M59A 44 Decreased 160A 45 Pseudo wt 163A 46 Pseudo wt F64A 47 Pseudo wt N65A 48 Pseudo wt L66A 49 Decreased F67A 50 Decreased T69A 51 Decreased K70A 52 Decreased D71 53 Decreased A

S72A 54 Decreased W76A 55 Pseudo wt D77A 56 Pseudo wt E78A 57 Pseudo wt L81A 58 Pseudo wt D82A 59 Decreased K83A 60 Decreased F84A 61 Decreased Y85A 62 Pseudo wt Y89A 63 Pseudo wt 0.90A 64 Pseudo wt Q91 65 Decreased N93A 66 Decreased D94A 67 Decreased C98A 68 Decreased V99A 69 Decreased Q101 207 Decreased A

G 104A70 Pseudo wt L110A 71 Pseudo wt S115A 72 Pseudo wt Y122A 73 Decreased MutantsSEQ ID HITs (viral Pseudo wt (viral No. activity) activity) W 140A 74 Decreased E146A 75 Pseudo wt Super LEADS of Interferon a-2b Protein by Additive Directional Mutagenesis The use of an additive directional mutagenesis approach provided a method for the assembly of multiple mutations previously present on the individual LEAD molecules in a single mutant protein thereby generating super-LEAD mutant proteins. In this method, a collection of nucleic acid molecules encoding a library of new mutant molecules is generated, tested and phenotypically characterized one-by-one in addressable arrays.
Super-LEAD mutant molecules are such that each molecule contains a variable number and type of LEAD mutations Using the LEADs obtained in Example 2, six series of mutant molecules were generated with more than one mutation per molecule as shown in Table 6. Some SuperLEAD mutant molecules were phenotypi-cally characterized and the results are shown in Table 7. As shown in the table not all SuperLEADS have improved activity compared with the original Leads; some showed decreased activity of some type.
Table 6 Schema of LEADs position for SuperLEADS generation Series 1 m 1 = E41 H
m 1 + m2 = E41 H + Y89H
Series 2 m1 = E58Q
m 1 + m2 = E58Q + F27V
Series 3 m1 = R125H
m1 +m2= R125H + M111V
Series 4 m1 = E159H
m1 +m2= E159H + Y89H
Series 5 m1 = K121Q
m1 +m2= K121Q + P109A
m1 +m2+m3= K121Q + P109A + K133Q
Series 6 m1 = E78H
m 1 + m2 = E78H + R33H
m 1 + m2 + m3 = E78H + R33H + E58H
m1 +m2+m3+m4= E78H + R33H + E58H + L1 10V
Table 7 SuperLEADs of IFNa-2b multiple mutants Mutant SEQ Proteolysis IFN
ID protection antiviral activity No.

E41 H 88 Pseudo wt Increased Y89H 1303 Pseudo wt Pseudo wt E41 H/Y89H/979 Increased Increased E58Q 89 Increased Pseudo wt F27V 83 Pseudo wt Pseudo wt E58Q/F27V 981 Increased Pseudo wt R125H 106 Increased Increased M1 1 1 V 978 Pseudo wt Pseudo wt R125H/M111V986 Increased Increased K121 Q 104 Increased Pseudo wt P109A 97 Pseudo wt Pseudo wt Mutant SEQ Proteolysis IFN
ID protection antiviral activity No.

K133Q 114 Increased Increased K121 Q/P109A983 Increased Pseudo wt K121Q1P109A984 Increased Increased /

E78H 93 Increased Increased R33H 86 Pseudo wt Pseudo wt E58H 89 Increased Increased L1 10V 98 Pseudo wt Pseudo wt E78H/R33H/ 982 Decreased Decreased Four mutants with mutations to additional those selected by the rational mutagenesis were generated in the E. coli MutS strain and were detected by sequencing. The mutants were the following: E41 Q/ D94G
SEQ.ID No. 199; L1 17V/ A139G SEQ.ID No. 204; E41 H/ Y89H/ N45D
SEQ.ID No. 198; and K121Q/ P109A/ IC133Q/ G102R SEQ.ID No. 204.

Cloning of IFN /3 in pNAUT, a mammalian cell expression plasmid The cDNA encoding IFN ~3 (see, SEQ ID No. 499) was cloned into a mammalian expression vector, prior to the generation of the selected mutations (see, Figures 6(O)-6(S) and 8(A). A collected of predesigned, targeted mutants was then generated such that each individual mutant was created and processed individually, physically separated form each other and in addressable arrays. The mammalian expression vector pSSV9 CMV 0.3 pA (see, Example 1 ) was engineered as follows:
The pSSV9 CMV 0.3 pA was cut by Pvull and religated (this step gets rid of the ITR functions), prior to the introduction of a new EcoRl restriction site by Quickchange mutagenesis (Stratagene). The oligonucleotides sequences used, follow:
EcoRl forward primer: 5'-GCCTGTATGATTTATTGGATGTTGGAATTCCCTGAT-GCGGTATTTTCTCCTTACG-3' (SEQ ID NO: 218) EcoRl reverse prime: 5'-CGTAAGGAGAAAATACCGCATCAGG-GAATTCCAACATCCAATAAATCATACAGGC-3' (SEQ ID NO: 219) The construct sequence was confirmed by using the following oligonucleotides:
Seq Clal forward primer: 5'-CTGATTATCAACCGGGGTACATATGATTGACATGC-3' (SEQ ID NO: 220) Seq Xmnl reverse primer 5'-TACGGGATAATACCGCGCCACATAGCAGAAC-3' (SEQ ID NO: 221 ).
Then, the Xmnl-Clal fragment containing the newly introduced EcoRl site was cloned into pSSV9 CMV 0.3 pA to replace the corresponding wild-type fragment and produce construct pSSV9-2EcoRl.
The IFN ~3-cDNA was obtained from the pIFN~31 (ATCC) construct.
The sequence of the IFN ~3-cDNA was confirmed by sequencing using the primers below:
Seq forward primer: 5'-CCTGATGAAGGAGGACTC-3' (SEQ ID N0:222) Seq reverse primer: 5'-CCAAGCAGCAGATGAGTC-3' (SEQ ID N0:223).
The verified IFN ~3-encoding cDNA first was cloned into the pTOPO-TA vector (Invitrogen). After checking of the cDNA sequence by automatic DNA sequencing, the Hindlll-Xbal fragment containing the IFN
cDNA was subcloned into the corresponding sites of pSSV9-2EcoRl, leading to the construct pAAV-EcoRl-IFNbeta (pNB-AAV-IFN beta) Finally the fragment Pvu II of plasmid pNB-AAV-IFN beta was subcloned in Pvull site of pUC 18 leading the final construct pUC-CMVIFNbetapA called pNAUT-IFNbeta.
Production and normalization of IFN~l3 in mammalian cells IFN ~3 was produced in CHO Chinese Hamster Ovarian cells (obtained from ATCC), using Dubelcco's modified Eagle's medium supplemented with glucose (4.5 g/L; Gibco-BRL) and fetal bovine serum (5 %, Hyclone). Cells were transiently transfected as follows: 0.6 x 105 cells were seeded into 6 well plates and grown for 24 h before transfection. Confluent cells at about 70%, were supplemented with 1.0 ,ug of plasmid (from the library of IFN ~3 mutants) by lipofectamine plus reagent (Invitrogen) . After gently shaking, cells were incubated for 24 h with 1 ml of culture medium supplemented with 1 % of serum. IFN ,Q was obtained from culture supernatants 24 h after transfection and stored in aliquots at -80 °C until use.
Preparations of IFN ~3 produced from transfected cells were screened following sequential biological assays as follows. Normalization of IFN ,Q concentration from culture supernatants was performed by ELISA. IFN ~3 concentrations from wild type, and mutants samples were estimated by using an international reference standard provided by the NIBSC, UK.
Screening and in vitro charaterization of IFN ~3 mutants Two activities were measured directly on IFN samples: antiviral and antiproliferation activities. Dose (concentration) - response (activity) experiments for antiviral or antiproliferation activity allowed for the calculation of the 'potency' for antiviral and antiproliferation activities, respectively. Antiviral and antiproliferation activities also were measured after incubation with proteolytic samples such as specific proteases, mixtures of selected proteases, human serum or human blood.
Assessment of activity following incubation with proteolytic samples allowed to determine the residual (antiviral or antiproliferation) activity anal the respective kinetics of half-life upon exposure to proteases Antiviral activity - measured by Cytopathic Effects (CPE) Antiviral activity of IFN ~3 was determined by the capacity of the cytokine to protect Hela cells against EMC (mouse encephalomyocarditis) virus-induced cytopathic effects. The day before, Hela cells (2x105 cells/ml) were seeded in flat-bottomed 96-well plates containing 100 ,ul/well of Dulbecco's MEM-Glutamaxl-sodium pyruvate medium supplemented with 5% SVF and 0.2% of gentamicin. Cells were growth at 37°C in an atmosphere of 5% C02 for 24 hours Two-fold serial dilutions of interferon samples were made with MEM
complete media into 96-Deep-Well plates with final concentration ranging from 1600 to 0.6 pg/ml. The medium was aspirated from each well and 100 ,cil of interferon dilutions were added to Hela cells. Each interferon sample dilution was assessed in triplicate. The two last rows of the plates were filled with 100 ,ul of medium without interferon dilution samples in order to serve as controls for cells with and without virus.
After 24 hours of growth, a 111000 EMC virus dilution solution was placed in each well, except for the cell control row. Plates were returned to the C02 incubator for 48 hours. Then, the medium was aspirated and the cells were stained for 1 hour with 100 ,cal of Blue staining solutio to determine the proportion of intact cells. Plates were washed in a distilled water bath. The cell bound dye was extracted using 100 dal of ethylene-glycol mono-ethyl-ether (Sigma). The absorbance of the dye was measured using an Elisa plate reader (Spectramax). The antiviral activity of IFN ~3 samples (expressed as number of IU/mg of proteins) was determined as the concentration needed for 50% protection of the cells against EMC virus-induced cytopathic effects. For proteolysis experiments, each point of the kinetic was assessed at 800 and 400 pg/ml in triplicate.
Anti-proliferative activity Anti-proliferative activity of IFN /3 was determined by assessing the capacity of the cytokine to inhibit proliferation of Daudi cells. Daudi cells (1x104 cells) were seeded in flat-bottomed 96-well plates containing 50,~1/well of RPMI 1640 medium supplemented with 10% SVF, 1 X
glutamine and 1 ml of gentamicin. No cell was added to the last row ("H"

row) of the flat-bottomed 96-well plates in order to evaluate background absorbance of culture medium.
At the same time, two-fold serial dilutions of interferon samples were made with RPMI 1640 complete media into 96-Deep-Well plates with final concentration ranging from 6000 to 2.9 pg/ml. Interferon dilutions (50,c~1) were added to each well containing 50,u1 of Daudi cells.
The total volume in each well should now be 100,u1. Each interferon sample dilution was assessed in triplicate. Each well of the "G" row of the plates was filled with 50,1 of RPMI 1640 complete media in order to be used as positive control. The plates were incubated for 72 hours at 37°C
in a humidified, 5% C02 atmosphere.
After 72 hours of growth, 20,x1 of Cell titer 96 Aqueous one solution reagent (Promega) was added to each well and incubated 1 H30 at 37°C in an atmosphere of 5% C02. To measure the amount of colored soluble formazan produced by cellular reduction of the MTS, the absorbance of the dye was measured using an Elisa plate reader (spectramax) at 490nm.
The corrected absorbances ("H" row background value subtracted) obtained at 490nm were plotted versus concentration of cytokine. The ED50 value was calculated by determining the X-axis value corresponding to one-half the difference between the maximum and minimum absorbance values. (ED50 = the concentration of cytokine necessary to give one-half the maximum response).
Treatment of IFN ~(3 with proteolytic preparations Mutants were treated with proteases in order to identify resistant molecules. The resistance of the mutant IFN.,r3molecules compared to wild-type IFN ~3 against enzymatic cleavage (120 min, 25 °C) by a mixture of proteases (containing 1.5 pg of each of the following proteases (1 % wtlwt, Sigma): a-chymotrypsin, carboxypeptidase, endoproteinase Arg-C, endoproteinase Asp-N, endoproteinase Glu-C, endoproteinase Lys-C, and trypsin) was determined. At the end of the incubation time, 10 ,ul of anti-proteases complete, mini EDTA free, Roche (one tablet was dissolved in 10 ml of DMEM and then diluted to 1 /1000) was added to each reaction in order to inhibit protease activity. Treated samples were then used to determine residual antiviral or antiproliferation activities.
Protease resistance - Kinetic analysis The percent of residual IFN ~3 activity over time of exposure to proteases was evaluated by a kinetic study using 1.5 pg of protease mixture. Incubation times were: 0 h, 0.5 h, 2 h, 4 h, 8 h, 12 h, 24 h and 48 h. Briefly, 20 ,ul of each proteolytic sample (proteases, serum, bnlood) was added to 100,ci1 of IFN ~3 at 400 and 800 pg/ml and incubated for variable times, as indicated. At the appropriate time points, 10 ~ul of anti-proteases mixture, mini EDTA free, Roche (one tablet was dissolved in 10 ml of DMEM and then diluted to 1 /500) was added to each well in order to stop proteolysis reactions. Biological activity assays were then performed as described for each sample in order to determine the residual activity at each time point.
Performance The various biological activities, protease resistance and potency of each individual mutant were analyzed using a mathematical model and algorithm (NautScanTM; Fr. Patent No. 9915884; see, also published International PCT application No. WO 01 /44809 based on PCT n °
PCT/FR00/03503). Data was processed using a Hill equation-based model that uses key feature indicators of the performance of each individual mutant. Mutants were ranked based on the values of their individual performance and those on the top of the ranking list were selected as leads.

Using the 2D-scanning and 3D-scanning methods described above in addition to the 3-dimensional structure of IFN/3, the following amino acid target positions were identified as is-HITs on IFN,l3, which numbering is that of the mature protein (SEQ ID N0:196):
By 3D-scanning (see, SEQ ID Nos. 234-289, 989-1015): D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by 1 at position 47, L by T at position 47, L by Q at position L by H at position 47, L by A at position 47, 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by H at position 73, D by G at position 73, D by Q at position 73, E by Q at position 81, E by H at position 81, E by Q at position 107, E by H at position 107, K by Q at position 108,K by T at position 108, K by S 108, K by at position H at position 108,E by Q at position 109, E by H 109, D by at position Q at position 1 D by H at position 1 10, D by 1 10, F by 10, G at position I at position 11 F by V at position 1 11, R by 1 13, R by 1, H at position Q at position1 L by V at position 1 16, L by 16, L by 13, I at position 1 T at position 116, 116, L by L A at by Q
at position 116, L
by H
at position position 1 L by V at position120, L by I at 20, L by T
16, position 1 at position 120,L by Q at position120, L by H at 120, L by position A at position 120,K by Q at position123, K by T at 123, K by position S at position123,K by H at position123, R by H at 124" R by position Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136" K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 163, Y by I at position 1631, R by H at position 165, R by Q at position 165.
By 2D-scanning (see, SEQ ID Nos.1016-1302, and table above): M
by V at position 1, M by I at position 1, M by T at position 1, M by Q at position 1 , M by A at position 1 , L by V at position 5 , L by I at position 5 , L by T at position 5 , L by Q at position 5 , L by H at position 5 , L by A at position 5 , F by I at position 8, F by V at position 8, L by V at position 9, L by I at position 9, L by T at position 9, L by Q at position 9, L by H at position 9, L by A at position 9, R by H at position 11, R by Q
at position 11, F by I at position 15 , F by V at position 15 , K by Q at position 19, K by T at position 19, K by S at position 19, K by H at position 19, W by S at position 22, W by H at position 22, N by H at position 25, N by S at position 25, N by Q at position 25, R by H
position 27, R by Q position 27, L by V at position 28, L by I at position 28, L by T at position 28, L by Q at position 28, L by H at position 28, L
by A at position 28, E by Q at position 29, E by H at position 29, Y by H
at position 30, Y by I at position 30, L by V at position 32, L by I at position 32, L by T at position 32, L by Q at position 32, L by H at position 32, L by A at position 32, K by Q at position 33, K by T at position 33, K by S at position 33, K by H at position 33, R by H at position 35, R by Q at position 35, M by V at position 36, M by I at position 36, M by T at position 36, M by Q at position 36, M by A at position 36, D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by, Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by Q at position 73, D by H at position 73, D by G at position 73, E by Q at position 81, E by H at position 81, E by Q at position 85, E by H at position 85, Y by H at position 92, Y by I at position 92 , K by Q at position 99, K by T at position 99, K by S at position 99, K by H at position 99, E by Q at position 103, E by H at position 103, E by Q at position 104, E by H at position 104, K by Q at position 105, K by T at position 105, K by S at position 105, K by H at position 105, E by Q at position 107, 107,K by Q at position108, K by E T at by H
at position position 108, K by S at position108,K by H at position108, E by Q at position 109, E by H at position109,D by Q at position1 10, D by H at position 110, D by G at position1 F by I at position 10, 1 11, F by V at position1 R by H at position1 R by Q at position1 13, L by 11, 13, V at position 116,L by I at position116, L by T at position 116, L by Q at position 116,L by H at position1 16, L by A at position 1 16, L by V at position 120,L by I at position120, L by T at position 120, L by Q at position 120,L by H at position120, L by A at position 120, K by Q at position123,K by T at position123, K by S at position 123, K by H at position 123,R by H at position124, R by Q at position124, R by H at position 128,R by Q at position128, L by V at position130, L by I at position 130,L by T at position130, L by Q at position130, L by H at position 130,L by A at position130, K by Q at position134, K by T at position134,K by S at position134, K by H at position134, K by Q at position 136, K by T at position 136, K by S at position 136, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 138, Y by I at position 138, R by H at position 152, R by Q at position 152, Y by H at position 155, Y by I at position 155, R by H at position 159, R by Q at position 159, Y by H at position 163, Y by I at position 163, R by H at position 165, R by Q at position 165, M by D at position 1, M by E at position 1, M by K at position 1, M by N at position 1, M by R at position 1, M by S at position 1, L by D at position 5, L by E
at position 5, L by K at position 5, L by N at position 5, L by R at position 5, L by S at position 5, L by D at position 6, L by E at position 6, L by K
at position 6, L by N at position 6, L by R at position 6, L by S at position 6, L by Q at position 6, L by T at position 6, F by E at position 8, F by K
at position 8, F by R at position 8, F by D at position 8, L by D at position 9, L by E at position 9, L by K at position 9, L by N at position 9, L by R
at position 9, L by S at position 9, Q by D at position 10 , Q by E at position 10 , Q by K at position 10 , Q by N at position 10 , Q by R at position 10 , Q by S at position 10 , Q by T at position 10 , S by D at position 12, S' by E at position 12, S by K at position 12, S by R at position 12, S by D at position 13, S by E at position 13, S by K at position 13, S by R at position13, S by N at 13, S by position Q at position 13, S by T at position13, N by D at 14, N by position E at position 14, N by K at position14, N by Q at 14, N by position R at position 14, N by S at position14, N by T at 14, F by position D at position15, F by E at position15, F by K at 15, F by position R at position 15, Q by D at position16, Q by E at position 16 , Q by K at position 16 , Q by N at 16 , Q by R at position 16 position , Q by S at position 16 , Q by T at 16 , C by D at position 17, position C by E at position 17, C by K at position17, C by N at position 17, C by Q at position17, C by R at position17, C by S at position 17, C by T at position 17, L by N at position 20, L by Q at position 20, L by R at position 20, L by S at position 20, L by T at position 20, L by D at position 20, L by E at position 20, L by K at position 20, W by D at position 22, W by E at position 22, W by K at position 22, W by R at position 22, Q by D at position 23, Q by E at position 23, Q by K at position 23, Q by R at position 23, L by D at position 24, L by E at position 24, L by K at position 24, L by R at position 24, W by D at position 79, W by E at position 79, W by K at position 79, W by R at position N by D at position 80, N by E at position 80, 79, N by K at position 80, N by R at position 80, T by D at position 82, T by E at position 82, T by K at position 82, T by R at position 82, I by D at position 83, I by E at position 83, I by K at position 83, I by R at position 83, I by N
at position 83, I by Q at position 83, 1 by S at position 83, I by T at position 83, N by D at position 86, N by E at position 86, N by K at position 86, N by R at position 86, N by Q at position 86, N by S at position 86, N by T at position 86, L by D at position 87, L by E at position 87, L by K at position 87, L by R at position 87, L by N at position 87, L by Q at position 87, L by S at position 87, L by T at position A by D at position 89, A by E at position 87, 89, A by K at position 89, A by R at position 89, N by D at position 90, N by E at position 90, N by K at position 90, N by Q at position 90, N by R at position 90, N by S at position 90, N by T at position 90, V by D at position 91, V by E at position 91, V by K at position 91, V by N at position V by Q at position 91, V by R at position 91, 91, V by S at position 91, V by T at position 91, Q by D at position 94, Q by E at position 94, Q by Q at position 94, Q by N at position 94, Q by R at position 94, Q by S at position 94, Q by T at position 94, I by D at position 95, I by E at position 95, 1 by K at position 95, I by N at position 95, I by t position 95, I by R at position 95, I by S
Q a at position 95, I by T at position 95, H by D at position 97, H by E at position 97, H by K at position 97, H by N at position 97, H by Q at position 97, H by R at position 97, H by S at position 97, H by T at position 97, L by D at position 98, L by E at position 98, L by K at position 98, L by N at position 98, L by Q at position 98, L by R at position 98, L by S at position 98, L by T at position 98, V by D at position 101, V by E at position 101, V by K at position 101, V by N at position 101, V by Q at position 101, V by R at position 101, V by S at position 101, V by T at position 101, M by C at position 1, L by C at position 6, Q by C at position 10, S by C at position 13, Q by C at position 16, L by C at position 17, V by C at position 101, L by C at position 98, H by C at position 97, Q by C at position 94, V by C at position 91, N by C at position 90.
Since modifications will be apparent to those of skill in this art, it is intended that this invention be limited only by the scope of the appended claims.

Claims (375)

WHAT IS CLAIMED IS:
1. A modified cytokine that exhibits increased resistance to proteolysis compared to the unmodified cytokine or a modified cytokine selected from the group consisting of modified cytokines comprising a sequence of amino acids set forth in any of SEQ ID Nos. 2-181, 233-1303 or a structural homolog thereof.
2. The modified cytokine of claim 1, selected from the group consisting of a member of the interferons/interleukin-10 protein family, a member of the long-chain cytokine family and a member of the short-chain cytokine family, wherein the modified cytokine is a modified interferon a of any of SEQ ID Nos. 87, 89, 90, 93, 96, 101, 103, 107, 124, 979, 980, 983, 984, 985, 986 and 987 or a cytokine modified on the basis of 3-dimensional structural homology with any of SEQ ID Nos.
87, 89, 90, 93, 96, 101, 103, 107, 124, 979, 980, 983, 984, 985, 986 and 987.
3. The modified cytokine of claim 1 or claim 2 selected from the group consisting of interleukin-10 (IL-10), interferon beta (IFN.beta.), interferon alpha-2a (IFN.alpha.-2a), interferon alpha-2b (IFN.alpha.-2b), and interferon gamma (IFN-.gamma.), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncostatin M, interleukin-6 (IL-6) and interleukin-12 (IL-12), erythropoietin (EPO), granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-13 (IL-13), Flt3 ligand and stem cell factor (SCF).
4. The modified cytokine of claim 1, that is an interferon.
5. The modified cytokine of claim 1, that is an interferon .alpha.-2b (IFN.alpha.-2b), interferon .alpha.-2a (IFN.alpha.-2a), interferon .alpha.-2c (IFN.alpha.-2c), or an interferon having the sequence set forth in SEQ ID No. 232.
6. A modified cytokine of claim 4, that is IFN.alpha.-2b or IFN.alpha.-2a or IFN.alpha.-2C selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID No. 1 or 182, corresponding to the replacement of: L by V at position 3; L by I at position 3; P by S at position 4; P by A at position 4; R by H at position 12; R by Q at position 12; R by H at position 13; R by Q at position 13;
M by V at position 16; M by I at position 16; R by H at position 22; R by Q at position 22; R or K by H at position 23; R or K by Q at position 23; F
by I at position 27; F by V at position 27; L by V at position 30; L by I at position 30; K by Q at position 31; K by T at position 31; R by H at position 33; R by Q at position 33; E by Q at position 41; E by H at position 41; K by Q at position 49; K by T at position 49; E by Q at position 58; E by H at position 58; K by Q at position 70; K by T at position 70; E by Q at position 78; E by H at position 78; K by Q at position 83; K by T at position 83; Y by H at position 89; Y by I at position 89; E by Q at position 96; E by H at position 96; E by Q at position 107; E by H at position 107; P by S at position 109; P by A at position 109; L by V at position 110; L by I at position 110; M by V at position 111; M by I at position 111; E by Q at position 113; E by H at position 113; L by V at position 117; L by I at position 117; R by H at position 120; R by Q at position 120; K by Q at position 121; K by T at position 121; R by H at position 125; R by Q at position 125; L by V at position 128; L by 1 at position 128; K by Q at position 131; K by T at position 131; E by Q at position 132; E by H at position 132; K by Q at position 133; K by T at position 133; K by Q at position 134; K by T at position 134; Y by H at position 135; Y by I at position 135; P by S at position 137; P by A at position 137; M by V at position 148; M by I at position 148; R by H at position 149; R by Q at position 149; E by Q at position 159; E by H at position 159; L by V at position 161; L by I at position 161; R by H at position 162; R by Q at position 162; K by Q at position 164; K by T at position 164; E by Q at position 165; and E by H
at position 165, wherein residue 1 corresponds to residue 1 of the mature IFN.alpha.-2b or IFN.alpha.-2a cytokine set forth in SEQ ID NOS:1 or 182.
7. The modified cytokine of claim 6, wherein:
the protein is human;
has more resistance to proteolysis than the unmodified protein; and the protein is selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ ID NOS:1 or 182, corresponding to: F by V at position 27; R by H at position 33; E
by Q at position 41; E by H at position 41; E by Q at position 58; E by H
at position 58; E by Q at position 78; E by H at position 78; Y by H at position 89; E by Q at position 107; E by H at position 107; P by A at position 109; L by V at position 110; M by V at position 111; E by Q at position 113; E by H at position 113; L by V at position 117; L by I at position 117; K by Q at position 121; K by T at position 121; R by H at position 125; R by Q at position 125; K by Q at position 133; K by T at position 133; E by Q at position 159 and E by H at position 159.
8. A modified IFN.alpha.-2b or IFN.alpha.-2a cytokine of claim 5 selected from the group consisting of proteins comprising one or more sets of dual-amino acid replacements in SEQ ID NOS:1 or 182, corresponding to:
D by N at position 2 and P by S at position 4;
D by N at position 2 and P by T at position 4;
L by N at position 3 and Q by S at position 5;
L by N at position 3 and Q by T at position 5;
P by N at position 4 and T by S at position 6;
P by N at position 4 and T by T at position 6;
Q by N at position 5 and H by S at position 7;

Q by N at position 5 and H by T at position 7;
T by N at position 6 and S by S at position 8;
T by N at position 6 and S by T at position 8;
H by N at position 7 and L by S at position 9;
H by N at position 7 and L by T at position 9;
S by N at position 8 and G by S at position 10;
S by N at position 8 and G by T at position 10;
L by N at position 9 and S by S at position 11;
L by N at position 9 and S by T at position 11;
M by N at position 21 and K by S at position 23;
M by N at position 21 and K by T at position 23;
R by N at position 22 and I by S at position 24;
R by N at position 22 and I by T at position 24;
R or K by N at position 23 and S by S at position 25;
R or K by N at position 23 and S by T at position 25;
I by N at position 24 and L by S at position 26;
I by N at position 24 and L by T at position 26;
S by N at position 25 and F by S at position 27;
S by N at position 25 and F by T at position 27;
L by N at position 26 and S by S at position 28;
L by N at position 26 and S by T at position 28;
S by N at position 28 and L by S at position 30;
S by N at position 28 and L by T at position 30;
L by N at position 30 and D by S at position 32;
L by N at position 30 and D by T at position 32;
K by N at position 31 and R by S at position 33;
K by N at position 31 and R by T at position 33;
D by N at position 32 and H by S at position 34;
D by N at position 32 and H by T at position 34;

R by N at position 33 and D by S at position 35;
R by N at position 33 and D by T at position 35;
H by N at position 34 and F by S at position 36;
H by N at position 34 and F by T at position 36;
D by N at position 35 and G by S at position 37;
D by N at position 35 and G by T at position 37;
F by N at position 36 and F by S at position 38;
F by N at position 36 and F by T at position 38;
G by N at position 37 and P by S at position 39;
G by N at position 37 and P by T at position 39;
F by N at position 38 and Q by S at position 40;
F by N at position 38 and Q by T at position 40;
P by N at position 39 and E by S at position 41;
P by N at position 39 and E by T at position 41;
Q by N at position 40 and E by S at position 42;
Q by N at position 40 and E by T at position 42;
E by N at position 41 and F by S at position 43;
E by N at position 41 and F by T at position 43;
E by N at position 42 and G by S at position 44;
E by N at position 42 and G by T at position 44;
F by N at position 43 and N by S at position 45;
F by N at position 43 and N by T at position 45;
G by N at position 44 and Q by S at position 46;
G by N at position 44 and Q by T at position 46;
N by N at position 45 and F by S at position 47;
N by N at position 45 and F by T at position 47;
Q by N at position 46 and Q by S at position 48;
Q by N at position 46 and Q by T at position 48;
F by N at position 47 and K by S at position 49;

F by N at position 47 and K by T at position 49;
Q by N at position 48 and A by S at position 50;
Q by N at position 48 and A by T at position 50;
K by N at position 49 and E by S at position 51;
K by N at position 49 and E by T at position 51;
A by N at position 50 and T by S at position 52;
A by N at position 50 and T by T at position 52;
S by N at position 68 and K by S at position 70;
S by N at position 68 and K by T at position 70;
K by N at position 70 and S by S at position 72;
K by N at position 70 and S by T at position 72;
A by N at position 75 and D by S at position 77;
A by N at position 75 and D by T at position 77;
D by N at position 77 and T by S at position 79;
D by N at position 77 and T by T at position 79;
I by N at position 100 and G by S at position 102;
I by N at position 100 and G by T at position 102;
Q by N at position 101 and V by S at position 103;
Q by N at position 101 and V by T at position 103;
G by N at position 102 and G by S at position 104;
G by N at position 102 and G by T at position 104;
V by N at position 103 and V by S at position 105;
V by N at position 103 and V by T at position 105;
G by N at position 104 and T by S at position 106;
G by N at position 104 and T by T at position 106;
V by N at position 105 and E by S at position 107;
V by N at position 105 and E by T at position 107;
T by N at position 106 and T by S at position 108;
T by N at position 106 and T by T at position 108;

E by N at position 107 and P by S at position 109;

E by N at position 107 and P by T at position 109;

T by N at position 108 and I by S at position 110;

T by N at position 108 and I by T at position 110;

K by N at position 134 and S by S at position 136;

K by N at position 134 and S by T at position 136;

S by N at position 154 and N by S at position 156;

S by N at position 154 and N by T at position 156;

T by N at position 155 and L by S at position 157;

T by N at position 155 and L by T at position 157;

N by N at position 156 and Q by S at position 158;

N by N at position 156 and Q by T at position 158;

L by N at position 157 and E by S at position 159;

L by N at position 157 and E by T at position 159;

Q by N at position 158 and S by S at position 160;

Q by N at position 158 and S by T at position 160;

E by N at position 159 and L by S at position 161;

E by N at position 159 and L by T at position 161;

S by N at position 160 and R by S at position 162;

S by N at position 160 and R by T at position 162;

L by N at position 161 and S by S at position 163;

L by N at position 161 and S by T at position 163;

R by N at position 162 and K by S at position 164;

R by N at position 162 and K by T at position 164;

S by N at position 163 and E by S at position 165; and S by N at position 163 and E by T at position 165, wherein residue 1 corresponds to residue 1 of the mature IFN.alpha.-2b or IFN.alpha.-2a cytokine set forth in SEQ ID NOS:182
9. A modified IFN.alpha.-2b or IFN.alpha.-2a mutant cytokine of claim 5 selected from the group consisting of proteins comprising one or more sets of dual amino acid replacements in SEQ ID NOS:1 or 182, corresponding to:
Q by N at position 5 and H by S at position 7;
P by N at position 39 and E by S at position 41;
P by N at position 39 and E by T at position 41;
Q by N at position 40 and E by S at position 42;
Q by N at position 40 and E by T at position 42;
E by N at position 41 and F by S at position 43;
E by N at position 41 and F by T at position 43;
F by N at position 43 and N by S at position 45;
G by N at position 44 and Q by T at position 46;
N by N at position 45 and F by S at position 47;
N by N at position 45 and F by T at position 47;
Q by N at position 46 and Q by S at position 48;
F by N at position 47 and K by S at position 49;
F by N at position 47 and K by T at position 49;
I by N at position 100 and G by S at position 102;
I by N at position 100 and G by T at position 102;
V by N at position 105 and E by S at position 107;
V by N at position 105 and E by T at position 107;
T by N at position 106 and T by S at position 108;
T by N at position 106 and T by T at position 108;
E by N at position 107 and P by S at position 109;
E by N at position 107 and P by T at position 109;
L by N at position 157 and E by S at position 159;
L by N at position 157 and E by T at position 159;
E by N at position 159 and L by S at position 161; and E by N at position 159 and L by T at position 161.
10. A modified cytokine of claim 5, further comprising one or more pseudo-wild type mutations.
11. The modified cytokine of claim 10 that is IFN.alpha.-2b or IFN.alpha.-2a.
12. A modified IFN.alpha.-2b or IFN.alpha.-2a cytokine of claim 11, comprising one or more pseudo-wild type mutations at amino acid positions of IFN.alpha.-2b or IFN.alpha.-2a corresponding to SEQ ID NOS:1 or 182, amino acid residues: 9, 10, 17, 20, 24, 25, 35, 37, 41, 52, 54, 56, 57, 58, 60, 63, 64, 65, 76, 89, and 90, wherein the mutations are selected from the group consisting of one or more of insertions, deletions and replacements of the native amino acid residue(s), wherein residue 1 corresponds to residue 1 of the mature IFN.alpha.-2b or IFN.alpha.-2a protein set forth in SEQ ID NOS:1 or 182.
13. A modified IFN.alpha.-2b or IFN.alpha.-2a cytokine of claim 11, comprising one wherein the pseudo-wild type replacements are one or more mutations in SEQ ID No. 1 or 182 corresponding to:
P by A at position 4; Q by A at position 5, T by A at position 6; L by A at position 9, LG by A at position 10; L by A at position 17, Q by A at position 20; I by A at position 24, S by A at position 25; D by A at position 35, G by A at position 37; G by A at position 39;
E by A at position 41; E by A at position 42 E by A at position 51; T by A at position 52, P by A at position 54; V by A at position 55 L by A at position 56; H by A at position 57, E by A at position 58; I by A at position 60, I by A at position 63; F by A at position 64, N by A at position 65; W by A at position 76, D by A at position 77; E by A at position 78 L by A at position 81; Y by A at position 85 Y by A at position 89; Q by A at position 90 G by A at position 104; L by A at position 1 10 S by A at position 115 and E by A at position 146.
14. A modified cytokine of claim 5, comprising one or more pseudo-wild type mutations at amino acid positions of IFN.alpha.-2b, IFN.alpha.-2c or a protein having the sequence set forth in SEQ ID No. 232 corresponding amino acid residues: 4, 5, 6, 9, 10, 17, 20, 24, 25, 35, 37, 39, 41, 42, 51, 52, 54, 56, 57, 58, 60, 63, 64, 65, 76, 77, 78, 81, 85, 89, 90, 104, 110, 115 and 146 to SEQ ID No. 1, 182 or 232, wherein the mutations are selected from the group consisting of one or more of insertions, deletions and replacements of the native amino acid residue(s), wherein residue 1 corresponds to residue 1 of the mature interferon set forth in SEQ ID No.1, 182 or 232.
15. The modified cytokin of claim 14, wherein the pseudowild type replacements are one or more mutations selected from:
P by A at position 4; Q by A at position 5;
T by A at position 6; L by A at position 9;
LG by A at position 10; L by A at position 17;
Q by A at position 20; I by A at position 24;
S by A at position 25; D by A at position 35;
G by A at position 37; G by A at position 39;
E by A at position 41; E by A at position 42;
E by A at position 51; T by A at position 52;
P by A at position 54; V by A at position 55;
L by A at position 56; H by A at position 57;
E by A at position 58; I by A at position 60;

I by A at position 63; F by A at position 64;
N by A at position 65; W by A at position 76;
D by A at position 77; E by A at position 78;
L by A at position 81; Y by A at position 85;
Y by A at position 89, Q by A at position 90;
G by A at position 104; L by A at position 110;
S by A at position 115 and E by A at position 146, wherein the positions correspond to SEQ ID No. 1, 182, 185 or 232.
16. A modified cytokine of any of claims 5, 9, 12, 15 that has increased antiviral activity compared to the unmodified cytokine.
17. The modified cytokine of claim 16, wherein antiviral activity is assessed by measuring replication by reverse transcription quantification PCR (RT-qPCR).
18. A modified cytokine of any of claims 5-9, 12-15 and 17 that has more antiviral activity than antiproliferative activity compared to the unmodified cytokine.
19. The modified cytokine of claim 18, wherein antiproliferative activity is assessed by measuring cell proliferation in the presence of the cytokine.
20. A modified cytokine of any of claims 5-9, 12-15 and 17-19 that that binds to an IFN receptor, but exhibits decreased antiviral activity and decreased antiproliferative activity relative to its receptor binding activity when compared to the unmodified cytokine.
21. A modified cytokine of claim 1, comprising two or more mutations.
22. The modified cytokine of claim 21 that is a modified IFN.alpha.-2b cytokine.
23. A modified cytokine of claim 1, wherein the cytokine comprises the sequence of amino acids set forth in any of SEQ ID Nos 2 through 181, wherein the arginine at position 23 is replaced with a lysine.
24. A modified cytokine of any claim 1 selected from the group consisting of interleukin-10 (IL-10), interferon beta (IFN.beta.), interferon alpha (IFN.alpha.), interferon gamma (IFN-.gamma.), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncostatin M, interleukin-6 (IL-6) and interleukin-12 (IL-12), erythropoietin (EPO), granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-13 (IL-13), Flt3 ligand and stem cell factor (SCF).
25. A collection of the modified cytokines of any of claims 1-24.
26. A nucleic acid molecule encoding a cytokine of any of claim of claims 1-24.
27. A vector comprising a nucleic acid molecule of claim 26.
28. A eukaryotic cell, comprising the vector of claim 27.
29. A collection of nucleic acid molecules comprising a plurality of the molecules of claim 26.
30. A collection of nucleic acid molecules comprising a plurality of the vectors of claim 27.
31. A method for expression of a modified cytokine, comprising:
introducing a nucleic acid of claim 26 into a host; and culturing the cell, under conditions and in which the modified encoded cytokines are expressed.
32. The method of claim 31, wherein the nucleic acid is introduced into a host cell.
33. The method of claim 31 or claim 32, wherein the cytokine is a modified IFN.alpha.-2b, IFN.alpha.-2a cytokine IFN.alpha.a-2c or interferon of SEQ ID No.
232.
34. The method of claim 31 or 32, wherein the host is a eukaryotic host cell.
35. The method of claim 34, wherein the cytokine is glycosylated.
36. The method of claim 31, wherein expression is effected in vivo.
37. The method of claim 31, wherein expression is effected in vitro.
38. The method of claim 31, wherein expression is effected in a cell-free system.
39. A cytokine produced by the method of claims 31.
40. A pharmaceutical composition, comprising a cytokine of any of claims 1-24 1 in a pharmaceutically acceptable carrier.
41. A modified cytokine of any of claims 5-22 that exhibits greater resistance to proteolysis compared to the unmodified cytokine, comprising one or more amino acid replacements at one or more positions on the cytokine corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of the IFN.alpha.-2b or IFN.alpha.-2a or IFN.alpha.-2c or consensus IFN.alpha. of SEQ ID No. 232.
42. A modified cytokine of claim 41, wherein the resistance to proteolysis is measured by mixing it with a protease in vitro, incubation with blood or incubation with serum.
43. A modified cytokine of any of claims 1-24 that is a structural homolog of IFN.alpha.-2b, comprising one or more amino acid replacements in the cytokine structural homolog at positions corresponding to the 3-dimensional-structurally-similar modified positions within the 3-D structure of the modified INF.alpha.2b or INF.alpha.2a or IFN.alpha. 2c or an interferon of SEQ ID
No. 232.
44. A modified cytokine of claim 43, wherein the homolog has increased resistance to proteolysis compared to its unmodified cytokine counterpart, wherein the resistance to proteolysis is measured by mixture with a protease in vitro, incubation with blood or incubation with serum.
45. The cytokine of claim 44 that is an IFN.alpha. cytokine.
46. The cytokine of claim 45, selected from the group consisting of INF.alpha.2a, INF.alpha.c, INF.alpha.2c, INF.alpha.d, INF.alpha.5, INF.alpha.6, INF.alpha.4, INF.alpha.4b, INF.alpha.I, INF.alpha.J, INF.alpha.H, INF.alpha.F, INF.alpha.8, and INF.alpha.consensus cytokine.
47. A modified cytokine of claim 1 that is modified INF.alpha.2a cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO. 182 in the INF.alpha.2a corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of unmodified INF.alpha.2b, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN alpha-2a.
48. The modified INF.alpha.2a of claim 47, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 182, corresponding to amino acid positions: 41, 58, 78, 107, 117, 125, 133 and 159.
49. A modified INF.alpha.c cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO. 183 in the INF.alpha.c corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of INF.alpha.2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN
alpha-c.
50. The modified INF.alpha.-c of claim 49, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 183, corresponding to amino acid positions: 41, 59, 79, 108, 118, 126, 134 and 160.
51. A modified INF.alpha.-c, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 185 in the INF.alpha.-2c corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of INF.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified INF.alpha.-2c.
52. The modified INF.alpha.-2c cytokine of claim 51, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 185, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
53. An INF.alpha.-d cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 186 in the INF.alpha.-d corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of INF.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified INF.alpha.-d.
54. The INF.alpha.-d modified cytokine of claim 53, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 186, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 1 18, 122, 126, 134 and 160.
55. An IFN.alpha.-5 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 187 in the IFN.alpha.-5 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-5.
56. The IFN.alpha.-5 modified cytokine of claim 55, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 187, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
57. An IFN.alpha.-6 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 188 in the IFN.alpha.-6 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-6.
58. The IFN.alpha.-6 modified cytokine of claim 57, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 188, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
59. An IFN.alpha.-4 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 189 in the IFN.alpha.-4 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-4.
60. The IFN.alpha.-4 modified cytokine of claim 59, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 189, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
61. An IFN.alpha.-4b cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 190 in the IFN.alpha.-4b corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-4b.
62. The IFN.alpha.-4b modified cytokine of claim 61, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 190, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
63. An IFN.alpha.-I cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 191 in the IFN.alpha.-I corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-I.
64. The IFN.alpha.-I modified cytokine of claim 63, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 191, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
65. An IFN.alpha.-J cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 192 in the IFN.alpha.-J corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-J.
66. The IFN.alpha.-J modified cytokine of claim 65, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 192, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
67. An IFN.alpha.-H cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 193 in the IFN.alpha.-H corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-H.
68. The IFN.alpha.-H modified cytokine of claim 67, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 193, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
69. An IFN.alpha.-F cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 194 in the IFN.alpha.-F corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-F.
70. The IFN.alpha.-F modified cytokine of claim 69, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 194, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
71. An IFN.alpha.-8 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 195 in the IFN.alpha.-8 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-8.
72. The IFN.alpha.-8 modified cytokine of claim 71, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 195, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111, 112, 114, 118, 122, 126, 134 and 160.
73. An IFN.alpha.-consensus cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 232 in the IFN.alpha.-consensus cytokine corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.alpha.-consensus.
74. The IFN.alpha.-consensus modified cytokine of claim 1, that is human and is selected from the group consisting of cytokines comprising one or more single amino acid replacements in SEQ ID NO: 232, corresponding to amino acid positions: 27, 33, 41, 59, 79, 90, 108, 110, 111,112, 114, 118, 122, 126, 134 and 160.
75. A modified IFN.beta. cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 196 in the IFN.alpha.-.beta. cytokine corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.beta..
76. A modified IFN.beta. cytokine of claim 1, comprising mutations at one or more amino acid residues of IFN.beta. corresponding to SEQ ID NO:196 at positions corresponding to: 39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110, 111, 113, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
77. The modified IFN.beta. cytokine of claims 75 and 76, wherein the replacements are selected from the group consisting of amino acid sustitutions in SEQ ID NO:196 corresponding to: D by Q at position 39, D
by H at position 39, D by G at position 39, E by Q at position 42, E by H
at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by H at position 73, D by G at position 73, D by Q at position 73, E by Q at position 81, E by H at position 81, E by Q at position 107, E by H at position 107, K by Q at position 108, K by T at position 108, K by S at position 108, K by H at position 108, E by Q at position 109, E by H at position 109, D by Q at position 110, D by H at position 110, D by G at position 110, F by I at position 111, F by V at position 111, R by H at position 113, R by Q at position 113, L by V at position 116, L by I at position 116, L by T at position 116, L by Q at position 116, L by H at position 116, L by A at position 116, L by V at position 120, L by I at position 120, L by T at position 120, L by Q at position 120, L by H at position 120, L by A at position 120, K by Q at position 123, K by T at position 123, K by S at position 123, K by H at position 123, R by H at position 124,, R by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136,, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 163, Y by I at position 1631, R by H at position 165, R by Q at position 165, wherein the first amino acid listed is substituted by the second at the position indicated.
78. A modified IFN.beta.-1 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 197 in the IFN.beta.-1 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.beta.-1.
79. A modified IFN.beta.-1 cytokine, comprising mutations at one or more amino acid residues of IFN.beta.-1 corresponding to SEQ ID NO:197: 39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110, 111, 113, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
80. A modified IFN.beta.-2a cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 198 in the IFN.beta.-2a corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.beta.-2a.
81. A modified IFN.beta.-2a cytokine, comprising mutations at one or more amino acid residues of IFN.beta.-2a corresponding to SEQ ID NO:198:
39, 42, 45, 47, 52, 67, 71, 73, 81, 107, 108, 109, 110, 111, 113, 116, 120, 123, 124, 128, 130, 134, 136, 137, 163 and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
82. A modified IFN-gamma cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO:
199 in the IFN-gamma corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN-gamma.
83. A modified IFN-gamma cytokine, comprising mutations at one or more amino acid residues of IFN-gamma corresponding to SEQ ID
NO:199: 33, 37, 40, 41, 42, 58, 61, 64, 65 and 66, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
84. The modified IFN-gamma cytokine of claims 82 and 83, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO:199 corresponding to:

K37Q E41H K61Q D66Q, wherein the first amino acid listed is substituted by the second at the position indicated.
85. A modified IL-10 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 200 in the IL-10 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-10.
86. A modified IL-10 cytokine, comprising mutations at one or more amino acid residues of IL-10 corresponding to SEQ ID NO:200: 49, 50, 52, 53, 54, 55, 56, 57, 59, 60, 67, 68, 71, 72, 74, 75, 78, 81, 84, 85, 86, and 88, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
87. The modified IL-10 cytokine of claims 85 and 86, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO:200 corresponding to:

E54Q Y59I Y72H E81Q K88N, wherein the first amino acid listed is substituted by the second at the position indicated.
88. A modified erythropoietin cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO:
201 in the erythropoietin corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified erythropoietin.
89. A modified erythropoietin of claim 88, comprising mutations at one or more amino acid residues of erythropoietin corresponding to SEQ ID NO:201 at positions: 43, 45, 48, 49, 52, 53, 55, 72, 75, 76, 123, 129, 130, 131, 162, and 165, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
90. The modified erythropoietin cytokine of claims 88 and 89, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 201 corresponding to:

wherein the first amino acid listed is substituted by the second at the position indicated.
91. A modified GM-CSF cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 202 in the GM-CSF corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified GM-CSF.
92. A modified GM-CSF cytokine, comprising mutations at one or more amino acid residues of GM-CSF corresponding to SEQ ID NO: 202:
38, 41, 45, 46, 48, 49, 51, 60, 63, 67, 92, 93, 1 19, 120, 123, and 124, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
93. The modified GM-CSF cytokine of claims 91 and 92, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 202 corresponding to:

E45N E60Q E93N P124A, wherein the first amino acid listed is substituted by the second at the position indicated.
94. A modified FIt3 ligand cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO:
203 in the FIt3 ligand corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified FIt3 ligand.
95. A modified Flt3 ligand cytokine, comprising mutations at one or more amino acid residues of Flt3 ligand corresponding to SEQ ID NO:
203: 3, 40, 42, 43, 55, 58, 59, 61, 89, 90, 91, 95, and 96, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
96. The modified FIt3 ligand cytokine of claims 94 and 95, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 203 corresponding to:

L43I P89S F96V, wherein the first amino acid listed is substituted by the second at the position indicated.
97. A modified IL-2 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 204 in the IL-2 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-2.
98. A modified IL-2 cytokine, comprising mutations at one or more amino acid residues of IL-2 corresponding to SEQ ID NO: 204: 43, 45, 48, 49, 52, 53, 60, 61, 65, 67, 68, 72, 100, 103, 104, 106, 107, 109, 110, and 132, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
99. The modified IL-2 cytokine of claims 97 and 98, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 204 corresponding to:

L53V E67H M1041 Y107H, wherein the first amino acid listed is substituted by the second at the position indicated.
100. A modified IL-3 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 205 in the IL-3 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-3.
101. A modified IL-3 cytokine, comprising mutations at one or more amino acid residues of IL-3 corresponding to SEQ ID NO: 205: 37, 43, 46, 59, 63, 66, 96, 100, 101, and 103, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
102. The modified IL-3 cytokine of claims 100 and 101, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO:205 corresponding to:

D46N P96S D103N, wherein the first amino acid listed is substituted by the second at the position indicated.
103. A modified SCF cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 206 in the SCF corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified SCF.
104. A modified SCF cytokine, comprising mutations at one or more amino acid residues of SCF corresponding to SEQ ID NO: 206: 27, 31, 34, 37, 54, 58, 61, 62, 63, 96, 98, 99, 100, 102, 103, 106, 107, 108, 109, 134, and 137, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
105. The modified SCF cytokine of claims 103 and 104, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 206 corresponding to:

wherein the first amino acid listed is substituted by the second at the position indicated.
106. A modified IL-4 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 207 in the IL-4 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-4.
107. A modified IL-4 cytokine, comprising mutations at one or more amino acid residues of IL-4 corresponding to SEQ ID NO: 207: 26, 37, 53, 60, 61, 64, 66, 100, 102, 103, and 126, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
108. The modified IL-4 cytokine of claims 106 and 107, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 207 corresponding to:

wherein the first amino acid listed is substituted by the second at the position indicated.
109. A modified IL-5 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 208 in the IL-corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-5.
110. A modified IL-5 cytokine, comprising mutations at one or more amino acid residues of IL-5 corresponding to SEQ ID NO: 208: 32, 34, 39, 46, 47, 56, 84, 85, 88, 89, 90, 102, 110, and 111, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
111. The modified IL-5 cytokine of claims 109 and 1 10, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 208 corresponding to:

K390 E56H E89H W111H, wherein the first amino acid listed is substituted by the second at the position indicated.
112. A modified IL-13 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 209 in the IL-13 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of erythropoietin modified cytokines of claims 88-90, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-13.
113. A modified IL-13 cytokine, comprising mutations at one or more amino acid residues of IL-13 corresponding to SEQ ID NO: 209: 32, 34, 38, 48, 79, 82, 85, 86, 88, 107, 108, 110, and 111, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
114. The modified IL-13 cytokine of claims 112 and 113, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 209 corresponding to:

W34H L82V R107H F111V, wherein the first amino acid listed is substituted by the second at the position indicated.
115. A modified G-CSF cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 210 in the G-CSF corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.alpha.-2b modified cytokines of claims 5-22, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified G-CSF.
116. A modified G-CSF cytokine, comprising mutations at one or more amino acid residues of G-CSF corresponding to SEQ ID NO: 210:
61, 63, 68, 72, 86, 96, 100, 101, 131, 133, 135, 147, 169, 172, and 177, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
117. The modified G-CSF cytokine of claims 115 and 116, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 210 corresponding to:

L72I E101Q P135A P177A, wherein the first amino acid listed is substituted by the second at the position indicated.
118. A modified leptin cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 211 in the leptin corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-117, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified leptin.
119. A modified leptin cytokine, comprising mutations at one or more amino acid residues of leptin corresponding to SEQ ID NO: 211: 43, 49, 99, 100, 104, 105, 107, 108, 141 and 142, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
120. The modified leptin cytokine of claims 118 and 119, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 211 corresponding to:

P99S L104I L107I L142I, wherein the first amino acid listed is substituted by the second at the position indicated.
121. A modified CNTF cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 212 in the CNTF corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-1 17, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified CNTF.
122. A modified CNTF cytokine, comprising mutations at one or more amino acid residues of CNTF corresponding to SEQ ID NO: 212: 62, 64, 66, 67, 86, 89, 92, 100, 102, 104, 131, 132, 133, 135, 136, 138, 140, 143, 148, and 151, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
123. The modified CNTF cytokine of claims 121 and 122, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 212 corresponding to:

wherein the first amino acid listed is substituted by the second at the position indicated.
124. A modified LIF cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 213 in the LIF corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-117, wherein the ,replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified LIF.
125. A modified LIF cytokine, comprising mutations at one or more amino acid residues of LIF corresponding to SEQ ID NO: 213: 69, 70, 85, 99, 102, 104, 106, 109, 137, 143, 146, 148, 149, 153, 154, and 156, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
126. The modified LIF cytokine of claims 124 and 125, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 213 corresponding to:

R85H P106A P148S F156V, wherein the first amino acid listed is substituted by the second at the position indicated.
127. A modified oncostatin M cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO:
214 in the oncostatin M corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-117, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified oncostatin M.
128. A modified oncostatin M cytokine, comprising mutations at one or more amino acid residues of oncostatin M corresponding to SEQ ID

NO: 214: 59, 60, 63, 65, 84, 87, 89, 91, 94, 97, 99, 100, 103, and 106, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
129. The modified oncostatin M cytokine of claims 127 and 128, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 214 corresponding to:

wherein the first amino acid listed is substituted by the second at the position indicated.
130. A modified IL-12 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 215 in the IL-12 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-117, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-12.
131. A modified IL-12 cytokine, comprising mutations at one or more amino acid residues of IL-12 corresponding to SEQ ID NO: 215: 56, 61, 66, 67, 68, 70, 72, 75, 78, 79, 82, 89, 92, 93, 107, 110, 111, 115, 117, 124, 125, 127, 128, 129, and 189, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
132. The modified IL-12 cytokine of claims 130 and 131, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 215 corresponding to:

K70N L89I E115H R189Q, wherein the first amino acid listed is substituted by the second at the position indicated.
133. A modified hGH cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 216 in the hGH corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-117, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified hGH.
134. A modified hGH cytokine, comprising mutations at one or more amino acid residues of hGH corresponding to SEQ ID NO: 216: 56, 59, 64, 65, 66, 88, 92, 94, 101, 129, 130, 133, 134, 140, 143, 145, 146, 147, 183, and 186, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
135, The modified hGH cytokine of claims 133 and 134, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 216 corresponding to:

wherein the first amino acid listed is substituted by the second at the position indicated.
136. A modified IL-6 cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO: 217 in the IL-6 corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of G-CSF modified cytokines of claims 115-117, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IL-6.
137. A modified IL-6 cytokine, comprising mutations at one or more amino acid residues of IL-6 corresponding to SEQ. ID NO: 217: 64, 65, 66, 68, 69, 75, 77, 92, 98, 103, 105, 108, 133, 138, 139, 140, 149, 156, 178, and 181, wherein the mutations comprise insertions, deletions or replacements of the native amino acid residue(s).
138. The modified IL-6 cytokine of claims 136 and 137, wherein the replacements are selected from the group consisting of amino acid stitutions in SEQ ID NO: 217 corresponding to:

K69N R103H P138A R181Q, wherein the first amino acid listed is substituted by the second and the position indicated.
139. The modified IFN.alpha.-2b cytokine of claims 5-22 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication or to stimulate cell proliferation in appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
140. The modified IFN.alpha.-2b cytokine of claims 5-22 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
141. The modified IFN.alpha.-2b cytokine of claims 5-22 that has increased biological activity compared to the unmodified cytokine, wherein activity is assessed by measuring the capacity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
142. The modified IFN.alpha.-2a cytokine of claims 47 and 48 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication or to stimulate cell proliferation in appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
143. The modified IFN.alpha.-2a cytokine of claims 47 and 48 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
144. The modified IFN.alpha.-2a cytokine of claims 47 and 48 that has increased biological activity compared to the unmodified cytokine, wherein activity is assessed by measuring the capacity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
145. The modified IFN.alpha.-c cytokine of claims 49 and 50 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
146. The modified IFN.alpha.-c cytokine of claims 49 and 50 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
147. The modified IFN.alpha.-c cytokine of claims 49 and 50 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
148. The modified IFN.alpha.-2c cytokine of claims 51 and 52 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
149. The modified IFN.alpha.-2c cytokine of claims 51 and 52 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
150. The modified IFN.alpha.-2c cytokine of claims 51 and 52 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
151. The modified IFN.alpha.-1d cytokine of claims 53 and 54 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residua! biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
152. The modified IFN.alpha.-1d cytokine of claims 53 and 54 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
153. The modified IFN.alpha.-1d cytokine of claims 53 and 54 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
154. The modified IFN.alpha.-5 cytokine of claims 55 and 56 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
155. The modified IFN.alpha.-5 cytokine of claims 55 and 56 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
156. The modified IFN.alpha.-5 cytokine of claims 55 and 56 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
157. The modified IFN.alpha.-6 cytokine of claims 57 and 58 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
158. The modified IFN.alpha.-6 cytokine of claims 57 and 58 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
159. The modified IFN.alpha.-6 cytokine of claims 57 and 58 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
160. The modified IFN.alpha.-4 cytokine of claims 59 and 60 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
161. The modified IFN.alpha.-4 cytokine of claims 59 and 60 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
162. The modified IFN.alpha.-4 cytokine of claims 59 and 60 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
163. The modified IFN.alpha.-4b cytokine of claims 61 and 62 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
164. The modified IFN.alpha.-4b cytokine of claims 61 and 62 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
165. The modified IFN.alpha.-4b cytokine of claims 61 and 62 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
166. The modified IFN.alpha.-I cytokine of claims 63 and 64 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
167. The modified IFN.alpha.-I cytokine of claims 63 and 64 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
168. The modified IFN.alpha.-I cytokine of claims 63 and 64 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
169. The modified IFN.alpha.-J cytokine of claims 65 and 66 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
170. The modified IFN.alpha.-J cytokine of claims 65 and 66 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
171. The modified IFN.alpha.-J cytokine of claims 65 and 66 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
172. The modified IFN.alpha.-H cytokine of claims 67 and 68 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of protease's, individual proteases, blood lysate or serum.
173. The modified IFN.alpha.-H cytokine of claims 67 and 68 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
174. The modified IFN.alpha.-H cytokine of claims 67 and 68 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
176. The modified IFN.alpha.-F cytokine of claims 69 and 70 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
177. The modified IFN.alpha.-F cytokine of claims 69 and 70 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
178. The modified IFN.alpha.-8 cytokine of claims 71 and 72 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
179. The modified IFN.alpha.-8 cytokine of claims 71 and 72 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
180. The modified IFN.alpha.-8 cytokine of claims 71 and 72 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
181. The modified IFN.alpha. consensus cytokine of claims 73 and 74 that has increased stability compared to any of the aligned cytokines, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
182. The modified IFN.alpha. consensus cytokine of claims 73 and 74 that has decreased stability compared to any of the aligned cytokines, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
183. The modified IFN.alpha. consensus cytokine of claims 73 and 74 that has increased biological activity compared to any of the aligned cytokines, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
184. The modified IFN.beta. cytokine of claims 75-77 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
185. The modified IFN.beta. cytokine of claims 75-77 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
186. The modified IFN.beta. cytokine of claims 75-77 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
187. The modified IFN.beta.-1 cytokine of claims 78 and 79 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
188. The modified IFN.beta.-1 cytokine of claims 78 and 79 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
189. The modified IFN.beta.-1 cytokine of claims 78 and 79 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
190. The modified IFN.beta.-2a cytokine of claims 80 and 81 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
191. The modified IFN.beta.-2a cytokine of claims 80 and 81 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
192. The modified IFN.beta.-2a cytokine of claims 80 and 81 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
193. The modified IFN-gamma cytokine of claims 82-84 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
194. The modified IFN-gamma cytokine of claims 82-84 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
195. The modified IFN-gamma cytokine of claims 82-84 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
196. The modified IL-10 cytokine of claims 85-87 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
197. The modified IL-10 cytokine of claims 85-87 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
198. The modified IL-10 cytokine of claims 85-87 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
199. The modified erythropoietin cytokine of claims 88-90 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
200. The modified erythropoietin cytokine of claims 88-90 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
201. The modified erythropoietin cytokine of claims 88-90 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
202. The modified GM-CSF cytokine of claims 91-93 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
203. The modified GM-CSF cytokine of claims 91-93 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
204. The modified GM-CSF cytokine of claims 91-93 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
205. The modified Flt3 ligand cytokine of claims 94-96 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
206. The modified Flt3 ligand cytokine of claims 94-96 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
207. The modified Flt3 ligand cytokine of claims 94-96 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
208. The modified IL-2 cytokine of claims 97-99 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
209. The modified IL-2 cytokine of claims 97-99 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
210. The modified IL-2 cytokine of claims 97-99 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
211. The modified IL-3 cytokine of claims 100-102 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
212. The modified IL-3 cytokine of claims 100-102 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
213. The modified IL-3 cytokine of claims 100-102 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
214. The modified SCF cytokine of claims 103-105 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
215. The modified SCF cytokine of claims 103-105 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
216. The modified SCF cytokine of claims 103-105 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
217. The modified IL-4 cytokine of claims 106-108 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
218. The modified IL-4 cytokine of claims 106-108 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
219. The modified IL-4 cytokine of claims 106-108 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
220. The modified IL-5 cytokine of claims 109-111 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
221. The modified IL-5 cytokine of claims 109-111 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
222. The modified IL-5 cytokine of claims 109-111 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
223. The modified IL-13 cytokine of claims 112-114 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
224. The modified IL-13 cytokine of claims 1 12-114 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
225. The modified IL-13 cytokine of claims 112-114 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
226. The modified G-CSF cytokine of claims 115-117 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
227. The modified G-CSF cytokine of claims 115-117 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
228. The modified G-CSF cytokine of claims 115-117 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
229. The modified leptin cytokine of claims 118-120 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
230. The modified leptin cytokine of claims 118-120 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
231. The modified leptin cytokine of claims 118-120 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
232. The modified CNTF cytokine of claims 121-123 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
233. The modified CNTF cytokine of claims 121-123 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
234. The modified CNTF cytokine of claims 121-123 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
235. The modified LIF cytokine of claims 124-126 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
236. The modified LIF cytokine of claims 124-126 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
237. The modified LIF cytokine of claims 124-126 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
238. The modified oncostatin M cytokine of claims 127-129 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
239. The modified oncostatin M cytokine of claims 127-129 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
240. The modified oncostatin M cytokine of claims 127-129 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
241. The modified IL-12 cytokine of claims 130-132 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
242. The modified IL-12 cytokine of claims 130-132 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
243. The modified IL-12 cytokine of claims 130-132 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
244. The modified hGH of claims 133-135 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after with either mixtures of proteases, individual proteases, blood lysate or serum.
245. The modified hGH of claims 133-135 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
246. The modified hGH of claims 133-135 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
247. The modified IL-6 cytokine of claims 136-138 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
248. The modified IL-6 cytokine of claims 136-138 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
249. The modified IL-6 cytokine of claims 136-138 that has increased biological activity compared to the unmodified cytokine, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
250. A method for generating a protein or peptide molecule, having a predetermined property or activity, the method comprising:
(a) identifying, within a target protein or peptide or plurality thereof, one or more target amino acids, wherein:
each target amino acid is designated an in silico-HIT (is-HIT); and the is-HIT target amino acids are determined by identifying structurally homologous loci between the evolving target protein and a reference protein possessing the desired activity;
(b) identifying one or more replacement amino acids, specific for each is-HIT, wherein each single amino acid replacement within the target protein or peptide is designated as a candidate LEAD protein;
(c) producing a population of sets of nucleic acid molecules that encode each of the candidate LEAD proteins, wherein each candidate LEAD protein contains a single amino acid replacement, and wherein each polynucleotide in a set encodes a candidate LEAD protein that differs by one amino acid from the target protein or peptide;
(d) introducing each set of nucleic acid molecules into host cells and expressing the encoded candidate LEAD proteins, wherein the host cells are present in an addressable array;
(e) individually screening the sets of encoded candidate LEAD
proteins to identify one or more proteins that has an activity that differs from an activity an unmodified target protein, wherein each such protein is designated a LEAD mutant protein;
251. The method of claim 250, wherein the predetermined property or activity of the evolved modified protein is increased resistance to proteolysis.
252. The method of claim 250 or claim 251, wherein the target proteins comprise a family.
253. The method of any of claims 250-252 wherein target proteins are cytokines.
254. The method of claim 253, wherein the cytokines are selected from the group consisting of interleukin-10 (IL-10), interferon beta (IFN.beta.), interferon alpha (IFN.alpha.), interferon gamma (IFN-.gamma.), granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncostatin M, interleukin-6 (IL-6) and interleukin-12 (IL-12), erythropoietin (EPO), granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-13 (IL-13), Flt13 ligand and stem cell factor (SCF).
255. The method of any of claims 250-254, wherein each candidate lead is individually prepared and screened to identify leads.
256. The method of claim 250-255, wherein the nucleic acid molecules comprise plasmids; and the cells are eukaryotic cells that are transfected with the plasmids, or the nucleic acid molecules comprise plasmids and the cells are bacterial cells.
257. The method of claim 250-256, wherein the nucleic acid molecules in step (c) are produced by site-specific mutagenesis.
258. The method of claims 250-257, further comprising:
(e) generating a population of sets of nucleic acid molecules encoding a set of candidate super-LEAD proteins, wherein each candidate super-LEAD protein comprises a combination of two or more of the single amino acid mutations derived from two or more LEAD mutant proteins;
(f) introducing each set of nucleic acid molecules encoding candidate super-LEADs into cells and expressing the encoded candidate super-LEAD proteins; and (g) individually screening the sets of encoded candidate super-LEAD
proteins to identify one or more proteins that has activity that differs from the unmodified target protein and has properties that differ from the original LEADs, wherein each such protein is designated a super-LEAD.
259. The method of claim 258, wherein the nucleic acid molecules in step (f) are generated by a method selected from among additive directional mutagenesis (ADM), multi-overlapped primer extensions, oligonucleotide-mediated mutagenesis, nucleic acid shuffling, recombination, site-specific mutagenesis, and de novo synthesis.
260. The method of claim 252-259, wherein candidate leads are produced by replacing to a restricted subset of amino acids along the full length of a target protein.
261. The method of claim 250-260, wherein the replacement amino acids identified in step (b) correspond to a restricted subset of the 19 remaining non-native amino acids.
262. The method of claim 250-261 wherein the nucleic acids of step (c) are produced by systematically replacing each codon that is an is-HIT, with one or more codons encoding a restricted subset of the remaining amino acids, to produce nucleic acid molecules each differing by at least one codon and encoding candidate LEADs.
263. The method of claim 258, wherein the number of LEAD
amino acid positions generated on a single nucleic acid molecule is selected from the group consisting of: two, three, four, five, six, seven, eight, nine, ten or more LEAD amino acid positions up to all of the LEAD
amino acid positions.
264. The method of claim 250-263, wherein the LEADs or super-LEADs possess increased resistance to proteolysis compared to unmodified target protein.
265. The method of claim 250-264, wherein the change in activity is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to the activity of the unmodified target protein.
266. The method of claim 250-264, wherein the change in activity is not more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared to he activity of the unmodified target protein.
267. The method of claim 250-264, wherein the change in activity is at least about 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, or more greater than the activity of the unmodified target protein.
268. The method of claims 250-267, wherein the replacing amino acids are selected using Percent Accepted Mutations (PAM) matrices.
269. The method of claims 250-267, wherein the replacing amino acids are pseudo-wild type amino acids.
270. The method of any of claims 250-269, wherein identification of the structurally homologous loci between the evolving target protein and a reference protein possessing the desired activity, comprises:
(a) comparing the 3-dimensional structures of the two or more proteins to identify regions of high coincidence between their backbones, said regions designated as structurally homologous regions; and (b) identifying is-HIT structurally homologous loci on the evolving protein that correspond to structurally related is-HIT amino acid positions within a structurally homologous region of the reference protein.
271. The method of claim 270, wherein the comparison of the 3-dimensional structures of the evolving target protein and the reference protein is based upon their 3-dimensinal strucutures not upon alignment between their respective primary sequences.
272. The method of claim 270 or claim 271, wherein the evolving target protein and the reference protein belong to a family of sequence-related proteins.
273. The method of any of claims 270-272, wherein the evolving target protein and the reference protein belong respectively to families of non-related proteins or sequence-non-related proteins.
274. The method of claims 250-273, wherein the degree of coincidence between the 3-dimensional structures of the evolving target protein and the reference protein is in a region selected from the group consisting of:
(a) a small region on the two proteins;
(b) a large region on the two proteins; and (c) a region that covers the full length of one or both of the proteins.
275. The method of any of claims 270-274, wherein the degree of coincidence between the 3-dimensional structures of the evolving target protein and of the reference protein is determined by superposition and RMS deviation calculations using any combination of one or more of the peptide backbone atoms selected from the group consisting of: N, C, C(C=O), O and CA.
276. The method of any of claims 270-274, wherein the superposition and RMS deviation calculations are made using all of the peptide backbone atoms selected from the group consisting of: N, C, C(C=O), O and CA, when present.
277. The method of any of claims 270-276, wherein the superposition and RMS deviation calculations are carried out on a subset of regions or domains of a larger protein that adopts a structure similar to a smaller protein.
278. The method of claims 270-277, wherein the degree of coincidence between the 3-dimensional structures of the evolving target protein and the reference protein is obtained using any combination of one or more of either CATH (Class Architecture, Topology and Homologous Superfamily); CE (Combinatorial Extension of the optimal path); FSSP (Fold Classification based of Structure-Structure Alignment of Proteins); SCOP (Structural Classification of Proteins); VAST (Vector Alignment Search Tool), and TOP.
279. A modified cytokine of claim 1 selected from the group consisting of modified cytokines comprising a sequence of amino acids set forth in any of SEQ ID Nos. 2-181, 233-1303 or a structural homolog thereof.
280. The modfified cytokine of claim 279, selected from the group consisting of interleukin-10 (IL-10), interferon .alpha., interferon .beta., interferon .gamma., granulocyte colony stimulating factor (G-CSF), leukemia inhibitory factor (LIF), human growth hormone (hGH), ciliary neurotrophic factor (CNTF), leptin, oncostatin M, interleukin-6 (IL-6) and interleukin-12 (IL-12), erythropoietin (EPO), granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-4 (IL-4), interleukin-5 (IL-5), interleukin-13 (IL-13), Flt3 ligand and stem cell factor (SCF).
281. A method of generating a modified protein or cytokine having a pre-selected altered phenotype, comprising:
modifying a first protein or cytokine by a directed evolution method to produce an evolved protein or cytokine that has the altered phenotype to identify altered loci; and comparing the structures of one or more members of the protein or cytokine family to identify structurally homologous loci for alteration;
altering the identified loci in members of the protein or cytokine family to produce proteins or cytokines that have the altered phenotype.
282. The method of claim 281, wherein directed evolution is effected by a rational directed evolution method.
283. The method of claim 281, wherein directed evolution is effected by a 2-dimensional rational scanning.
284. The method of claims 281, wherein identification of the structurally homologous loci between the evolved protein or cytokine and members of the protein or cytokine family, further comprises:
(a) comparing the 3-dimensional structures of the evolved protein or cytokine with one or more members of the protein or cytokine family to identify regions of high coincidence between their backbones, said regions designated as structurally homologous regions; and (b) identifying is-HIT structurally homologous loci on the members of the protein or cytokine family that correspond to structurally related is-HIT amino acid positions within a structurally homologous region of the evolved protein or cytokine.
285. The method of claim 284, wherein the comparison of the 3-dimensional structures of the members of the protein or cytokine family and the evolved protein or cytokine is made irrespective of any alignment between their respective sequences.
286. The method of claim 284 or claim 285, wherein the degree of coincidence between the 3-dimensional structures of the members of the protein or cytokine family and the evolved protein or cytokine is in a region selected from the group consisting of:
(a) a small region on the two proteins;
(b) a large region on the two proteins; and (c) a region that covers the full length of one or both of the proteins.
287. The method of any of claims 284-286, wherein the degree of coincidence between the 3-dimensional structures of the members of the protein or cytokine family and of the evolved protein or cytokine is determined by superposition and RMS deviation calculations using any combination of one or more of the peptide backbone atoms selected from the group consisting of: N, C, C(C=O), O and CA.
288. The method of claim 287, wherein the superposition and RMS deviation calculations are made using all of the peptide backbone atoms present selected from group the consisting of: N, C, C(C = O), O
and CA.
289. The method of claim 287 or claim 288, wherein the superposition and RMS deviation calculations are carried out on a subset of regions or domains of a larger protein that adopts a structure similar to a smaller protein.
290. The method of any of claims 284-289, wherein the degree of coincidence between the 3-dimensional structures of the members of the protein or cytokine family and the evolved protein or cytokine is obtained using any combination of one or more of either CATH (Class Architecture, Topology and Homologous Superfamily); CE (Combinatorial Extension of the optimal path); FSSP (Fold Classification based of Structure-Structure Alignment of Proteins); SCOP (Structural Classification of Proteins); VAST
(Vector Alignment Search Tool), and TOP.
291. The method of claim 283, wherein the 2-dimensional rational scanning method comprises:
(a) identifying, within the first protein or cytokine, one or more target amino acids amenable to providing the altered phenotype upon amino acid replacement, wherein each target amino acid is designated an in silico-HIT (is-HIT);
(b) identifying one or more replacement amino acids, specific for each is-HIT, amenable to providing the altered phenotype upon amino acid replacement, wherein each single amino acid replacement within the protein or cytokine is designated as a candidate LEAD protein;

(c) producing a population of sets of nucleic acid molecules that encode each of the candidate LEAD proteins, wherein each candidate LEAD protein comprises a single amino acid replacement, and wherein each polynucleotide in a set encodes a candidate LEAD protein that differs by one amino acid from the unmodified protein or cytokine;
(d) introducing each set of nucleic acid molecules into host cells and expressing the encoded candidate LEAD proteins, wherein the host cells are present in an addressable array;
(e) individually screening the sets of encoded candidate LEAD
proteins to identify one or more candidate LEAD proteins that has activity that differs from the unmodified protein or cytokine, wherein each such protein is designated a LEAD mutant protein.
292. The method of claim 291, wherein the array comprises a solid support with wells; and each well contains one set of cells.
293. The method of claim 291 or claim 292, wherein the nucleic acid molecules comprise plasmids; and the cells are eukaryotic cells that are transfected with the plasmids.
294. The method of claim 291 or claim 292, wherein the nucleic acid molecules comprise plasmids and the cells are bacterial cells.
295. The method of any of claims 291-294, wherein the nucleic acid molecules in step (c) are produced by site-specific mutagenesis.
296. The method of any of claims 291-295, further comprising:
(f) generating a population of sets of nucleic acid molecules encoding a set of candidate super-LEAD proteins, wherein each candidate super-LEAD protein comprises a combination of two or more of the single amino acid mutations derived from two or more LEAD mutant proteins;
(g) introducing each set of nucleic acid molecules encoding candidate super-LEADs into cells and expressing the encoded candidate super-LEAD proteins; and (h) individually screening the sets of encoded candidate super-LEAD
proteins to identify one or more proteins that has activity that differs from the unmodified protein or cytokine and has properties that differ from the original LEADs, wherein each such protein is designated a super-LEAD.
297. The method of any of claims 296, wherein the nucleic acid molecules in step (f) are produced by a method selected from among Additive Directional Mutagenesis (ADM), multi-overlapped primer extensions, oligonucleotide-mediated mutagenesis, nucleic acid shuffling, recombination, site-specific mutagenesis, and de novo synthesis.
298. The method of any of claims 291-297, wherein the is-HITs identified in step (a) correspond to a restricted subset of amino acids along the full length target protein.
299. The method of any of claims 291-298, wherein the replacement amino acids identified in step (b) correspond to a restricted subset of the 19 remaining non-native amino acids.
300. The method of of any of claims 291-299, wherein the nucleic acids of step (c) are produced by systematically replacing each codon that is an is-HIT, with one or more codons encoding a restricted subset of the remaining amino acids, to produce nucleic acid molecules each differing by at least one codon and encoding candidate LEADs.
301. The method of claim 296, wherein the number of LEAD
amino acid positions generated on a single nucleic acid molecule is selected from the group consisting of: two, three, four, five, six, seven, eight, nine, ten or more LEAD amino acid positions up to all of the LEAD
amino acid positions.
302. The method of any of claims 291-301, wherein the LEADs or super-LEADs possess increased resistance to proteolysis compared to unmodified protein or cytokine.
303. The method of any of claims 291-302, wherein the change in activity is at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, of the activity of the unmodified target protein.
304. The method of any of claims 291-302, wherein the change in activity is not more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%, of the activity of the unmodified target protein.
305. The method of any of claims 291-304, wherein the change in activity is at least about 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, or more greater than the activity of the unmodified target protein.
306. A collection of the modified cytokines of any of claims 41-249.
307. A nucleic acid molecule encoding a cytokine of any of claims 41-249.
308. A vector comprising the nucleic acid molecule of claim 307.
309. A eukaryotic cell, comprising the vector of claim 308.
310. A collection of nucleic acid molecules comprising a plurality of the molecules of claim 307.
311. A collection of nucleic acid molecules comprising a plurality of the vectors of claim 308.
312. A method for expression of a modified cytokine, comprising:
introducing a nucleic acid of claim 307 into a host; and culturing the cell, under conditions and in which the modified encoded cytokines are expressed.
313. The method of claim 312, wherein the nucleic acid is introduced into a host cell.
314. The method of claim 312 or 313, wherein the host is a eukaryotic host cell.
315. The method of claim 314, wherein the cytokine is glycosylated.
316. The method of claim 312-315, wherein expression is effected in vivo.
317. The method of claim 312-315, wherein expression is effected in vitro.
318. The method of claim 312, wherein expression is effected in a cell-free system.
319. A cytokine produced by the method of any of claims 312-318.
320. A modified cytokine of claim 1 that is an IFN.alpha.-2b, IFN.alpha.-2a, IFN-2c cytokine selected from the group consisting of proteins comprising one or more single amino acid replacements corresponding to the replacement of: N by D at position 45; D by G at position 94; G by R at position 102; A by G at position 139; or any combination thereof.
321. A modified cytokine of claim 1 that is an IFN.alpha.-2b, IFN.alpha.-2a, IFN-2c cytokine selected from selected from the group consisting of proteins comprising one or more single amino acid replacements in any of SEQ ID Nos. 1, 182, 185 or 232 or any combination thereof corresponding to the replacement: L by V at position 3; L by I at position 3; P by S at position 4; P by by S at position 4; P by A at position 4; R by H at position 12; R by Q at position 12; R by H at position 13; R by Q at position 13; M by V at position 16; M by I at position 16; R by H at position 22; R by Q at position 22; R or K by H at position 23; R or K by Q at position 23; F by I at position 27; F by V at position 27; L by V at position 30; L by I at position 30; K by Q at position 31; K by T at position 31; R by H at position 33; R by Q at position 33; E by Q at position 41; E by H at position 41; K by Q at position 49; K by T at position 49; E by Q at position 58; E by H at position 58; K by Q at position 70; K by T at position 70; E by Q at position 78; E by H at position 78; K by Q at position 83; K by T at position 83; Y by H at position 89; Y by I at position 89; E by Q at position 96; E by H at position 96; E by Q at position 107; E by H at position 107; P by S at position 109; P by A at position 109; L by V at position 110; L by I at position 110; M by V at position 111; M by I at position 111; E by Q at position 113; E by H at position 113; L by V at position 117; L by I at position 117; R by H at position 120; R by Q at position 120; K by Q at position 121; K by T at position 121; R by H at position 125; R by Q at position 125; L by V at position 128; L by I at position 128; K by Q at position 131; K by T at position 131; E by Q at position 132; E by H at position 132; K by Q at position 133; K by T at position 133; K by Q at position 134; K by T at position 134; Y by H at position 135; Y by I at position 135; P by S at position 137; P by A at position 137; M by V at position 148; M by I at position 148; R by H at position 149; R by Q at position 149; E by Q at position 159; E by H at position 159; L by V at position 161; L by I at position 161; R by H at position 162; R by Q at position 162; K by Q at position 164; K by T at position 164; E by Q at position 165; and E by H at position 165 or any combination thereof, wherein residue 1 corresponds to residue 1 of the mature IFN.alpha.-2b or IFN.alpha.-2a cytokine set forth in SEQ ID NOS:1 or 182.
322. A modified cytokine of claim 1 that is an IFN.alpha.-2b, IFN.alpha.-2a, IFN-2c cytokine selected from selected from the group consisting of proteins comprising one or more single amino acid replacements in any of SEQ ID Nos. 1, 182, 185 or 232 or any combination thereof corres-ponding to the replacement L by V at position 3; L by I at position 3; P
by S at position 4; P by A at position 4; R by H at position 12; R by Q at position 12; R by H at position 13; R by Q at position 13; M by V at position 16; M by I at position 16; R by H at position 22; R by Q at position 22; R or K by H at position 23; R or K by Q at position 23; F by I
at position 27; F by V at position 27; L by V at position 30; L by I at position 30; K by Q at position 31; K by T at position 31; R by H at position 33; R by Q at position 33; E by Q at position 41; E by H at position 41; K by Q at position 49; K by T at position 49; E by Q at position 58; E by H at position 58; K by Q at position 70; K by T at position 70; E by Q at position 78; E by H at position 78; K by Q at position 83; K by T at position 83; Y by H at position 89; Y by I at position 89; E by Q at position 96; E by H at position 96; E by Q at position 107; E by H at position 107; P by S at position 109; P by A at position 109; L by V at position 110; L by I at position 110; M by V at position 111; M by I at position 111; E by Q at position 113; E by H at position 113; L by V at position 117; L by 1 at position 1 17; R by H at position 120; R by Q at position 120; K by Q at position 121; K by T at position 121; R by H at position 125; R by Q at position 125; L by V at position 128; L by I at position 128; K by Q at position 131; K by T at position 131; E by Q at position 132; E by H at position 132; K by Q at position 133; K by T at position 133; K by Q at position 134; K by T at position 134; Y by H at position 135; Y by I at position 135; P by S at position 137; P by A at position 137; M by V at position 148; M by I at position 148; R by H at position 149; R by Q at position 149; E by Q at position 159; E by H at position 159; L by V at position 161; L by I at position 161; R by H at position 162; R by Q at position 162; K by Q at position 164; K by T at position 164; E by Q at position 165; E by H at position 165; N by D at position 45; D by G at position 94; G by R at position 102; and A by G at position 139, wherein residue 1 corresponds to residue 1 of the mature IFN.alpha.-2b or IFN.alpha.-2a cytokine set forth in SEQ
ID No. 1 or 182.
323. The modified cytokine of claim 1, that is an interferon .beta.
(IFN.beta.).
324. A modified IFN .beta. cytokine selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ
ID NOS:196, corresponding to the replacement of M by V at position 1, M by I at position 1, M by T at position 1, M by Q at position 1 , M by A
at position 1 , L by V at position 5 , L by I at position 5 , L by T at position 5 , L by Q at position 5 , L by H at position 5, L by A at position , F by I at position 8, F by V at position 8, L by V at position 9, L by I
at position 9, L by T at position 9, L by Q at position 9, L by H at position 9, L by A at position 9, R by H at position 11, R by Q at position 11, F by I at position 15 , F by V at position 15 , K by Q at position 19, K by T at position 19, K by S at position 19, K by H at position 19, W by S at position 22, W by H at position 22, N by H at position 25, N by S at position 25, N by Q at position 25, R by H position 27, R by Q position 27, L by V at position 28, L by I at position 28, L by T at position 28, L
by Q at position 28, L by H at position 28, L by A at position 28, E by Q
at position 29, E by H at position 29, Y by H at position 30, Y by I at position 30, L by V at position 32, L by I at position 32, L by T at position 32, L by Q at position 32, L by H at position 32, L by A at position 32, K by Q at position 33, K by T at position 33, K by S at position 33, K by H at position 33, R by H at position 35, R by Q at position 35, M by V at position 36, M by I at position 36, M by T at position 36, M by Q at position 36, M by A at position 36, D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by, Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by Q at position 73, D by H at position 73, D by G at position 73, E by Q at position 81, E by H at position 81, E by Q at position 85, E by H at position 85, Y by H at position 92, Y by I at position 92, K by Q at position 99, K by T at position 99, K by S at position 99, K by H at position 99, E by Q at position 103, E by H at position 103, E by Q at position 104, E by H at position 104, K by Q at position 105, K by T at position 105, K by S at position 105, K by H at position 105, E by Q at position 107, E by H at position 107, K by Q at position 108, K by T at position 108, K by S at position 108, K by H at position 108, E by Q at position 109, E by H at position 109, D by Q at position 110, D by H at position 110, D by G at position 110, F by I at position 111, F by V at position 111, R by H at position 113, R by Q at position 113, L by V at position 116, L by I at position 116, L by T at position 116, L by Q at position 116, L by H at position 116, L by A at position 116, L by V at position 120, L by I at position 120, L by T at position 120, L by Q at position 120, L by H at position 120, L by A at position 120, K by Q at position 123, K by T at position 123, K by S at position 123, K by H at position 123, R by H at position 124, R by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 138, Y by I at position 138, R by H at position 152, R by Q at position 152, Y by H at position 155, Y by I at position 155, R by H at position 159, R by Q at position 159, Y by H at position 163, Y by I at position 163, R by H at position 165, R by Q at position 165, M by D at position 1, M by E at position 1, M by K at position 1, M by N at position 1, M by R at position 1, M by S at position 1, L by D at position 5, L by E at position 5, L by K
at position 5, L by N at position 5, L by R at position 5, L by S at position 5, L by D at position 6, L by E at position 6, L by K at position 6, L by N
at position 6, L by R at position 6, L by S at position 6, L by Q at position 6, L by T at position 6, F by E at position 8, F by K at position 8, F by R
at position 8, F by D at position 8, L by D at position 9, L by E at position 9, L by K at position 9, L by N at position 9, L by R at position 9, L by S
at position 9, Q by D at position 10 , Q by E at position 10 , Q by K at position 10 , Q by N at position 10 , Q by R at position 10 , Q by S at position 10 , Q by T at position 10 , S by D at position 12, S by E at position 12, S by K at position 12, S by R at position 12, S by D at position 13, S by E at position 13, S by K at position 13, S by R at position 13, S by N at position 13, S by Q at position 13, S by T at position 13, N by D at position 14, N by E at position 14, N by K at position 14, N by Q at position 14, N by R at position 14, N by S at position 14, N by T at position 14, F by D at position 15, F by E at position 15, F by K at position 15, F by R at position 15, Q by D at position 16, Q by E at position 16, Q by K at position 16, Q by N at position 16, Q by R at position 16, Q by S at position 16, Q by T at position 16, C by D at position 17, C by E at position 17, C by K at position 17, C by N at position 17, C by Q at position 17, C by R at position 17, C by S at position 17, C by T at position 17, L by N at position 20, L by Q at position 20, L by R at position 20, L by S at position 20, L by T at position 20, L by D at position 20, L by E at position 20, L by K at position 20, W by D at position 22, W by E at position 22, W by K at position 22, W by R at position 22, Q by D at position 23, Q by E at position 23, Q by K at position 23, Q by R at position 23, L by D at position 24, L by E at position 24, L by K at position 24, L by R at position 24, W by D at position 79, W by E at position 79, W by K at position 79, W by R at position 79, N by D at position 80, N by E at position 80, N by K at position 80, N by R at position 80, T by D at position 82, T by E at position 82, T by K at position 82, T by R at position 82, I by D at position 83, I by E at position 83, I by K at position 83, I by R at position 83, I by N at position 83, I by Q at position 83, I by S at position 83, I by T at position 83, N by D at position 86, N by E at position 86, N by K at position 86, N by R at position 86, N by Q at position 86, N by S at position 86, N by T at position 86, L by D at position 87, L by E at position 87, L by K at position 87, L by R at position 87, L by N at position 87, L by Q at position 87, L by S at position 87, L by T at position 87, A by D at position 89, A by E at position 89, A by K at position 89, A by R at position 89, N by D at position 90, N by E at position 90, N by K at position 90, N by Q at position 90, N by R at position 90, N by S at position 90, N by T at position 90, V by D at position 91, V by E at position 91, V by K at position 91, V by N at position 91, V by Q at position 91, V by R at position 91, V by S at position 91, V by T at position 91, Q by D at position 94, Q by E at position 94, Q by Q at position 94, Q by N at position 94, Q by R at position 94, Q by S at position 94, Q by T at position 94, I by D at position 95, I by E at position 95, I by K at position 95, I by N at position 95, I by Q at position 95, I by R at position 95, I by S at position 95, I by T at position 95, H by D at position 97, H by E at position 97, H by K at position 97, H by N at position 97, H by Q at position 97, H by R at position 97, H by S at position 97, H by T at position 97, L by D at position 98, L by E at position 98, L by K at position 98, L by N at position 98, L by Q at position 98, L by R at position 98, L by S at position 98, L by T at position 98, V by D at position 101, V by E at position 101, V by K at position 101, V by N at position 101, V by Q at position 101, V by R at position 101, V by S at position 101, V by T at position 101, M by C at position 1, L by C at position 6, Q by C at position 10, S by C at position 13, Q by C at position 16, L by C at position 17, V by C at position 101, L by C at position 98, H by C at position 97, Q by C at position 94, V by C at position 91, N by C at position 90, wherein residue 1 corresponds to residue 1 of the mature IFN.beta.
cytokine set forth in SEQ ID NOS:196.
325. A modified cytokine of any of claims 1-4, 323 and 324, further comprising one or more pseudo-wild type mutations.
326. The modified cytokine of claim 325 that is a modified IFN.beta..
327. A modified IFN.beta. cytokine of any of claims 323 or 324 that has increased antiviral activity compared to the unmodified cytokine.
328. The modified IFN.beta. cytokine of claim 327, wherein antiviral activity is assessed by measuring replication by reverse transcription quantification PCR (RT-qPCR) or CPE (cythopathic effect).
329. A modified IFN.alpha.-2b or IFN.alpha.-2a cytokine of any of claims 323, 324 or 327 that has more antiviral activity than antiproliferative activity compared to the unmodified cytokine.
330. The cytokine of claim 329, wherein antiproliferative activity is assessed by measuring cell proliferation in the presence of the cytokine.
331. A modified IFN.beta. cytokine of any of claims 323, 324, 327-330 that binds to an IFN receptor, but exhibits when compared to unmodified IFN.beta., decreased antiviral activity and decreased antiproliferative activity relative to its receptor binding activity.
332. A modified cytokine of any of claims 1-4 or 323-331 comprising two or more mutations.
333. The modified protein of claim 332 that is a modified IFN.beta.
cytokine.
334. A collection of the modified cytokines of any of claims 1-4, 323-332.
335. A nucleic acid molecule encoding a cytokine of any of claims 1-4, 323-332.
336. A vector comprising the nucleic acid molecule of claim 335.
337. A eukaryotic cell, comprising the vector of claim 336.
338. A collection of nucleic acid molecules comprising a plurality of the molecules of claim 337.
339. A collection of nucleic acid molecules comprising a plurality of the vectors of claim 338.
340. A method for expression of a modified cytokine, comprising:
introducing a nucleic acid of claim 335 into a host; and culturing the cell, under conditions and in which the modified encoded cytokines are expressed.
341. The method of claim 340, wherein the nucleic acid is introduced into a host cell.
342. The method of claim 340 or 341, wherein the cytokine is a modified IFN.beta. cytokine.
343. The method of claim 340 or 341, wherein the host is a eukaryotic host cell.
344. The method of claim 343, wherein the cytokine is glycosylated.
345. The method of claim 335, wherein expression is effected in vivo.
346. The method of claim 345, wherein expression is effected in vitro.
347. The method of claim 345, wherein expression is effected in a cell-free system.
348. A cytokine produced by the method of any of claims 335-345.
349. A pharmaceutical composition, comprising a cytokine of any of claims 1-4, 323-333 or 348 in a pharmaceutically acceptable carrier.
350. A modified cytokine that exhibits greater resistance to proteolysis compared to the unmodified cytokine, comprising one or more amino acid replacements at one or more target positions on the cytokine corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of the IFN.beta. modified cytokines of claims 323-333.
351. A modified cytokine of claim 350, wherein the resistance to proteolysis is measured by mixing it with a protease in vitro, incubation with blood or incubation with serum.
352. A cytokine structural homolog of an IFN.beta. modified cytokine of any of claims 323-333, comprising one or more amino acid replacements in the cytokine structural homolog at positions corresponding to the 3-dimensional-structurally-similar modified positions within the 3-D structure of the modified IFN.beta..
353. A cytokine homolog of claim 352, wherein the homolog has increased resistance to proteolysis compared to its unmodified cytokine counterpart, wherein the resistance to proteolysis is measured by mixture with a protease in vitro, incubation with blood, or incubation with serum.
354. The cytokine of claim 353 that is an IFN.beta. cytokine.
355. A modified IFN.beta. cytokine, comprising one or more amino acid replacements at one or more target positions in SEQ ID NO. 196 in the IFN.beta. corresponding to a structurally-related modified amino acid position within the 3-dimensional structure of IFN.beta. modified cytokines of claims 323-333, wherein the replacements lead to greater resistance to proteases, as assessed by incubation with a protease or a with a blood lysate or by incubation with serum, compared to the unmodified IFN.beta..
356. The modified IFN.beta. cytokine of claims 323-333 that has increased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication or to stimulate cell proliferation in appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
357. The modified IFN.beta. cytokine of claims 323-333 that has decreased stability compared to the unmodified cytokine, wherein stability is assessed by measuring residual biological activity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
358. The modified IFN.beta. cytokine of claims 323-333 that has increased biological activity compared to the unmodified cytokine, wherein activity is assessed by measuring the capacity to either inhibit viral replication in the appropriate cells or to stimulate cell proliferation of the appropriate cells, after incubation with either mixtures of proteases, individual proteases, blood lysate or serum.
359. A nucleic acid molecule encoding a cytokine of any of claims 350-358.
360. A vector comprising the nucleic acid molecule of claim 359.
361. A eukaryotic cell, comprising the vector of claim 360.
362. A collection of nucleic acid molecules comprising a plurality of the molecules of claim 359.
363. A collection of nucleic acid molecules comprising a plurality of the vectors of claim 360.
364. A method for expression of a modified cytokine, comprising:
introducing a nucleic acid of claim 359 into a host; and culturing the cell, under conditions and in which the modified encoded cytokines are expressed.
365. The method of claim 364, wherein the nucleic acid is introduced into a host cell.
366. The method of claim 364 or 365, wherein the host is a eukaryotic host cell.
367. The method of claim 366, wherein the cytokine is glycosylated.
368. The method of claim 364-367, wherein expression is effected in
369. The method of claim 364-367, wherein expression is effected in vitro.
370. The method of claim 364, wherein expression is effected in a cell-free system.
371. A cytokine produced by the method of any of claims 364-371.
372. A modified IFN.beta. cytokine selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ
ID NOS:196, or any combination thereof, corresponding to the replacement of:
M by V at position 1, M by I at position 1, M by T at position 1, M by Q
at position 1 , M by A at position 1 , L by V at position 5 , L by I at position 5 , L by T at position 5 , L by Q at position 5 , L by H at position , L by A at position 5 , F by I at position 8, F by V at position 8, L by V
at position 9, L by I at position 9, L by T at position 9, L by Q at position 9, L by H at position 9, L by A at position 9, R by H at position 11, R by Q at position 11, F by I at position 15 , F by V at position 15 , K by Q at position 19, K by T at position 19, K by S at position 19, K by H at position 19, W by S at position 22, W by H at position 22, N by H at position 25, N by S at position 25, N by Q at position 25, R by H
position 27, R by Q position 27, L by V at position 28, L by I at position 28, L by T at position 28, L by Q at position 28, L by H at position 28, L
by A at position 28, E by Q at position 29, E by H at position 29, Y by H
at position 30, Y by I at position 30, L by V at position 32, L by I at position 32, L by T at position 32, L by Q at position 32, L by H at position 32, L by A at position 32, K by Q at position 33, K by T at position 33, K by S at position 33, K by H at position 33, R by H at position 35, R by Q at position 35, M by V at position 36, M by I at position 36, M by T at position 36, M by Q at position 36, M by A at position 36, D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by, Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by Q at position 73, D by H at position 73, D by G at position 73, E by Q at position 81, E by H at position 81, E by Q at position 85, E by H at position 85, Y by H at position 92, Y by I at position 92 , K by Q at position 99, K by T at position 99, K by S at position 99, K by H at position 99, E by Q at position 103, E by H at position 103, E by Q at position 104, E by H at position 104, K by Q at position 105, K by T at position 105, K by S at position 105, K by H at position 105, E by Q at position 107, E by H at position 107, K by Q at position 108, K by T at position 108, K by S at position 108, K by H at position 108, E by Q at position 109, E by H at position 109, D by Q at position 110, D by H at position 110, D by G at position 110, F by I at 111, F by V at position 111, R by H at position 113, R by Q at position 113, L by V at position 116, L by I at position 116, L by T at position 116, L by Q at position 116, L by H at position 116, L by A at position 116, L by V at position 120, L by I at position 120, L by T at position 120, L by V at position 120, L by H at position 120, L by A at position 120, K by Q at position 123, K by T at position 123, K by S at position 123, K by H at position 123, R by H at position 124, R by Q at position 124, R by H at position 123, R by H at position 124, R by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 138, Y by I at position 138, R by H at position152, R by Q at position 152, Y by H at position 155, Y by I at position 155, R by H at position 159, R by Q at position 159, Y by H at position 163, Y by I at position 163, R by H at position 165, R by Q at position 165, M by D at position 1, M by E at position M by K at position 1, M by N at position 1, M by R at position 1, at position 1, L by D at position 5, L by E
at position 5, L by K at position 5, L by N at position 5, L by R at position 5, L by S at position 5, L by D at position 6, L by E at position 6, L by K
at position 6, L by N at position 6, L by R at position 6, L by S at position 6, L by Q at position 6, L by T at position 6, F by E at position 8, F by K

at position 8, F by R at position 8, F by D at position 8, L by D at position 9, L by E at position 9, L by K at position 9, L by N at position 9, L by R
at position 9, L by S at position 9, Q by D at position 10 , Q by E at position 10 , Q by K at position 10 , Q by N at position 10 , Q by R at position 10 , Q by S at position 10 , Q by T at position 10 , S by D at position 12, S by E at position 12, S by K at position 12, S by R at position 12, S by D at position 13, S by E at position 13, S by K at position 13, S by R at position 13, S by N at position 13, S by Q at position 13, S by T at position 13, N by D at position 14, N by E at position 14, N by K at position 14, N by Q at position 14, N by R at position 14, N by S at position 14, N by T at position 14, F by D at position 15, F by E at position 15, F by K at position 15, F by R at position 15, Q by D at position 16, Q by E at position 16 , Q by K at position 16 , Q by N at position 16 , Q by R at position 16 , Q by S at position 16 , Q by T at position 16 , C by D at position 17, C by E at position 17, C by K at position 17, C by N at position 17, C by Q at position 17, C by R at position 17, C by S at position 17, C by T at position 17, L by N at position 20, L by Q at position 20, L by R at position 20, L by S at position 20, L by T at position 20, L by D at position 20, L by E at position 20, L by K at position 20, W by D at position 22, W by E at position 22, W by K at position 22, W by R at position 22, Q by D at position 23, Q by E at position 23, Q by K at position 23, Q by R at position 23, L by D at position 24, L by E at position 24, L by K at position 24, L by R at position 24, W by D at position 79, W by E at position 79, W by K at position 79, W by R at position 79, N by D at position 80, N by E at position 80, N by K at position 80, N by R at position 80, T by D at position 82, T by E at position 82, T by K at position 82, T by R at position 82, I by D at position 83, I by E at position 83, I by K at position 83, I by R at position 83, I by N at position 83, I by Q at position 83, I by S at position 83, I by T at position 83, N by D at position 86, N by E at position 86, N by K at position 86, N by R at position 86, N by Q at position 86, N by S at position 86, N by T at position 86, L by D at position 87, L by E at position 87, L by K at position 87, L by R at position 87, L by N at position 87, L by Q at position 87, L by S at position 87, L by T at position 87, A by D at position 89, A by E at position 89, A by K at position 89, A by R at position 89, N by D at position 90, N by E at position 90, N by K at position 90, N by Q at position 90, N by R at position 90, N by S at position 90, N by T at position 90, V by D at position 91, V by E at position 91, V by K at position 91, V by N at position 91, V by Q at position 91, V by R at position 91, V by S at position 91, V by T at position 91, Q by D at position 94, Q by E at position 94, Q by Q at position 94, Q by N at position 94, Q by R at position 94, Q by S at position 94, Q by T at position 94, I by D at position 95, I by E at position 95, I by K at position 95, I by N at position 95, I by Q at position 95, I by R at position 95, I by S at position 95, I by T at position 95, H by D at position 97, H by E at position 97, H by K at position 97, H by N at position 97, H by Q at position 97, H by R at position 97, H by S at position 97, H by T at position 97, L by D at position 98, L by E at position 98, L by K at position 98, L by N at position 98, L by Q at position 98, L by R at position 98, L by S at position 98, L by T at position 98, V by D at position 101, V by E at position 101, V by K at position 101, V by N at position 101, V by Q at position 101, V by R at position 101, V by S at position 101, V by T at position 101, M by C at position 1, L by C at position 6, Q by C at position 10, S by C at position 13, Q by C at position 16, L by C at position 17, V by C at position 101, L by C at position 98, H by C at position 97, Q by C at position 94, V by C at position 91, N by C at position 90, wherein residue 1 corresponds to residue 1 of the mature IFN.beta.
cytokine set forth in SEQ ID NOS:196.
373. A modified IFN.beta. cytokine selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ
ID NOS:196, or any combination thereof, corresponding to the replacement of:
D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by H at position 73, D by G at position 73, D by Q at position 73, E by Q at position 81, E by H at position 81, E by Q at position 107, E by H at position 107, K by Q at position 108, K by T at position 108, K by S at position 108, K by H at position 108, E by Q at position 109, E by H at position 109, D by Q at position 110, D by H at position 110, D by G at position 110, F by I at position 111, F by V at position 111, R by H at position 113, R by Q at position 113, L by V at position 116, L by I at position 116, L by T at position 116, L by Q at position 116, L by H at position 116, L by A at position 116, L by V at position 120, L by I at position 120, L by T at position 120, L by Q at position 120, L by H at position 120, L by A at position 120, K by Q at position 123, K by T at position 123, K by S at position 123, K by H at position 123, R by H at position 124,, R by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136,, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 163, Y by I at position 1631, R by H at position 165, R by Q at position 165, wherein the first amino acid listed is substituted by the second at the position indicated.
374. A modified IFN.beta. cytokine selected from the group consisting of proteins comprising one or more single amino acid replacements in SEQ
ID NOS:196, or any combination thereof, corresponding to the replacement of: M by V at position 1, M by I at position 1, M by T at position 1, M by Q at position 1 , M by A at position 1 , L by V at position 5 , L by I at position 5 , L by T at position 5 , L by Q at position , L by H at position 5 , L by A at position 5 , F by I at position 8, F by V at position 8, L by V at position 9, L by I at position 9, L by T at position 9, L by Q at position 9, L by H at position 9, L by A at position 9, R by H at position 11, R by Q at position 1 1, F by I at position 15 , F
by V at position 15 , K by Q at position 19, K by T at position 19, K by S
at position 19, K by H at position 19, W by S at position 22, W by H at position 22, N by H at position 25, N by S at position 25, N by Q at position 25, R by H position 27, R by Q position 27, L by V at position 28, L by I at position 28, L by T at position 28, L by O at position 28, L
by H at position 28, L by A at position 28, E by Q at position 29, E by H
at position 29, Y by H at position 30, Y by I at position 30, L by V at position 32, L by I at position 32, L by T at position 32, L by Q at position 32, L by H at position 32, L by A at position 32, K by Q at position 33, K by T at position 33, K by S at position 33, K by H at position 33, R by H at position 35, R by Q at position 35, M by V at position 36, M by I at position 36, M by T at position 36, M by Q at position 36, M by A at position 36, D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by, Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by Q at position 73, D by H at position 73, D by G at position 73, E by Q at position 81, E by H at position 81, E by Q at position 85, E by H at position 85, Y by H at position 92, Y by I at position 92 , K by Q at position 99, K by T at position 99, K by S at position 99, K by H at position 99, E by Q at position 103, E by H at position 103, E by Q at position 104, E by H at position 104, K by Q at position 105, K by T at position 105, K by S at position 105, K by H at position 105, E by Q at position 107, E by H at position 107, IC by Q at position 108, K by T at position 108, K by S at position 108, K by H at position 108, E by Q at position 109, E by H at position 109, D by Q at position 110, D by H at position 110, D by G at position 110, F by I at position 111, F by V at position 111, R by H at position 113, R by Q at position 113, L by V at position 116, L by I at position 116, L by T at position 116, L by Q at position 116, L by H at position 116, L by A at position 116, L by V at position 120, L by I at position 120, L by T at position 120, L by Q at position 120, L by H at position 120, L by A at position 120, K by Q at position 123, K by T at position 123, K by S at position 123, K by H at position 123, R by H at position 124, R by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 138, Y by I at position 138, R by H at position 152, R by Q at position 152, Y by H at position 155, Y by I at position 155, R by H at position 159, R by Q at position 159, Y by H at position 163, Y by I at position 163, R by H at position 165, R by Q. at position 165, M by D at position 1, M by E at position 1, M by K at position 1, M by N at position 1, M by R at position 1, M by S at position 1, L by D at position 5, L by E at position 5, L by K at position 5, L by N
at position 5, L by R at position 5, L by S at position 5, L by D at position 6, L by E at position 6, L by K at position 6, L by N at position 6, L by R
at position 6, L by S at position 6, L by Q at position 6, L by T at position 6, F by E at position 8, F by K at position 8, F by R at position 8, F by D
at position 8, L by D at position 9, L by E at position 9, L by K at position 9, L by N at position 9, L by R at position 9, L by S at position 9, Q by D
at position 10 , Q by E at position 10 , Q by K at position 10 , Q by N at position 10 , Q by R at position 10 , Q by S at position 10 , Q by T at position 10 , S by D at position 12, S by E at position 12, S by K at position 12, S by R at position 12, S by D at position 13, S by E at position 13, S by K at position 13, S by R at position 13, S by N at position 13, S by Q at position 13, S by T at position 13, N by D at position 14, N by E at position 14, N by K at position 14, N by Q at position 14, N by R at position 14, N by S at position 14, N by T at position 14, F by D at position 15, F by E at position 15, F by K at position 15, F by R at position 15, Q. by D at position 16, Q by E at position 16 , Q by K at position 16 , Q by N at position 16 , Q by R at position 16 , Q by S at position 16 , Q by T at position 16 , C by D at position 17, C by E at position 17, C by K at position 17, C by N at position 17, C by Q at position 17, C by R at position 17, C by S at position 17, C by T at position 17, L by N at position 20, L by Q at position 20, L by R at position 20, L by S at position 20, L by T at position 20, L by D at position 20, L by E at position 20, L by K at position 20, W by D at position 22, W by E at position 22, W by K at position 22, W by R at position 22, Q by D at position 23, Q by E at position 23, Q by K at position 23, Q by R at position 23, L by D at position 24, L by E at position 24, L by K at position 24, L by R at position 24, W by D at position 79, W by E at position 79, W by K at position 79, W by R at position 79, N by D at position 80, N by E at position 80, N by K at position 80, N by R at position 80, T by D at position 82, T by E at position 82, T by K at position 82, T by R at position 82, I by D at position 83, I by E at position 83, I by K at position 83, I by R at position 83, I by N at position 83, I by Q at position 83, I by S at position 83, I by T at position 83, N by D at position 86, N by E at position 86, N by K at position 86, N by R at position 86, N by Q at position 86, N by S at position 86, N by T at position 86, L by D at position 87, L by E at position 87, L by K at position 87, L by R at position 87, L by N at position 87, L by Q at position 87, L by S at position 87, L by T at position 87, A by D at position 89, A by E at position 89, A by K at position 89, A by R at position 89, N by D at position 90, N by E at position 90, N by K at position 90, N by Q at position 90, N by R at position 90, N by S at position 90, N by T at position 90, V by D at position 91, V by E at position 91, V by K at position 91, V by N at position 91, V by Q at position 91, V by R at position 91, V by S at position 91, V by T at position 91, Q by D at position 94, Q by E at position 94, Q by Q at position 94, Q by N at position 94, Q by R at position 94, Q by S at position 94, Q by T at position 94, I by D at position 95, I by E at position 95, I by K at position 95, I by N at position 95, I by Q at position 95, I by R at position 95, I by S at position 95, I by T at position 95, H by D at position 97, H by E at position 97, H by K at position 97, H by N at position 97, H by Q at position 97, H by R at position 97, H by S at position 97, H by T at position 97, L by D at position 98, L by E at position 98, L by K at position 98, L by N at position 98, L by Q at position 98, L by R at position 98, L by S at position 98, L by T at position 98, V by D at position 101, V by E at position 101, V by K at position 101, V by N at position 101, V by Q at position 101, V by R at position 101, V by S at position 101, V by T at position 101, M by C at position 1, L by C at position 6, Q by C at position 10, S by C at position 13, Q by C at position 16, L by C at position 17, V by C at position 101, L by C at position 98, H by C at position 97, Q by C at position 94, V by C at position 91, N by C at position 90, D by Q at position 39, D by H at position 39, D by G at position 39, E by Q at position 42, E by H at position 42, K by Q at position 45, K by T at position 45, K by S at position 45, K by H at position 45, L by V at position 47, L by I at position 47, L by T at position 47, L by Q at position 47, L by H at position 47, L by A at position 47, K by Q at position 52, K by T at position 52, K by S at position 52, K by H at position 52, F by I at position 67, F by V at position 67, R by H at position 71, R by Q at position 71, D by H at position 73, D by G at position 73, D by Q at position 73, E by Q at position 81, E by H at position 81, E by Q at position 107, E by H at position 107, K by Q at position 108, K by T at position 108, K by S at position 108, K by H at position 108, E by Q at position 109, E by H at position 109, D by Q at position 110, D by H at position 110, D by G at position 110, F by I at position 111, F by V at position 111, R by H at position 113, R by Q at position 113, L by V at position 116, L by I at position 116, L by T at position 116, L by Q at position 116, L by H at position 116, L by A at position 116, L by V at position 120, L by I at position 120, L by T at position 120, L by Q at position 120, L by H at position 120, L by A at position 120, K by Q at position 123, K by T at position 123, K by S at position 123, K by H at position 123, R by H at position 124, R by Q at position 124, R by H at position 128, R by Q at position 128, L by V at position 130, L by I at position 130, L by T at position 130, L by Q at position 130, L by H at position 130, L by A at position 130, K by Q at position 134, K by T at position 134, K by S at position 134, K by H at position 134, K by Q at position 136, K by T at position 136, K by S at position 136, K by H at position 136, E by Q at position 137, E by H at position 137, Y by H at position 163, Y by I at position 1631, R by H at position 165, R by Q at position 165, wherein the first amino acid listed is substituted by the second at the position indicated.
375. A modified IFN.beta. of claim 374 selected from the group consisting of a modified IFN.beta. set forth in any of SEQ ID Nos.234-289, 989-1302.
CA002498319A 2002-09-09 2003-09-08 Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules Abandoned CA2498319A1 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US40989802P 2002-09-09 2002-09-09
US60/409,898 2002-09-09
US45713503P 2003-03-21 2003-03-21
US60/457,135 2003-03-21
PCT/IB2003/004347 WO2004022593A2 (en) 2002-09-09 2003-09-08 Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules

Publications (1)

Publication Number Publication Date
CA2498319A1 true CA2498319A1 (en) 2004-03-18

Family

ID=31981642

Family Applications (1)

Application Number Title Priority Date Filing Date
CA002498319A Abandoned CA2498319A1 (en) 2002-09-09 2003-09-08 Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules

Country Status (8)

Country Link
US (12) US7611700B2 (en)
EP (1) EP1539960B1 (en)
AT (1) ATE466085T1 (en)
AU (1) AU2003263552A1 (en)
CA (1) CA2498319A1 (en)
DE (1) DE60332358D1 (en)
ES (1) ES2343518T3 (en)
WO (1) WO2004022593A2 (en)

Families Citing this family (92)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2808804B1 (en) * 2000-05-09 2002-08-02 Nautilus Biotech METHOD FOR DETERMINING THE TITLE OF BIOLOGICAL AGENTS IN REAL TIME IN LIVING TARGET CELLS AND ITS APPLICATIONS
US7647184B2 (en) 2001-08-27 2010-01-12 Hanall Pharmaceuticals, Co. Ltd High throughput directed evolution by rational mutagenesis
US20030129203A1 (en) * 2001-08-27 2003-07-10 Nautilus Biotech S.A. Mutant recombinant adeno-associated viruses
NZ537306A (en) * 2002-07-01 2008-11-28 Kenneth S Warren Inst Inc Compositions comprising mutein recombinant tissue protective cytokines having one or more amino acid substitutions facilitating transport of a molecule via transcytosis across an endothelial cell barrier
US7611700B2 (en) * 2002-09-09 2009-11-03 Hanall Pharmaceuticals, Co., Ltd. Protease resistant modified interferon alpha polypeptides
US20050202438A1 (en) * 2002-09-09 2005-09-15 Rene Gantier Rational directed protein evolution using two-dimensional rational mutagenesis scanning
US20060020396A1 (en) * 2002-09-09 2006-01-26 Rene Gantier Rational directed protein evolution using two-dimensional rational mutagenesis scanning
US20050054053A1 (en) * 2002-10-01 2005-03-10 Xencor, Inc. Interferon variants with improved properties
EP1581631A4 (en) * 2002-10-01 2007-09-05 Xencor Inc Interferon variants with improved properties
KR20100109969A (en) * 2002-10-02 2010-10-11 카탈리스트 바이오사이언시즈, 인코포레이티드 Methods of generating and screening for proteases with altered specificity
US7456257B2 (en) * 2003-02-18 2008-11-25 Merck Patent Gmbh Fusion proteins of interferon alpha muteins with improved properties
WO2006076014A2 (en) * 2004-04-30 2006-07-20 Government Of The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services Interferon-alpha constructs for use in the treatment of sars
US7597884B2 (en) * 2004-08-09 2009-10-06 Alios Biopharma, Inc. Hyperglycosylated polypeptide variants and methods of use
KR20070085227A (en) * 2004-08-09 2007-08-27 앨리오스 바이오파마 인크. Synthetic hyperglycosylated, protease-resistant polypeptide variants, oral formulations and methods of using the same
WO2006029094A2 (en) * 2004-09-02 2006-03-16 Xencor, Inc. Erythropoietin derivatives with altered immunogenicity
US7998930B2 (en) * 2004-11-04 2011-08-16 Hanall Biopharma Co., Ltd. Modified growth hormones
US7211973B1 (en) * 2005-01-07 2007-05-01 Marvell Asia Pte, Ltd. System and process for utilizing back electromotive force in disk drives
AU2005325768A1 (en) * 2005-01-25 2006-08-03 Apollo Life Sciences Limited Molecules and chimeric molecules thereof
WO2006111745A2 (en) * 2005-04-20 2006-10-26 Viragen Incorporated Composition and method for treating viral infection
CA2607806A1 (en) * 2005-05-04 2006-11-16 Nautilus Biotech, S.A. Modified interferon-gamma polypeptides and methods for using modified interferon-gamma polypeptides
CN101257925A (en) * 2005-06-20 2008-09-03 派普根公司 Low-toxicity, long-circulating chimeras of human interferon-alpha analogs and interferon tau
EP2476428B1 (en) * 2005-06-29 2013-08-21 Yeda Research and Development Co. Ltd. Recombinant interferon alpha 2 (IFN alpha 2) mutants
WO2007098547A1 (en) * 2006-03-01 2007-09-07 Apollo Life Sciences Limited A molecule and chimeric molecules thereof
WO2007098548A1 (en) * 2006-03-01 2007-09-07 Apollo Life Sciences Limited A molecule and chimeric molecules thereof
WO2007110231A2 (en) * 2006-03-28 2007-10-04 Nautilus Biotech, S.A. MODIFIED INTERFERON-β (IFN-β) POLYPEPTIDES
EP2581450B1 (en) 2006-05-02 2018-08-15 MedImmune Limited Non-natural amino acid substituted polypeptides
US20080096819A1 (en) 2006-05-02 2008-04-24 Allozyne, Inc. Amino acid substituted molecules
EP2084274A2 (en) 2006-06-19 2009-08-05 Nautilus Technology LLC Modified coagulation factor ix polypeptides and use thereof for treatment
AR078117A1 (en) * 2006-06-20 2011-10-19 Protech Pharma S A A RECOMBINANT MUTEIN OF THE GLICOSILATED HUMAN ALPHA INTERFERON, A CODIFYING GENE FOR SUCH MUTEIN, A METHOD OF PRODUCTION OF SUCH GENE, A METHOD FOR OBTAINING A EUCARIOTE CELL MANUFACTURING THIS MUTEINE, A METHOD FOR A MUTE DIFFERENT PROCEDURE
FR2905375A1 (en) * 2006-08-29 2008-03-07 Biomethodes Sa Thermostable variants of human interferon alpha useful for preparing antiviral, antiproliferative or immunomodulatory medicaments have one or more selected amino acid substitutions
ES2606034T3 (en) 2006-09-28 2017-03-17 Merck Sharp & Dohme Corp. Pegylated IL-10 for use in the treatment of lymphoma
CN101553499B (en) 2006-10-10 2013-10-16 澳大利亚国立大学 Process for generation of protein and uses thereof
EP2120998B1 (en) 2006-11-28 2013-08-07 HanAll Biopharma Co., Ltd. Modified erythropoietin polypeptides and uses thereof for treatment
US20080260820A1 (en) * 2007-04-19 2008-10-23 Gilles Borrelly Oral dosage formulations of protease-resistant polypeptides
US7625555B2 (en) 2007-06-18 2009-12-01 Novagen Holding Corporation Recombinant human interferon-like proteins
CA2707840A1 (en) 2007-08-20 2009-02-26 Allozyne, Inc. Amino acid substituted molecules
ATE548381T1 (en) * 2008-05-29 2012-03-15 Hanall Biopharma Co Ltd MODIFIED ERYTHROPOIETIN (EPO) POLYPEPTIDES WITH INCREASED PROTEASE RESISTANCE AND PHARMACEUTICAL COMPOSITIONS THEREOF
KR20110039348A (en) 2008-08-06 2011-04-15 노보 노르디스크 헬스 케어 악티엔게젤샤프트 Conjugated proteins with prolonged in vivo efficacy
CN103601800B (en) 2008-12-17 2015-10-21 默沙东公司 The production of single and double PEG IL10 and purposes
WO2010085086A2 (en) * 2009-01-20 2010-07-29 한올바이오파마 주식회사 Modified human thrombopoietin polypeptide fragment and manufacturing method thereof
KR20110122100A (en) 2009-01-22 2011-11-09 노보 노르디스크 헬스 케어 악티엔게젤샤프트 Stable growth hormone compounds
US8940501B2 (en) 2009-01-30 2015-01-27 Whitehead Institute For Biomedical Research Methods for ligation and uses thereof
SG176000A1 (en) * 2009-05-13 2011-12-29 Protein Delivery Solutions Llc Pharmaceutical system for trans-membrane delivery
US20100310509A1 (en) * 2009-06-04 2010-12-09 Ash John D COMPOSITIONS COMPRISING MODULATORS OF SIGNAL TRANSDUCING RECEPTOR gp130 AND METHODS OF PRODUCING AND USING SAME
EP2461831B1 (en) 2009-08-06 2018-11-21 Novo Nordisk Health Care AG Growth hormones with prolonged in-vivo efficacy
JP5980689B2 (en) 2010-01-22 2016-08-31 ノヴォ・ノルディスク・ヘルス・ケア・アーゲー Stable growth hormone compound
CN102834109B (en) 2010-01-22 2016-01-20 诺沃—诺迪斯克保健股份有限公司 Stable growth hormone compound
EP2595661A1 (en) 2010-07-22 2013-05-29 Novo Nordisk Health Care AG Growth hormone conjugates
CN103547288B (en) 2011-01-10 2016-03-16 密执安大学评议会 Stem cell factor inhibitor
US9732132B2 (en) * 2011-01-14 2017-08-15 Vanderbilt University Therapeutic compositions and methods for disorders associated with neuronal degeneration
CN103764665A (en) 2011-06-28 2014-04-30 怀特黑德生物医学研究所 Using sortases to install click chemistry handles for protein ligation
JP6184965B2 (en) 2011-10-28 2017-08-23 テバ・ファーマシューティカルズ・オーストラリア・ピーティワイ・リミテッド Polypeptide constructs and uses thereof
BR112015024423B1 (en) * 2013-03-29 2023-04-25 Glytech, Inc GLYCOSYLATED POLYPEPTIDE HAVING INTERFERON ACTIVITY, PHARMACEUTICAL COMPOSITION AND USE OF A GLYCOSYLATED POLYPEPTIDE
JP6464145B2 (en) 2013-04-05 2019-02-06 ノヴォ・ノルディスク・ヘルス・ケア・アーゲー Growth hormone compound preparation
CN105209054A (en) 2013-04-18 2015-12-30 阿尔莫生物科技股份有限公司 Methods of using interleukin-10 for treating diseases and disorders
US20160068583A1 (en) * 2013-04-24 2016-03-10 Armo Biosciences, Inc. Interleukin-10 Compositions and Uses Thereof
US11117975B2 (en) 2013-04-29 2021-09-14 Teva Pharmaceuticals Australia Pty Ltd Anti-CD38 antibodies and fusions to attenuated interferon alpha-2B
US9823255B2 (en) 2013-06-17 2017-11-21 Armo Biosciences, Inc. Method for assessing protein identity and stability
WO2015006554A1 (en) 2013-07-10 2015-01-15 The Regents Of The University Of Michigan Therapeutic antibodies and uses thereof
WO2015031316A1 (en) 2013-08-30 2015-03-05 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
KR20160079114A (en) 2013-11-11 2016-07-05 아르모 바이오사이언시스 인코포레이티드 Methods of using interleukin-10 for treating diseases and disorders
KR102230547B1 (en) * 2013-11-13 2021-03-22 수퍼랩 파 이스트 리미티드 Methods of determining interferon having direct inhibitory effects on tumors and uses thereof
UA119352C2 (en) 2014-05-01 2019-06-10 Тева Фармасьютикалз Острейліа Пті Лтд Combination of lenalidomide or pomalidomide and cd38 antibody-attenuated interferon-alpha constructs, and the use thereof
US10293043B2 (en) 2014-06-02 2019-05-21 Armo Biosciences, Inc. Methods of lowering serum cholesterol
MX2017004838A (en) 2014-10-14 2017-10-16 Armo Biosciences Inc Interleukin-15 compositions and uses thereof.
EP3209320B1 (en) 2014-10-22 2023-03-08 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
EP3212216A4 (en) 2014-10-29 2018-04-18 Teva Pharmaceuticals Australia Pty Ltd Interferon alpha2b variants
WO2016126615A1 (en) 2015-02-03 2016-08-11 Armo Biosciences, Inc. Methods of using interleukin-10 for treating diseases and disorders
CN107847564B (en) 2015-05-12 2021-11-09 远东超级实验室有限公司 Method for identifying interferon with direct inhibition effect on tumor and application thereof
EP3302547A1 (en) 2015-05-28 2018-04-11 Armo Biosciences, Inc. Pegylated interleukin-10 for use in treating cancer
JP7053453B2 (en) 2015-08-25 2022-04-12 アルモ・バイオサイエンシーズ・インコーポレイテッド How to use interleukin 10 to treat diseases and disorders
CA3019005A1 (en) 2016-05-18 2017-11-23 Cue Biopharma, Inc. T-cell modulatory multimeric polypeptides and methods of use thereof
TW201808987A (en) 2016-06-08 2018-03-16 健生生物科技公司 GM-CSF variants and methods of use
IL297617B2 (en) 2016-12-22 2023-11-01 Cue Biopharma Inc T-cell modulatory multimeric polypeptides and methods of use thereof
WO2018129474A1 (en) 2017-01-09 2018-07-12 Cue Biopharma, Inc. T-cell modulatory multimeric polypeptides and methods of use thereof
CN110520436A (en) 2017-03-15 2019-11-29 潘迪恩治疗公司 Target immunological tolerance
JP2020514375A (en) 2017-03-15 2020-05-21 キュー バイオファーマ, インコーポレイテッド Methods for modulating the immune response
US10926283B2 (en) 2017-04-12 2021-02-23 Carolyn S. Jordan Fingertip mist
EP3630163A4 (en) * 2017-05-24 2021-06-09 Pandion Operations, Inc. Targeted immunotolerance
WO2019073315A1 (en) 2017-10-09 2019-04-18 Mansour Poorebrahim Interferon-beta analog peptide
US10946068B2 (en) 2017-12-06 2021-03-16 Pandion Operations, Inc. IL-2 muteins and uses thereof
US10174091B1 (en) 2017-12-06 2019-01-08 Pandion Therapeutics, Inc. IL-2 muteins
EP3720871A4 (en) * 2017-12-06 2021-09-15 Pandion Operations, Inc. Targeted immunotolerance
EP3737689A4 (en) 2018-01-09 2021-12-01 Cue Biopharma, Inc. Multimeric t-cell modulatory polypeptides and methods of use thereof
MX2021000801A (en) * 2018-07-24 2021-04-12 BioNTech SE Il2 agonists.
CN113166261A (en) 2018-10-11 2021-07-23 印希比股份有限公司 B7H3 single domain antibodies and therapeutic compositions thereof
JP2022504822A (en) 2018-10-11 2022-01-13 インヒブルクス インコーポレイテッド DLL3 single domain antibody and therapeutic composition thereof
WO2020076992A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. 5t4 single domain antibodies and therapeutic compositions thereof
WO2020077257A1 (en) 2018-10-11 2020-04-16 Inhibrx, Inc. Pd-1 single domain antibodies and therapeutic compositions thereof
US11739146B2 (en) 2019-05-20 2023-08-29 Pandion Operations, Inc. MAdCAM targeted immunotolerance
CA3169564A1 (en) 2020-03-31 2021-10-07 Hanmi Pharm. Co., Ltd. Novel immunostimulating il-2 analogs
IL296209A (en) 2020-05-12 2022-11-01 Cue Biopharma Inc Multimeric t-cell modulatory polypeptides and methods of use thereof

Family Cites Families (308)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US134351A (en) * 1872-12-31 Improvement in crutches
US129584A (en) * 1872-07-16 Improvement in springs for gates and doors
US129203A (en) * 1872-07-16 Improvement in animal-traps
US175694A (en) * 1876-04-04 Improvement in sponge-cups
US3171820A (en) 1964-02-17 1965-03-02 Scott Paper Co Reticulated polyurethane foams and process for their production
US3224404A (en) * 1964-11-06 1965-12-21 Jong George E De Mooring device
US4044126A (en) 1972-04-20 1977-08-23 Allen & Hanburys Limited Steroidal aerosol compositions and process for the preparation thereof
GB1429184A (en) 1972-04-20 1976-03-24 Allen & Hanburys Ltd Physically anti-inflammatory steroids for use in aerosols
US4302386A (en) * 1978-08-25 1981-11-24 The Ohio State University Antigenic modification of polypeptides
US4363877B1 (en) * 1977-09-23 1998-05-26 Univ California Recombinant dna transfer vectors
US5221619A (en) * 1977-11-08 1993-06-22 Genentech, Inc. Method and means for microbial polypeptide expression
US4503035B1 (en) 1978-11-24 1996-03-19 Hoffmann La Roche Protein purification process and product
US4342832A (en) * 1979-07-05 1982-08-03 Genentech, Inc. Method of constructing a replicable cloning vehicle having quasi-synthetic genes
US4898830A (en) * 1979-07-05 1990-02-06 Genentech, Inc. Human growth hormone DNA
US5510472A (en) * 1979-11-21 1996-04-23 Yeda Research And Development Co. Ltd. Production of recombinant human interferon-beta2
US4816396A (en) * 1980-03-10 1989-03-28 Cetus Corporation Method and vector organism for controlled accumulation of heterologous gene products in bacillus subtilis
US6610830B1 (en) 1980-07-01 2003-08-26 Hoffman-La Roche Inc. Microbial production of mature human leukocyte interferons
US4462985A (en) 1980-08-22 1984-07-31 University Of Illinois Foundation Delivery of biologically active components of heterologous species interferon isolates
US4678751A (en) 1981-09-25 1987-07-07 Genentech, Inc. Hybrid human leukocyte interferons
US4775622A (en) * 1982-03-08 1988-10-04 Genentech, Inc. Expression, processing and secretion of heterologous protein by yeast
US4670393A (en) * 1982-03-22 1987-06-02 Genentech, Inc. DNA vectors encoding a novel human growth hormone-variant protein
US4446235A (en) * 1982-03-22 1984-05-01 Genentech, Inc. Method for cloning human growth hormone varient genes
US4665160A (en) * 1982-03-22 1987-05-12 Genentech, Inc. Novel human growth hormone like protein HGH-V encoded in the human genome
DE3220116A1 (en) 1982-05-28 1983-12-01 Dr. Karl Thomae Gmbh, 7950 Biberach MICROBIOLOGICALLY MANUFACTURED (ALPHA) AND SS INTERFERONES, DNA SEQUENCES CODING FOR THESE INTERFERONES, MICROORGANISMS CONTAINING THIS GENETIC INFORMATION, AND METHOD FOR THE PRODUCTION THEREOF
US4522811A (en) 1982-07-08 1985-06-11 Syntex (U.S.A.) Inc. Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides
US4588585A (en) * 1982-10-19 1986-05-13 Cetus Corporation Human recombinant cysteine depleted interferon-β muteins
US5618697A (en) * 1982-12-10 1997-04-08 Novo Nordisk A/S Process for preparing a desired protein
US5910304A (en) 1982-12-13 1999-06-08 Texas A&M University System Low-dose oral administration of interferons
US4820515A (en) 1982-12-13 1989-04-11 Texas A&M University System Method of using interferon in low dosage to regulate appetite and efficiency of food utilization
US4497795A (en) 1982-12-13 1985-02-05 The Texas A&M University System Method of regulating appetite and efficiency of food utilization employing interferon
US4518584A (en) * 1983-04-15 1985-05-21 Cetus Corporation Human recombinant interleukin-2 muteins
US4755465A (en) * 1983-04-25 1988-07-05 Genentech, Inc. Secretion of correctly processed human growth hormone in E. coli and Pseudomonas
US4859600A (en) * 1983-04-25 1989-08-22 Genentech, Inc. Recombinant procaryotic cell containing correctly processed human growth hormone
GB8317880D0 (en) * 1983-07-01 1983-08-03 Searle & Co Structure and synthesis of interferons
US5256546A (en) * 1983-07-15 1993-10-26 Bio-Technology General Corp. Bacterial expression of porcine growth hormone
US5637495A (en) * 1983-07-15 1997-06-10 Bio-Technology General Corp. Plasmids for production of human growth hormone or polypeptide analog thereof, hosts containing the plasmids, products manufactured thereby, and related methods
BG49718A3 (en) * 1983-07-15 1992-01-15 Bio Technology General Corp Method for preparing of polypeptid with superoxiddismutasne activitty
US5198361A (en) * 1983-07-15 1993-03-30 Bio-Technology General Corp. Plasmids for production of met-asp-gln bovine growth hormone, hosts containing the plasmids, products manufactured thereby and related methods
US5670371A (en) * 1983-07-15 1997-09-23 Bio-Technology General Corp. Bacterial expression of superoxide dismutase
US4703008A (en) * 1983-12-13 1987-10-27 Kiren-Amgen, Inc. DNA sequences encoding erythropoietin
KR850004274A (en) * 1983-12-13 1985-07-11 원본미기재 Method for preparing erythropoietin
NZ210501A (en) * 1983-12-13 1991-08-27 Kirin Amgen Inc Erythropoietin produced by procaryotic or eucaryotic expression of an exogenous dna sequence
GB8412564D0 (en) * 1984-05-17 1984-06-20 Searle & Co Structure and properties
US4747825A (en) * 1984-06-29 1988-05-31 Ferring Laboratories, Inc. Apparatus and methodology for pulsed administration of growth promoting agents
US4937076A (en) * 1984-08-10 1990-06-26 Combe Incorporated Chewable aspirin and buffering material tablet and method for producing same
US4797368A (en) 1985-03-15 1989-01-10 The United States Of America As Represented By The Department Of Health And Human Services Adeno-associated virus as eukaryotic expression vector
GB2183661B (en) 1985-03-30 1989-06-28 Marc Ballivet Method for obtaining dna, rna, peptides, polypeptides or proteins by means of a dna recombinant technique
US5198345A (en) 1985-04-15 1993-03-30 Gist-Brocades N.V. Vectors in use in filamentous fungi
US4845196A (en) * 1985-06-24 1989-07-04 G. D. Searle & Co. Modified interferon gammas
US5391485A (en) * 1985-08-06 1995-02-21 Immunex Corporation DNAs encoding analog GM-CSF molecules displaying resistance to proteases which cleave at adjacent dibasic residues
US4810643A (en) * 1985-08-23 1989-03-07 Kirin- Amgen Inc. Production of pluripotent granulocyte colony-stimulating factor
US5631227A (en) * 1985-09-18 1997-05-20 The Upjohn Company Somatotropin analogs
US5139941A (en) 1985-10-31 1992-08-18 University Of Florida Research Foundation, Inc. AAV transduction vectors
IL77186A0 (en) * 1985-11-29 1986-04-29 Touitou Elka Pharmaceutical insulin composition
US5298603A (en) * 1985-12-21 1994-03-29 Hoechst Aktiengesellschaft GM-CSF protein, its derivatives, the preparation of proteins of this type, and their use
US4820514A (en) 1985-12-30 1989-04-11 Texas A&M University System Low dosage of interferon to enhance vaccine efficiency
US6548640B1 (en) * 1986-03-27 2003-04-15 Btg International Limited Altered antibodies
EP0240224A3 (en) * 1986-03-31 1989-02-01 Interferon Sciences, Inc. An alpha interferon analogue
US4959217A (en) * 1986-05-22 1990-09-25 Syntex (U.S.A.) Inc. Delayed/sustained release of macromolecules
DK173067B1 (en) * 1986-06-27 1999-12-13 Univ Washington Human erythropoietin gene, method of expression thereof in transfected cell lines, the transfected cell lines
DE3683910D1 (en) 1986-09-05 1992-03-26 Cetus Corp OXIDATION RESISTANT MUTEINE FROM BETA-INTERFERON, THEIR PRODUCTION AND THE PREPARATIONS CONTAINING THESE MUTEINE.
US5183746A (en) * 1986-10-27 1993-02-02 Schering Aktiengesellschaft Formulation processes for pharmaceutical compositions of recombinant β-
CA1320905C (en) 1986-11-06 1993-08-03 Joseph M. Cummins Treatment of immuno-resistant disease
ZA878295B (en) 1986-11-06 1988-05-03 Amarillo Cell Culture Co. Inc. Treatment of immuno-resistant disease
US5013718A (en) * 1986-11-21 1991-05-07 Amgen, Inc. Method for treating iron overload using EPO
US5214132A (en) * 1986-12-23 1993-05-25 Kyowa Hakko Kogyo Co., Ltd. Polypeptide derivatives of human granulocyte colony stimulating factor
US4835260A (en) * 1987-03-20 1989-05-30 Genetics Institute, Inc. Erythropoietin composition
US4904584A (en) * 1987-12-23 1990-02-27 Genetics Institute, Inc. Site-specific homogeneous modification of polypeptides
US5017371A (en) 1988-01-06 1991-05-21 Amarillo Cell Culture Company, Incorporated Method for reducing side effects of cancer therapy
US5622845A (en) * 1988-02-17 1997-04-22 The Upjohn Company Fermentation method for producing norleucine
US5068317A (en) * 1988-03-15 1991-11-26 Eli Lilly And Company Novel derivative of human growth hormone
US5445826A (en) * 1988-06-28 1995-08-29 Cibus Pharmaceutical, Inc. Delivery system containing a gel-forming dietary fiber and a drug
CA1333777C (en) * 1988-07-01 1995-01-03 Randy M. Berka Aspartic proteinase deficient filamentous fungi
US5079345A (en) * 1988-08-19 1992-01-07 Eli Lilly And Company Proteins having growth hormone anabolic properties with reduced effect on carbohydrate metabolism
ES2154627T3 (en) * 1988-08-24 2001-04-16 American Cyanamid Co STABILIZATION OF SOMATOTROPINS THROUGH THE MODIFICATION OF CISTEINE REMAINS USING DIRECTED LOCATION OR CHEMICAL DERIVATIZATION MUTAGENESIS.
US5130422A (en) * 1988-08-29 1992-07-14 Monsanto Company Variant somatotropin-encoding DNA
US5089473A (en) * 1988-08-29 1992-02-18 Monsanto Company Somatotropin variants and their use
US5223409A (en) 1988-09-02 1993-06-29 Protein Engineering Corp. Directed evolution of novel binding proteins
US5079230A (en) * 1988-09-12 1992-01-07 Pitman-Moore, Inc. Stable bioactive somatotropins
GB8824591D0 (en) * 1988-10-20 1988-11-23 Royal Free Hosp School Med Fractionation process
WO1990004788A1 (en) * 1988-10-28 1990-05-03 Genentech, Inc. Method for identifying active domains and amino acid residues in polypeptides and hormone variants
US6780613B1 (en) 1988-10-28 2004-08-24 Genentech, Inc. Growth hormone variants
US5688666A (en) * 1988-10-28 1997-11-18 Genentech, Inc. Growth hormone variants with altered binding properties
US5534617A (en) * 1988-10-28 1996-07-09 Genentech, Inc. Human growth hormone variants having greater affinity for human growth hormone receptor at site 1
US5096815A (en) 1989-01-06 1992-03-17 Protein Engineering Corporation Generation and selection of novel dna-binding proteins and polypeptides
US5101018A (en) * 1989-06-12 1992-03-31 International Minerals & Chemical Corp. Method for recovering recombinant proteins
US5663305A (en) * 1989-07-10 1997-09-02 The Upjohn Company Somatotropin analogs
DE3923963A1 (en) * 1989-07-20 1991-01-31 Behringwerke Ag MUTEINE OF HUMAN ERYTHROPOETIN, THEIR PRODUCTION AND THEIR USE
US5047511A (en) * 1989-08-28 1991-09-10 Pitman-Moore, Inc. Method for recovering recombinant proteins
US5436146A (en) 1989-09-07 1995-07-25 The Trustees Of Princeton University Helper-free stocks of recombinant adeno-associated virus vectors
US5958879A (en) * 1989-10-12 1999-09-28 Ohio University/Edison Biotechnology Institute Growth hormone receptor antagonists and methods of reducing growth hormone activity in a mammal
US6787336B1 (en) * 1989-10-12 2004-09-07 Ohio University/Edison Biotechnology Institute DNA encoding growth hormone antagonists
US6583115B1 (en) * 1989-10-12 2003-06-24 Ohio University/Edison Biotechnology Institute Methods for treating acromegaly and giantism with growth hormone antagonists
US5350836A (en) * 1989-10-12 1994-09-27 Ohio University Growth hormone antagonists
US5856298A (en) * 1989-10-13 1999-01-05 Amgen Inc. Erythropoietin isoforms
JPH03151399A (en) 1989-11-07 1991-06-27 Snow Brand Milk Prod Co Ltd Mutant human erythropoietin
CA2072587A1 (en) * 1990-01-08 1991-07-09 Gail F. Seelig Oxidized variants of gm-csf
US5109121A (en) * 1990-01-22 1992-04-28 Pitman-Moore, Inc. Method for recovering recombinant proteins
US4988798A (en) * 1990-01-22 1991-01-29 Pitman-Moore, Inc. Method for recovering recombinant proteins
US5262568A (en) 1990-03-02 1993-11-16 State Of Oregon Tri- and tetra-substituted guanidines and their use as excitatory amino acid antagonists
EP0527809B1 (en) 1990-04-05 1995-08-16 CREA, Roberto Walk-through mutagenesis
GB9107846D0 (en) * 1990-04-30 1991-05-29 Ici Plc Polypeptides
US5951972A (en) * 1990-05-04 1999-09-14 American Cyanamid Company Stabilization of somatotropins and other proteins by modification of cysteine residues
US5399345A (en) * 1990-05-08 1995-03-21 Boehringer Mannheim, Gmbh Muteins of the granulocyte colony stimulating factor
HUT63185A (en) 1990-06-04 1993-07-28 Schering Corp Process for producing crystalline alpha-2-interferon
US5849694A (en) * 1990-07-16 1998-12-15 Synenki; Richard M. Stable and bioactive modified porcine somatotropin and pharmaceutical compositions thereof
IE912365A1 (en) * 1990-07-23 1992-01-29 Zeneca Ltd Continuous release pharmaceutical compositions
US5770434A (en) 1990-09-28 1998-06-23 Ixsys Incorporated Soluble peptides having constrained, secondary conformation in solution and method of making same
US6258530B1 (en) 1990-09-28 2001-07-10 Ixsys, Inc. Surface expression libraries of randomized peptides
US5871974A (en) 1990-09-28 1999-02-16 Ixsys Inc. Surface expression libraries of heteromeric receptors
US5215741A (en) 1990-10-30 1993-06-01 Amarillo Cell Culture Company, Incorporated Method for prevention of parasite infections
CA2044468C (en) * 1990-11-21 2006-08-22 Richard A. Nash Canine granulocyte macrophage colony stimulating factor
US5310882A (en) * 1990-11-30 1994-05-10 American Cyanamid Company Somatotropins with alterations in the α-helix 3 region
NZ240718A (en) * 1990-11-30 1996-10-28 Bio Technology General Corp Somatotropin analogues carrying mutations in the alpha-helix-1 region
WO1992009690A2 (en) * 1990-12-03 1992-06-11 Genentech, Inc. Enrichment method for variant proteins with altered binding properties
EP0499990B1 (en) * 1991-02-19 1996-05-15 Takeda Chemical Industries, Ltd. Method for producing cysteine-free peptides
JP3417558B2 (en) * 1991-05-10 2003-06-16 ジェネンテク,インコーポレイテッド Choice of ligand agonists and antagonists
US5733761A (en) * 1991-11-05 1998-03-31 Transkaryotic Therapies, Inc. Protein production and protein delivery
NZ245015A (en) * 1991-11-05 1995-12-21 Transkaryotic Therapies Inc Delivery of human growth hormone through the administration of transfected cell lines encoding human growth hormone, which are physically protected from host immune response; the transfected cells and their production
US5676942A (en) * 1992-02-10 1997-10-14 Interferon Sciences, Inc. Composition containing human alpha interferon species proteins and method for use thereof
JPH05289267A (en) * 1992-04-07 1993-11-05 Fuji Photo Film Co Ltd Silver halide color photographic sensitive material
US6153407A (en) * 1992-07-28 2000-11-28 Beth Israel Deaconess Medical Center Erythropoietin DNA having modified 5' and 3' sequences and its use to prepare EPO therapeutics
US5614184A (en) * 1992-07-28 1997-03-25 New England Deaconess Hospital Recombinant human erythropoietin mutants and therapeutic methods employing them
US6436387B1 (en) * 1992-11-24 2002-08-20 G.D. Searle & Co. Methods of ex-vivo expansion of hematopoietic cells using multivariant IL-3 hematopoiesis chimera proteins
US5581476A (en) * 1993-01-28 1996-12-03 Amgen Inc. Computer-based methods and articles of manufacture for preparing G-CSF analogs
US5441734A (en) 1993-02-25 1995-08-15 Schering Corporation Metal-interferon-alpha crystals
CN1125401A (en) * 1993-04-29 1996-06-26 艾博特公司 Erythropoietin analog compositions and methods
EP0626448A3 (en) 1993-05-26 1998-01-14 BOEHRINGER INGELHEIM INTERNATIONAL GmbH Process for preparing and purifying alpha-interferon
US5789551A (en) 1993-06-11 1998-08-04 Pestka Biomedical Laboratories, Inc. Human leukocyte interferon Hu-IFN-α001
US6299870B1 (en) 1993-06-11 2001-10-09 Pbl Biomedical Laboratories Mutant human interferons
NZ269766A (en) * 1993-07-28 1998-01-26 Medvet Science Pty Ltd Haemopoietic growth factor antagonists; relates to modified forms of such factors
US5424289A (en) * 1993-07-30 1995-06-13 Alza Corporation Solid formulations of therapeutic proteins for gastrointestinal delivery
US5798500A (en) * 1993-08-10 1998-08-25 Stillwagon, Jr.; Ross I. Curling iron stove with internal cavity with electric heater positioned therebelow
CN1057534C (en) 1993-08-17 2000-10-18 柯瑞英-艾格公司 Erythropoietin analogs
US5976552A (en) * 1995-04-28 1999-11-02 Protein Sciences Corporation Virus vaccines
EP0749980A4 (en) * 1993-12-29 1999-09-29 Sumitomo Pharma Novel human ciliary neurotrophic factor
US5597709A (en) * 1994-01-27 1997-01-28 Human Genome Sciences, Inc. Human growth hormone splice variants hGHV-2(88) and hGHV-3(53)
US6117679A (en) 1994-02-17 2000-09-12 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US6165793A (en) 1996-03-25 2000-12-26 Maxygen, Inc. Methods for generating polynucleotides having desired characteristics by iterative selection and recombination
US5605793A (en) 1994-02-17 1997-02-25 Affymax Technologies N.V. Methods for in vitro recombination
US6335160B1 (en) 1995-02-17 2002-01-01 Maxygen, Inc. Methods and compositions for polypeptide engineering
KR100403688B1 (en) * 1994-02-23 2004-02-05 교와 핫꼬 고교 가부시끼가이샤 Thrombocytopenia and pharmaceutical compositions comprising the same
EP0748338A4 (en) 1994-03-04 2001-03-28 Merck & Co Inc In vitro antibody affinity maturation using alanine scanning mutagenesis
US5545723A (en) * 1994-03-15 1996-08-13 Biogen Inc. Muteins of IFN-β
US5747446A (en) * 1994-03-22 1998-05-05 Beth Israel Deaconess Medical Center Modified polypeptides with increased biological activity
US5580853A (en) * 1994-03-22 1996-12-03 New England Deaconess Hospital Modified polypeptides with increased biological activity
US6024734A (en) 1994-03-31 2000-02-15 Brewitt; Barbara A. Treatment methods using homeopathic preparations of growth factors
US5635599A (en) * 1994-04-08 1997-06-03 The United States Of America As Represented By The Department Of Health And Human Services Fusion proteins comprising circularly permuted ligands
US6346243B1 (en) 1994-04-12 2002-02-12 Research Development Foundation Inhibition of transplant rejection by type one interferon
JP3560639B2 (en) 1994-05-26 2004-09-02 株式会社タカハシキカン Incinerator
FR2722208B1 (en) 1994-07-05 1996-10-04 Inst Nat Sante Rech Med NEW INTERNAL RIBOSOME ENTRY SITE, VECTOR CONTAINING SAME AND THERAPEUTIC USE
US5460232A (en) * 1994-07-25 1995-10-24 Central Mine Equipment Company Rotary earth drill bit socket shield
US6099830A (en) * 1994-08-09 2000-08-08 Zymogenetics, Inc. Methods for stimulating erythropoiesis using hematopoietic proteins
IL116085A (en) * 1994-12-16 1999-12-31 Ortho Pharma Corp Spray dried erythropoietin
IL116816A (en) 1995-01-20 2003-05-29 Rhone Poulenc Rorer Sa Cell for the production of a defective recombinant adenovirus or an adeno-associated virus and the various uses thereof
US6387365B1 (en) 1995-05-19 2002-05-14 Schering Corporation Combination therapy for chronic hepatitis C infection
US5814485A (en) * 1995-06-06 1998-09-29 Chiron Corporation Production of interferon-β (IFN-β) in E. coli
US5871723A (en) 1995-06-06 1999-02-16 The Regent Of The University Of Michigan CXC chemokines as regulators of angiogenesis
US5854049A (en) * 1995-06-09 1998-12-29 President And Fellows Of Harvard College Plasmin-resistant streptokinase
AUPN378095A0 (en) * 1995-06-23 1995-07-20 Bresagen Limited Haemopoietic growth factor antagonists and uses therefor
NZ286884A (en) * 1995-06-29 1997-12-19 Mitsui Chemicals Inc Use of 20 kd human growth hormone in hrt, increasing serum igf-1 levels and stimulating lipolysis
US6057103A (en) 1995-07-18 2000-05-02 Diversa Corporation Screening for novel bioactivities
DE19535853C2 (en) * 1995-09-18 1999-04-01 Fraunhofer Ges Forschung Variants of recombinant human interferon gamma, process for their preparation and their use
ATE455171T1 (en) * 1995-09-21 2010-01-15 Genentech Inc VARIANTS OF HUMAN GROWTH HORMONE
EP0858343B1 (en) 1995-11-02 2004-03-31 Schering Corporation Continuous low-dose cytokine infusion therapy
US6238884B1 (en) 1995-12-07 2001-05-29 Diversa Corporation End selection in directed evolution
US6171820B1 (en) 1995-12-07 2001-01-09 Diversa Corporation Saturation mutagenesis in directed evolution
US20030215798A1 (en) 1997-06-16 2003-11-20 Diversa Corporation High throughput fluorescence-based screening for novel enzymes
US6479258B1 (en) 1995-12-07 2002-11-12 Diversa Corporation Non-stochastic generation of genetic vaccines
CA2244372A1 (en) 1996-01-23 1997-07-31 Marc S. Collett Methods for identifying inhibitors of rna viruses
DE69712124T2 (en) * 1996-02-13 2002-12-12 Jcr Pharmaceutical Co Hormones de croissance humaines mutantes et leur utilization
GEP20012489B (en) 1996-02-28 2001-07-25 Ifi Inst Farmacoterapico Italiano S P A Use of Natural Human α-Interferon
US6096548A (en) 1996-03-25 2000-08-01 Maxygen, Inc. Method for directing evolution of a virus
SI9720025A (en) * 1996-03-29 1999-08-31 Emishphere Technologies, Inc. Compounds and compositions for delivering active agents
US6204022B1 (en) 1996-04-12 2001-03-20 Pepgen Corporation And University Of Florida Low-toxicity human interferon-alpha analogs
WO1997041884A1 (en) 1996-05-09 1997-11-13 Pharma Pacific Pty. Ltd. Method of treatment
CN1151840C (en) 1996-05-09 2004-06-02 太平洋制药控股公司 Stimulation of host defence mechanisms against tumors
US6207145B1 (en) 1997-05-09 2001-03-27 Pharma Pacific Pty Ltd. Therapeutic applications of high dose interferon
US5763239A (en) 1996-06-18 1998-06-09 Diversa Corporation Production and use of normalized DNA libraries
WO1998007878A2 (en) * 1996-08-23 1998-02-26 Arch Development Corporation Long-term expression of gene products by transforming muscle cells
JP2001504325A (en) 1996-09-27 2001-04-03 マキシジェン,インコーポレイテッド A method for optimization of gene therapy by recursive sequence shuffling and selection
US6967092B1 (en) * 1996-10-25 2005-11-22 Mc Kearn John P Multi-functional chimeric hematopoietic receptor agonists
DE19648625A1 (en) * 1996-11-13 1998-05-14 Soft Gene Gmbh Microprojectile for the introduction of substances into cells by ballistic transfer
US5862514A (en) 1996-12-06 1999-01-19 Ixsys, Inc. Method and means for synthesis-based simulation of chemicals having biological functions
BR9606270A (en) * 1996-12-18 1998-09-22 Univ Minas Gerais Process for the production of recombinant human beta-cis interferon protein and recombinant human beta-cis interferon protein
US6884419B1 (en) * 1996-12-23 2005-04-26 Kyowa Hakko Kogyo, Co., Ltd. hG-CSF fusion polypeptide having c-mpl activity, DNA coding for same and methods of treating anemia using same
US5779434A (en) 1997-02-06 1998-07-14 Baker Hughes Incorporated Pump mounted thrust bearing
DE19717864C2 (en) 1997-04-23 2001-05-17 Fraunhofer Ges Forschung Human recombinant interferon beta, process for its preparation and its use
US6153420A (en) * 1997-04-24 2000-11-28 Zymogenetics, Inc. Serine protease polypeptides and materials and methods for making them
WO1998050025A1 (en) * 1997-05-08 1998-11-12 Chugai Seiyaku Kabushiki Kaisha Preventives/remedies for arteriosclerosis
AU7383298A (en) * 1997-05-13 1998-12-08 Regents Of The University Of California, The Novel antiangiogenic peptide agents and their therapeutic and diagnostic use
US6165476A (en) * 1997-07-10 2000-12-26 Beth Israel Deaconess Medical Center Fusion proteins with an immunoglobulin hinge region linker
US7153943B2 (en) * 1997-07-14 2006-12-26 Bolder Biotechnology, Inc. Derivatives of growth hormone and related proteins, and methods of use thereof
BR9812267B1 (en) * 1997-07-14 2013-11-26 Recombinant Growth Hormone.
US7270809B2 (en) 1997-07-14 2007-09-18 Bolder Biotechnology, Inc. Cysteine variants of alpha interferon-2
US6753165B1 (en) 1999-01-14 2004-06-22 Bolder Biotechnology, Inc. Methods for making proteins containing free cysteine residues
DE69838647T2 (en) * 1997-09-08 2008-08-28 Metabolic Pharmaceuticals Ltd., Melbourne TREATMENT OF GRAVITY
US6156509A (en) 1997-11-12 2000-12-05 Genencor International, Inc. Method of increasing efficiency of directed evolution of a gene using phagemid
US6897297B1 (en) 1997-12-03 2005-05-24 Curis, Inc. Hydrophobically-modified protein compositions and methods
US6165458A (en) 1997-12-26 2000-12-26 Pharmaderm Laboratories Ltd. Composition and method for dermal and transdermal administration of a cytokine
US6274158B1 (en) * 1998-02-04 2001-08-14 Veronica L. Zaharia Czeizler Treatment with recombinant human erythropoietin of bleeding in patients with normal and abnormal hemostasis
DE69825137T2 (en) * 1998-02-23 2005-07-21 Cilag Ag International Liposomal erythropoietin dispersion
US6036949A (en) 1998-03-05 2000-03-14 Amarillo Biosciences, Inc. Treatment of fibromyalgia with low doses of interferon
US6676937B1 (en) * 1998-03-09 2004-01-13 Caritas St. Elizabeth's Medical Center Of Boston Inc. Compositions and methods for modulating vascularization
US20040228834A1 (en) * 1998-03-09 2004-11-18 Jeffrey Isner Compositions and methods for modulating vascularization
US6174406B1 (en) * 1998-04-09 2001-01-16 International Business Machines Corporation Bonding together surfaces
US6413776B1 (en) 1998-06-12 2002-07-02 Galapagos Geonomics N.V. High throughput screening of gene function using adenoviral libraries for functional genomics applications
US6548653B1 (en) * 1998-06-15 2003-04-15 Genzyme Transgenics Corporation Erythropoietin analog-human serum albumin fusion
US6472512B1 (en) * 1998-07-21 2002-10-29 Human Genome Sciences, Inc. Keratinocyte derived interferon
EE04967B1 (en) * 1998-10-16 2008-02-15 Biogen, Incorporated Glycylated Interferon Beta, its Use and a Pharmaceutical Composition, Method for Prolonging Interferon Beta-1a Activity, and Preparing a Protein of the Invention
MXPA01003790A (en) * 1998-10-16 2002-09-18 Biogen Inc Interferon-beta fusion proteins and uses.
AUPP660698A0 (en) * 1998-10-21 1998-11-12 University Of Queensland, The A method of protein engineering
CA2352167A1 (en) 1998-11-25 2000-06-08 Amarillo Biosciences, Inc. Interferon-alpha mediated upregulation of aquaporin expression
JP2002531089A (en) * 1998-11-30 2002-09-24 イーライ・リリー・アンド・カンパニー Erythropoietic compounds
US6171620B1 (en) * 1999-04-27 2001-01-09 Health Research, Inc. Method of enhancing the efficacy of anti-tumor agents
US6555343B1 (en) * 1999-05-07 2003-04-29 Genentech Inc. Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US6831060B2 (en) * 1999-05-07 2004-12-14 Genentech, Inc. Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US6946265B1 (en) * 1999-05-12 2005-09-20 Xencor, Inc. Nucleic acids and proteins with growth hormone activity
US6514729B1 (en) 1999-05-12 2003-02-04 Xencor, Inc. Recombinant interferon-beta muteins
US6710025B1 (en) * 1999-05-26 2004-03-23 The Brigham And Women's Hospital, Inc. Treatment of damaged tissue using agents that modulate the activity of alpha-smooth muscle actin
US6319691B1 (en) * 1999-06-15 2001-11-20 Usa Universe Bioengineering, Inc. Fusion proteins comprising IFN-alpha2b and TM-alpha1
US6566329B1 (en) * 1999-06-28 2003-05-20 Novo Nordisk A/S Freeze-dried preparation of human growth hormone
CZ299516B6 (en) * 1999-07-02 2008-08-20 F. Hoffmann-La Roche Ag Erythropoietin glycoprotein conjugate, process for its preparation and use and pharmaceutical composition containing thereof
KR100356140B1 (en) * 1999-07-08 2002-10-19 한미약품공업 주식회사 Modified Human Granulocyte-Colony Stimulating Factor and Process for Producing Same
US7144574B2 (en) * 1999-08-27 2006-12-05 Maxygen Aps Interferon β variants and conjugates
US6531122B1 (en) * 1999-08-27 2003-03-11 Maxygen Aps Interferon-β variants and conjugates
AU7731700A (en) 1999-09-28 2001-04-30 Amarillo Biosciences, Inc. Low dose ifn-gamma for treatment of disease
WO2001025438A2 (en) * 1999-10-07 2001-04-12 Maxygen, Inc. Ifn-alpha homologues
US20040002474A1 (en) 1999-10-07 2004-01-01 Maxygen Inc. IFN-alpha homologues
AU1436401A (en) 1999-10-21 2001-05-14 Board Of Trustees Of The University Of Arkansas, The RepO-associated virus AAV REP78 major regulatory protein, mutants thereof and uses thereof
AU7646200A (en) 1999-11-05 2001-05-14 Novozymes A/S Microtiter plate (mtp) based high throughput screening (hts) assays
KR20020065517A (en) * 1999-11-12 2002-08-13 맥시겐 홀딩스 리미티드 Interferon gamma conjugates
DE60021760T2 (en) 1999-12-09 2006-06-08 Chiron Corp., Emeryville METHOD FOR THE ADMINISTRATION OF ACTIVE SUBSTANCES IN THE CENTRAL NERVOUS SYSTEM OR LYMPHIC SYSTEM
FR2802645B1 (en) 1999-12-16 2002-03-08 Meillat Roland METHOD FOR EVALUATING THE PERFORMANCE OF A SET OF BIOLOGICAL AGENTS IN LIVE TARGET CELLS AND ITS APPLICATIONS
US6646110B2 (en) * 2000-01-10 2003-11-11 Maxygen Holdings Ltd. G-CSF polypeptides and conjugates
US6555660B2 (en) * 2000-01-10 2003-04-29 Maxygen Holdings Ltd. G-CSF conjugates
WO2001061344A1 (en) * 2000-02-17 2001-08-23 California Institute Of Technology Computationally targeted evolutionary design
AU780270B2 (en) * 2000-02-23 2005-03-10 Association Francaise Contre Les Myopathies Treatment of immune diseases
FR2808804B1 (en) 2000-05-09 2002-08-02 Nautilus Biotech METHOD FOR DETERMINING THE TITLE OF BIOLOGICAL AGENTS IN REAL TIME IN LIVING TARGET CELLS AND ITS APPLICATIONS
AU2001256499B2 (en) * 2000-05-12 2007-07-26 University College Cardiff Consultants Limited Method for detecting growth hormone variations in humans, the variations and their uses
ATE367398T1 (en) * 2000-05-16 2007-08-15 Bolder Biotechnology Inc METHOD FOR REFOLDING PROTEINS WITH FREE CYSTEINE RESIDUE
US7154958B2 (en) * 2000-07-05 2006-12-26 Texas Instruments Incorporated Code division multiple access wireless system with time reversed space time block transmitter diversity
DE60142971D1 (en) 2000-07-31 2010-10-14 Biolex Therapeutics Inc EXPRESSION OF BIOLOGICALLY ACTIVE POLYPEPTIDES IN WATER LENS
JP4707931B2 (en) 2000-08-18 2011-06-22 エミスフェアー・テクノロジーズ・インク Active agent delivery compounds and compositions
WO2002015664A2 (en) 2000-08-23 2002-02-28 The New York Hospital Medical Center Of Queens Methods of preventing or treating west nile virus and other infections
FR2813314B1 (en) 2000-08-25 2004-05-07 Biomethodes MASSIVE DIRECTED MUTAGENESIS PROCESS
MXPA03002046A (en) * 2000-09-08 2003-07-24 Massachusetts Inst Technology G-csf analog compositions and methods.
US20020169290A1 (en) * 2000-11-02 2002-11-14 Claus Bornaes New multimeric interferon beta polypeptides
US20030072737A1 (en) * 2000-12-29 2003-04-17 Michael Brines Tissue protective cytokines for the protection, restoration, and enhancement of responsive cells, tissues and organs
US20060183197A1 (en) * 2001-01-11 2006-08-17 Andersen Kim V Variant growth hormone molecules conjugated with macromolecules compounds
HUP0400703A3 (en) * 2001-02-06 2006-06-28 Merck Patent Gmbh Modified erythropoietin (epo) with reduced immunogenicity
CN1514844A (en) * 2001-02-06 2004-07-21 Ĭ��ר�����޹�˾ Modified granulocyte colony stimulating factor (G-CSF) with reduced immunogenicity
MXPA03007323A (en) * 2001-02-19 2003-12-12 Merck Patent Gmbh Artificial proteins with reduced immunogenicity.
MXPA03008032A (en) * 2001-03-08 2003-12-04 Merck Patent Gmbh Modified granulocyte macrophage colony stimulating factor (gm-csf) with reduced immunogenicity.
BR0208041A (en) * 2001-03-15 2004-02-25 Merck Patent Gmbh Modified interferon beta with reduced immunogenicity
WO2002079415A2 (en) * 2001-03-30 2002-10-10 Lexigen Pharmaceuticals Corp. Reducing the immunogenicity of fusion proteins
FR2823220B1 (en) * 2001-04-04 2003-12-12 Genodyssee NOVEL ERYTHROPOIETIN (EPO) POLYNUCLEOTIDES AND POLYPEPTIDES
US7271150B2 (en) * 2001-05-14 2007-09-18 United States Of America, Represented By The Secretary, Department Of Health And Human Services Modified growth hormone
US6833351B2 (en) * 2001-05-21 2004-12-21 Douglas T. Dieterich Method of treating anemia caused by ribavirin treatment of hepatitis C using erythropoietin alpha
US6828305B2 (en) * 2001-06-04 2004-12-07 Nobex Corporation Mixtures of growth hormone drug-oligomer conjugates comprising polyalkylene glycol, uses thereof, and methods of making same
US20030129203A1 (en) 2001-08-27 2003-07-10 Nautilus Biotech S.A. Mutant recombinant adeno-associated viruses
US7647184B2 (en) 2001-08-27 2010-01-12 Hanall Pharmaceuticals, Co. Ltd High throughput directed evolution by rational mutagenesis
MXPA04001976A (en) * 2001-09-04 2004-06-07 Merck Patent Gmbh Modified human growth hormone.
US6688666B2 (en) * 2001-09-13 2004-02-10 Colin G. Neale Second row fold and pivot seat assembly
US6930086B2 (en) * 2001-09-25 2005-08-16 Hoffmann-La Roche Inc. Diglycosylated erythropoietin
US7297511B2 (en) 2001-10-10 2007-11-20 Neose Technologies, Inc. Interferon alpha: remodeling and glycoconjugation of interferon alpha
EP1507540A4 (en) * 2001-10-10 2006-12-06 Centocor Inc Nucleic acid vaccines using tumor antigen encoding nucleic acids with cytokine adjuvant encoding nucleic acid
US6786634B2 (en) * 2001-10-10 2004-09-07 Noritake Co., Limited Temperature measuring method and apparatus
CN101724075B (en) * 2001-10-10 2014-04-30 诺和诺德公司 Remodeling and glycoconjugation of peptides
CA2466346A1 (en) * 2001-11-09 2003-05-22 Pharmacia & Upjohn Company Single nucleotide polymorphisms in gh-1
GB0127213D0 (en) * 2001-11-12 2002-01-02 Univ Wales Medicine Method of detecting growth hormone variations in humans the variations and their uses
GB2389115B (en) * 2001-12-14 2005-03-16 Asterion Ltd Polypeptide having a plurality of modified growth hormone receptor binding domains of growth hormone
US20030224404A1 (en) 2002-02-25 2003-12-04 Manuel Vega High throughput directed evolution of nucleic acids by rational mutagenesis
NZ537306A (en) 2002-07-01 2008-11-28 Kenneth S Warren Inst Inc Compositions comprising mutein recombinant tissue protective cytokines having one or more amino acid substitutions facilitating transport of a molecule via transcytosis across an endothelial cell barrier
US6809191B2 (en) * 2002-07-03 2004-10-26 Vaxim, Inc. GM-CSF nucleic acid sequences
BR0313135A (en) * 2002-08-09 2005-07-05 Merck Patent Gmbh T cell epitopes in erythropoietin
EP1549675B1 (en) 2002-08-31 2008-02-13 CJ Corp Glycosylated human interferon alpha isoform
US7611700B2 (en) * 2002-09-09 2009-11-03 Hanall Pharmaceuticals, Co., Ltd. Protease resistant modified interferon alpha polypeptides
US20060020396A1 (en) * 2002-09-09 2006-01-26 Rene Gantier Rational directed protein evolution using two-dimensional rational mutagenesis scanning
US20050176627A1 (en) * 2002-09-09 2005-08-11 Anthony Cerami Long acting erythropoietins that maintain tissue protective activity of endogenous erythropoietin
WO2004022747A1 (en) 2002-09-09 2004-03-18 Nautilus Biotech Rational directed protein evolution using two-dimensional rational mutagenesis scanning
US20050202438A1 (en) 2002-09-09 2005-09-15 Rene Gantier Rational directed protein evolution using two-dimensional rational mutagenesis scanning
EP1581631A4 (en) 2002-10-01 2007-09-05 Xencor Inc Interferon variants with improved properties
US20050054053A1 (en) * 2002-10-01 2005-03-10 Xencor, Inc. Interferon variants with improved properties
US7189740B2 (en) * 2002-10-15 2007-03-13 Celgene Corporation Methods of using 3-(4-amino-oxo-1,3-dihydro-isoindol-2-yl)-piperidine-2,6-dione for the treatment and management of myelodysplastic syndromes
US20040091961A1 (en) * 2002-11-08 2004-05-13 Evans Glen A. Enhanced variants of erythropoietin and methods of use
KR20050086498A (en) 2002-11-18 2005-08-30 맥시겐, 인크. Interferon-alpha polypeptides and conjugates
TWI281864B (en) * 2002-11-20 2007-06-01 Pharmacia Corp N-terminally monopegylated human growth hormone conjugates and process for their preparation
US20040142870A1 (en) * 2002-11-20 2004-07-22 Finn Rory F. N-terminally monopegylated human growth hormone conjugates, process for their preparation, and methods of use thereof
KR100541850B1 (en) 2003-03-31 2006-01-11 삼성정밀화학 주식회사 Mutein of human interferon-beta and its preparation method
EP1636256A2 (en) 2003-06-10 2006-03-22 Xencor, Inc. Interferon variants with improved properties
KR100632985B1 (en) * 2003-07-26 2006-10-11 메덱스젠 주식회사 A method of improving efficacy of biological response-modifying proteins and the example muteins
CA2552892C (en) * 2004-01-08 2014-08-05 Neose Technologies, Inc. O-linked glycosylation of peptides
NZ586034A (en) * 2004-02-02 2011-10-28 Ambrx Inc Modified human growth hormone polypeptides and their uses
JP2008508854A (en) 2004-04-23 2008-03-27 ケンブリッジ アンティボディー テクノロジー リミテッド Erythropoietin protein variant
CA2565368A1 (en) * 2004-04-29 2005-11-24 Glaxosmithkline Istrazivacki Centar Zagreb D.O.O. Oral formulations comprising bone morphogenetic proteins for treating metabolic bone diseases
KR20070085227A (en) 2004-08-09 2007-08-27 앨리오스 바이오파마 인크. Synthetic hyperglycosylated, protease-resistant polypeptide variants, oral formulations and methods of using the same
WO2006029094A2 (en) 2004-09-02 2006-03-16 Xencor, Inc. Erythropoietin derivatives with altered immunogenicity
WO2006024547A2 (en) 2004-09-03 2006-03-09 Creabilis Therapeutics S.P.A. Protease resistant human and non-human hmgb1 box-a mutants and their therapeutic/diagnostic use
US7998930B2 (en) 2004-11-04 2011-08-16 Hanall Biopharma Co., Ltd. Modified growth hormones
GB0500099D0 (en) 2005-01-05 2005-02-09 Cambridge Antibody Tech Methods and means relating to protein variants
CA2607806A1 (en) * 2005-05-04 2006-11-16 Nautilus Biotech, S.A. Modified interferon-gamma polypeptides and methods for using modified interferon-gamma polypeptides
WO2007110230A2 (en) 2006-03-27 2007-10-04 Institut Pasteur Secreted proteins as early markers and drug targets for autoimmunity, tumorigenesis and infections
WO2007110231A2 (en) * 2006-03-28 2007-10-04 Nautilus Biotech, S.A. MODIFIED INTERFERON-β (IFN-β) POLYPEPTIDES
EP2084274A2 (en) * 2006-06-19 2009-08-05 Nautilus Technology LLC Modified coagulation factor ix polypeptides and use thereof for treatment
EP2120998B1 (en) 2006-11-28 2013-08-07 HanAll Biopharma Co., Ltd. Modified erythropoietin polypeptides and uses thereof for treatment
US20080260820A1 (en) * 2007-04-19 2008-10-23 Gilles Borrelly Oral dosage formulations of protease-resistant polypeptides
ATE548381T1 (en) 2008-05-29 2012-03-15 Hanall Biopharma Co Ltd MODIFIED ERYTHROPOIETIN (EPO) POLYPEPTIDES WITH INCREASED PROTEASE RESISTANCE AND PHARMACEUTICAL COMPOSITIONS THEREOF

Also Published As

Publication number Publication date
US20080075672A1 (en) 2008-03-27
US8052964B2 (en) 2011-11-08
US20070254838A1 (en) 2007-11-01
US20040132977A1 (en) 2004-07-08
US20060020116A1 (en) 2006-01-26
US20110142801A1 (en) 2011-06-16
EP1539960A2 (en) 2005-06-15
US8057787B2 (en) 2011-11-15
US20080159977A1 (en) 2008-07-03
US20090131318A1 (en) 2009-05-21
WO2004022593A3 (en) 2004-07-15
ATE466085T1 (en) 2010-05-15
US20090053147A1 (en) 2009-02-26
US7650243B2 (en) 2010-01-19
US20080194477A1 (en) 2008-08-14
DE60332358D1 (en) 2010-06-10
US7611700B2 (en) 2009-11-03
US20090123974A1 (en) 2009-05-14
US8105573B2 (en) 2012-01-31
ES2343518T3 (en) 2010-08-03
AU2003263552A8 (en) 2004-03-29
EP1539960B1 (en) 2010-04-28
US20070224665A1 (en) 2007-09-27
US20080274081A9 (en) 2008-11-06
US7998469B2 (en) 2011-08-16
US8114839B2 (en) 2012-02-14
WO2004022593A8 (en) 2007-05-18
AU2003263552A1 (en) 2004-03-29
US20070172459A1 (en) 2007-07-26
WO2004022593A2 (en) 2004-03-18

Similar Documents

Publication Publication Date Title
US7650243B2 (en) Rational evolution of cytokines for higher stability, the cytokines and encoding nucleic acid molecules
US20060020396A1 (en) Rational directed protein evolution using two-dimensional rational mutagenesis scanning
EP2297197B1 (en) Modified erythropoietin (epo)polypeptides that exhibit increased protease resistance and pharmaceutical compositions thereof
US8252743B2 (en) Modified erythropoietin polypeptides and uses thereof for treatment
CA2498284A1 (en) Rational directed protein evolution using two-dimensional rational mutagenesis scanning
EP1807449A2 (en) Modified growth hormones
JP2003501035A (en) Cytokines modified for stability
US20050202438A1 (en) Rational directed protein evolution using two-dimensional rational mutagenesis scanning
CA2441095A1 (en) Modified interferon beta with reduced immunogenicity
EP2742064A1 (en) Derivatives of recombinant proteins, homo-multimers of granulocyte colony-stimulating factor and method of preparation thereof
WO2005003157A2 (en) Interferon variants with improved properties
CA2418913A1 (en) Peptide mimetics
CA2528964A1 (en) Interferon variants with improved properties

Legal Events

Date Code Title Description
EEER Examination request
FZDE Discontinued