CA2579374A1 - Aptamers to von willebrand factor and their use as thrombotic disease therapeutics - Google Patents

Abstract

The invention relates generally to the field of nucleic acids and more particularly to aptamers capable of binding to von Willebrand Factor useful as therapeutics in and diagnositcs of thrombotic diseases and/or other diseases or disorders in which von Willebrand Factor mediated platelet aggregation has been implicated. The invention further relates to materials and methods for the administration of aptamers capable of binding to von Willebrand Factor.

Description

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Aptamers to von Willebrand Factor And their Use As Thrombotic Disease Therapeutics FIELD OF THE INVENTION

[0001] The invention relates generally to the field of nucleic acids and more particularly to aptamers capable of binding to von Willebrand Factor useful as therapeutics in and diagnostics of thrombotic diseases and/or other diseases or disorders in which von Willebrand Factor mediated platelet aggregation is implicated. The invention further relates to materials and methods for the administration of aptamers capable of binding to von Willebrand Factor.

BACKGROUND OF THE INVENTION

[0002] Aptamers are nucleic acid molecules having specific binding affinity to molecules through interactions other than classic Watson-Crick base pairing.

[0003] Aptamers, like peptides generated by phage display or monoclonal antibodies ("mAbs"), are capable of specifically binding to selected targets and modulating the target's activity or binding interactions, e.g., through binding aptamers may block their target's ability to function. Discovered by an in vitro selection process from pools of random sequence oligonucleotides, aptamers have been generated for over 130 proteins including growth factors, transcription factors, enzymes, immunoglobulins, and receptors. A
typical aptamer is 10-15 kDa in size (20-45 nucleotides), binds its target with nanomolar to sub-nanomolar affinity, and discriminates against closely related targets (e.g., aptamers will typically not bind other proteins from the same gene family). A series of structural studies have shown that aptamers are capable of using the same types of binding interactions (e.g., hydrogen bonding, electrostatic complementarities, hydrophobic contacts, steric exclusion) that drive affinity and specificity in antibody-antigen complexes.

[0004] Aptamers have a number of desirable characteristics for use as therapeutics and diagnostics including high specificity and affinity, biological efficacy, and excellent pharmacokinetic properties. In addition, they offer specific competitive advantages over antibodies and other protein biologics, for example:

[0005] 1) S-peed and control. Aptamers are produced by an entirely in vitro process, allowing for the rapid generation of initial leads, including therapeutic leads. In vitro selection allows the specificity and affinity of the aptamer to be tightly controlled and allows the generation of leads, including leads against both toxic and non-immunogenic targets.

[0006] 2) Toxicity and Immuno e~ nicity. Aptamers as a class have demonstrated therapeutically acceptable toxicity and lack of immunogenicity. Whereas the efficacy of many monoclonal antibodies can be severely limited by immune response to antibodies themselves, it is extremely difficult to elicit antibodies to aptamers most likely because aptamers cannot be presented by T-cells via the MHC and the immune response is generally trained not to recognize nucleic acid fragments.

[0007] 3) Administration. Whereas most currently approved antibody therapeutics are administered by intravenous infusion (typically over 2-4 hours), aptamers can be administered by subcutaneous injection (aptamer bioavailability via subcutaneous administration is >80%
in monkey studies (Tucker et al., J. Chromatography B. 732: 203-212, 1999)).
With good solubility (>150 mg/mL) and comparatively low molecular weight (aptamer: 10-50 kDa;
antibody: 150 kDa), a weekly dose of aptamer may be delivered by injection in a volume of less than 0.5 mL. In addition, the small size of aptamers allows them to penetrate into areas of conformational constrictions that do not allow for antibodies or antibody fragments to penetrate, presenting yet another advantage of aptamer-based therapeutics or prophylaxis.
[00081 4) Scalability and cost. Therapeutic aptamers are chemically synthesized and consequently can be readily scaled as needed to meet production demand.
Whereas difficulties in scaling production are currently limiting the availability of some biologics and the capital cost of a large-scale protein production plant is enormous, a single large-scale oligonucleotide synthesizer can produce upwards of 100 kg/year and requires a relatively modest initial investment. The current cost of goods for aptamer synthesis at the kilogram scale is estimated at $500/g, comparable to that for highly optimized antibodies. Continuing improvements in process development are expected to lower the cost of goods to <$100/g in five years.

[0009] 5) Stability. Therapeutic aptamers are chemically robust. They are intrinsically adapted to regain activity following exposure to factors such as heat and denaturants and can be stored for extended periods (>1 yr) at room temperature as lyophilized powders.

THROMBOTIC DISEASE

[0010] During normal, controlled hemostasis, platelets do not adhere to healthy vessels, rather platelets typically adhere to the subendothelium of injured vessels.
Platelet adhesion triggers a series of platelet activation processes which ultimately results in thrombus formation and cessation of bleeding. The von Willebrand Factor ("vWF") is a mediator of platelet adhesion at sites of vascular damage. vWF is a large multi-subunit, multimeric soluble factor mainly produced by vascular endothelial cells. The von Willebrand Factor becomes immobilized on the blood vessel wall via interactions between von Willebrand Factor domain A3 and exposed collagen. Transient interactions of the platelet-receptor glycoprotein Ib ("hereinafter GPIb") and the Al domain of the immobilized von Willebrand Factor facilitates the adhesion and activation of platelets at sites of vascular injury. E.G.
Huizinga et al., Science, 297, 1176 (2002). Accordingly, the von Willebrand factor is pro-thrombotic, playing an important role during hemostasis in facilitating thrombus formation at sites of vascular injury.

[0011] Conversely, the von Willebrand Factor, by the same mechanism, also plays a key role in pathological conditions, such as cardiovascular diseases, involving platelet aggregation and thrombosis formation. Although antithrombotic therapies are currently available there is still a large unmet need for additional therapies. The American Heart Association estimates that more than 60 million people in the United States alone have one or more forms of cardiovascular disease, and that a high proportion of people with cardiovascular disease are at higher risk for arterial thrombosis. S.P. Jackson and S.M. Schoenwaelder, Nature Reviews, 2, 1-12 (2003).

[0012] A significant problem with presently available therapies is that improving efficacy reduces safety. S.P. Jackson and S.M. Schoenwaelder, Nature Reviews, 2, 1-12 (2003).
Accordingly, it would be beneficial to treat or prevent thrombotic disease by preventing platelet aggregation in the vasculature while minimizing bleeding side effects. The present invention provides materials and methods to meet these and other needs.

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 is a schematic representation of the in vitro aptamer selection (SELEX') process from pools of random sequence oligonucleotides.

[0014] Figure 2 is an illustration depicting various PEGylation strategies representing standard mono-PEGylation, multiple PEGylation, and oligomerization via PEGylation.
[0015] Figure 3 is a table listing the amino acid sequences of the von Willebrand Factor domain Al proteins used in the experiments of the invention.

[0016] Figure 4 is a table listing the amino acid sequence of the full length human von Willebrand Factor protein used in the experiments of the invention.

[0017] Figure 5 is an illustration depicting the proposed secondary structure of ARC 1029 (SEQ ID NO 214).

[0018] Figure 6 is a graph of the dot blot binding curves for ARC1029 (SEQ ID
NO 214) to full length vWF and rabbit vWF domain Al. A black box in this table indicates a deletion.
[0019] Figure 7 is a graph of FACS data showing that ARC1029 (SEQ ID NO 214) inhibits binding of human vWF and rabbit vWF Al domain to lyophilized human platelets.
[0020] Figure 8 is a graph of an aggregometer trace showing ARC1029 (SEQ ID NO
214) inhibiting botrocetin induced platelet aggregation over time.

[0021] Figure 9 is a graphical representation of ARC1029 (SEQ ID NO 214) inhibiting botrocetin induced platelet aggregation.

[0022] Figure 10 is an illustration depicting the proposed secondary structure for the SEQ
ID NO 217 wherein C= fC, T= fU, N= any nucleotide but in paired regions it assumes a Watson/Crick base pair, and X= 1 to 4 nucleotides or Nx-Nx-Nx-Nx can be replaced with a PEG spacer.

[0023] Figure 11 is an illustration depicting the sequence alignment for three aptamers of the vWF rRdY SELEXTM Family #1.

[0024] Figure 12 is an illustration depicting the proposed secondary structure for SEQ ID
NO 218.

[0025] Figure 13 is an illustration depicting the proposed secondary structure for SEQ ID
NO 219.

[0026] Figure 14 is an illustration depicting the sequence alignment for 26 aptamers of the vWF DNA SELEXTM 2 Family #1. The black line at the top of the alignment represents the proposed core nucleic acid binding sequence required to bind the von Willebrand Factor target.

[0027] Figure 15 is an illustration depicting the proposed secondary structure for SEQ ID
NO 220. Figure 15B is an illustration depicting the secondary structure of ARC1172 (SEQ ID
NO 222) and which residues are tolerant of 2'-OMe substitution.

[0028] Figure 16 is a table depicting the nucleic acid sequences including any modifications of ARC1029 (SEQ ID NO 214), ARC1115 (SEQ ID NO 221), ARC1172 (SEQ
ID NO 222), and ARC1194 (SEQ ID NO 223) to ARC 1243 (SEQ ID NO 272).

[0029] Figure 17 is a table depicting the nucleic acid sequences including any modifications of ARC1172 (SEQ ID NO 222), ARC1338 (SEQ ID NO 273) to ARC1348 (SEQ ID NO 283) and ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304). A
black block in this table indicates a deletion. An "s" preceding a nucleotide indicator (e.g. T or dA) indicates a phosphorothioate substitution in the phosphate backbone 5' to the indicated nucleotide.

[0030] Figure 18 is a table depicting the nucleic acid sequences including any modifications of ARC1172 (SEQ IDNO 222), ARC1524 (SEQ IDNO 305) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317) and ARC1759 (SEQ ID NO 318). A black block in this table indicates a deletion.

[0031] Figure 19 is an illustration of the secondary structures of ARC1368 (SEQ ID NO
291) and ARC1534 (SEQ ID NO 315).

[0032] Figure 20 is a graph depicting the clotting time, in the PFA-100 assay, for human whole blood treated with ARC1368 (SEQ ID NO 291) or ARC1525 (SEQ ID NO 306) as a function of aptamer concentration.

I

[0033] Figure 21 is a graph depicting occlusion time, in a PFA-100 assay, of human whole blood treated with IntegrilinTM, ReoProTM or ARC1368 (SEQ ID NO 291), as a function of drug concentration.

[0034] Figure 22 is a graph depicting percent inhibition, in BIPA, of human PRP, treated with IntegrilinTM, ReoProTM or ARC1368 (SEQ ID NO 291), as a function of drug concentration.

[0035] Figure 23 is a graph depicting percent inhibition, in AIPA, of human PRP, treated with IntegrilinTM, ReoProTM or ARC1368 (SEQ ID NO 291), as a function of drug concentration.

[0036] Figure 24 is a graph depicting percentage of full length ARC1172 (SEQ
ID NO
222) or ARC1368 (SEQ ID NO 291), detected in human plasma, as a function of time.
[0037] Figure 25 is a graph depicting primate plasma aptamer concentration (determined using Oligreen analysis) plotted as a fiuiction of time following administration of ARC 1368 (SEQ ID NO 291), ARC1779 (SEQ ID NO 320) or ARC1780 (SEQ ID NO 321).

[0038] Figure 26 is a graph showing the time points on the horizontal axis at which blood for testing was drawn from three cynoniolgus macaques, ARC1779 (SEQ ID NO 320) plasma concentration (in nM) along the top third of the vertical axis, PFA-100 closure time (in seconds) on the middle third of the vertical axis, and the template or cutaneous bleeding time (in minutes) on the bottom third of the vertical axis. The average from all three animals for plasma aptamer concentration, PFA- 100 closure time and cutaneous bleeding time is plotted on the top third, middle third and bottom third of the graph, respectively.

[0039] Figure 27 is a table showing the cutaneous bleeding time (CBT) in minutes, raw BIPA data and PFA-100 closure time (sec) at various time points, shown in column 1, relative to ARC1779 (SEQ ID NO 320) dosing in three different cynomolgus macaques.

[0040] Figure 28 is a graph showing the average PFA-100 closure time at various time points following ARC 1779 (SEQ ID NO 320) dosing of C. macaques.

[0041] Figure 29 is a graph showing the average bleeding time of the three (SEQ ID NO 320) treated macaques taken at various time points following dosing.

[0042] Figure 30 is a graph correlating the average bleeding time in ARC 1779 (SEQ ID
NO 320) treated C. macaques (left vertical axis) to the PFA-100 closure time.

[0043] Figure 31 is a schematic depicting the blood sample collection schedule used in the assessment of ARC 1779 (SEQ ID NO 320) in the cynomolgus monkey electrolytic thrombosis model.

[0044] Figure 32 is graph of ARC1779 (SEQ ID NO 320) plasma concentration (vertical axis) as a function of time in each cynomolgus monkey of treatment group 3 tested in the electrolytic thrombosis model.

[0045] Figure 33 is a graph of the time to occlusion of the right (hatched bar) or left carotid artery (indicated by a solid bar) in each cynomolgus macaque from each treatment group tested in the cynomolgus monkey electrolytic thrombosis model. Bar pairs 1, 8 and 9 indicate treatment group 1(vehicle only) Bar pairs 2, 10, 11, 12 and 13 indicates treatment groups 2 and 4 (ReoPro). Bar pairs 3 to 7 indicate treatment group 3(1000nM
aptamer plasma concentration target group). Bar pairs 20, 22, 16, and 18 indicate treatment group 7 (750 nM plasma aptamer concentration target group) . Bar pairs 19, 21, 23 and 24 indicate treatment group 6 (500 nM plasma aptamer concentration target group). Bar pairs 15 and 17 indicate treatment group 5 (300 nM plasma aptamer concentration target group) [0046] Figure 34 is a graph showing the cutaneous bleed time in minutes (vertical axis) of the various cynomolgous treatment groups in the electrical injury model taken at the time points shown on the horizontal axis.

SUMMARY OF THE INVENTION

[0047] ' The present invention provides materials and methods for the treatment of thrombotic disorders involving von Willebrand Factor mediated platelet aggregation.

[0048] The present invention provides aptamers that specifically bind to a von Willebrand Factor target. In some embodiments, the von Willebrand Factor target is human von Willebrand Factor. In some embodiments, the von Willebrand Factor target is a variant of human von Willebrand Factor that performs a biological function that is essentially the same as a function of human von Willebrand Factor. In some embodiments, the biological function of the von Willebrand Factor target or variant thereof is to mediate platelet aggregation. In some embodiments, the variant of the human von Willebrand Factor target has substantially the same structure and substantially the same ability to bind an aptamer of the invention as that of human von Willebrand Factor. In some embodiments, the vWF target is a non-human von Willebrand Factor. In some embodiments, the aptanier of the invention binds the von Willebrand Factor target or a variant thereof that comprises an amino acid sequence which is at least 75%, 80%, 90% or 95% identical to SEQ ID NO 7 (Figure 4). In one embodiment, the von Willebrand Factor target comprises the amino acid sequence of SEQ ID
NO 7.

[0049] The terms "sequence identity" or " % identity" in the context of two or more nucleic acid or protein sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence, as measured using one of the following sequence comparison algorithms or by visual inspection. For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared.
When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv.
Appl. Math. 2:
482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J Mol.
Biol. 48:
443 (1970), by the search for similarity method of Pearson & Lipman, Proc.
Nat'l. Acad. Sci.
USA 85: 2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally, Ausubel, F. M. et al., Current Protocols in Molecular Biology, pub. by Greene Publishing Assoc. and Wiley-Interscience (1987).

[0050] One example of an algorithm that is suitable. for determining percent sequence identity is the algorithm used in the basic local alignment search tool (hereinafter "BLAST"), see, e.g. Altschul et al., J Mol. Biol. 215: 403-410 (1990) and Altschul et al., Nucleic Acids Res., 15: 3389-3402 (1997). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (hereinafter "NCBI"). The default parameters used in determining sequence identity using the software available from NCBI, e.g., BLASTN (for nucleotide sequences) and BLASTP (for amino acid sequences) are described in McGinnis et al., Nucleic Acids Res., 32: W20-W25 (2004). In a preferred embodiment, percent identity is determined using the BLAST implemented algorithm of Altschul et al., and the default parameters of McGinnis et al., which herein may be referred to as BLAST percent identity.

[0051] In one embodiment, the vWF aptamer of the invention comprises a dissociation constant for human von Willebrand Factor or a variant thereof, of about 100 nM
or less, preferably 50 nM or less, preferably 10 nM or less, preferably 5 nM or less, preferably 1 nM
or less, and more preferably 500 pM or less. The dissociation constant may be determined by dot blot assay using a multi-point titration and fitting the equation y=
(max/(1+K/protein))+yint as described in Example 1, below.

[0052) The present invention also provides an aptamer that specifically binds to a von Willebrand Factor domain Al target. In some embodiments, the von Willebrand Factor domain Al target is a human von Willebrand Factor domain Al target. In some embodiments, the human von Willebrand Factor domain Al target is a variant of human von Willebrand Factor domain Al that performs a biological function that is essentially the same as a function of human von Willebrand Factor domain Al. In some embodiments, the biological function of von Willebrand Factor domain Al or a variant thereof is to bind to platelets. In some embodiments, the variant of human von Willebrand Factor domain target has substantially the same structure and substantially the same ability to bind said aptamer as that of human von Willebrand Factor domain Al. In other embodiments, the von Willebrand Factor domain Al target is non-human von Willebrand Factor domain Al target, e.g. a rabbit or non-human primate von Willebrand Factor domain Al target.

[0053] In some embodiments, the von Willebrand Factor domain Al target of the invention comprises an amino acid sequence which is at least 75%, 80%, 90% or 95%
identical to any one of the sequences selected from the group consisting of:
SEQ ID NOS 4 to 6. In a preferred embodiment, the von Willebrand Factor domain Al target comprises any one of the amino acid sequences selected from the group consisting: of SEQ ID
NOS 4 to 6.
[0054] In one embodiment, the vWF aptamer of the invention comprises a dissociation constant for human von Willebrand Factor domain Al or a variant thereof, of about 100 nM
or less, preferably 50 nM or less, preferably 10 nM or less, preferably 5 nM
or less, preferably 1 nM or less, and more preferably 500 pM or less. In another embodiment, the aptamer of the invention comprises a dissociation constant for non- human von Willebrand Factor domain Al or a variant thereof, of about 100 nM or less, preferably 50 nM or less, preferably 10 nM or less, preferably 5 nM or less, preferably 1nM or less, and more preferably 500 pM or less. The dissociation constant may be determined by dot blot assay using a multi-point titration and fitting the equation y=
(max/(l+K/protein))+yint as described in Example 1, below.

[0055] In some embodiments, the invention provides an aptamer that specifically binds to a von Willebrand Factor full length target. In some embodiments, the invention provides an aptamer that specifically binds to a von Willebrand Factor full length target and a von Willebrand Factor domain Al target. In some embodiments, the von Willebrand Factor full length target is a human von Willebrand target or variant thereof. In other embodiments, the von Willebrand Factor full length target is a non-human von Willebrand target or variant thereof. In some embodiments, the von Willebrand Factor domain Al target is a non-human von Willebrand Factor domain Al target or variant thereof. In other embodiments, the von Willebrand Factor domain Al target is a human von Willebrand Factor domain Al target or variant thereof. In some embodiments, the von Willebrand Factor full length target or domain Al target is selected from the group consisting of: a rabbit, guinea pig, monkey, dog, sheep, mouse and rat, von Willebrand Factor full length or domain Al target. In some embodiments, the von Willebrand Factor full length target and von Willebrand Factor domain Al target to which the aptamer of the invention specifically binds, are from different species.

[0056] The present invention provides aptamers against a von Willebrand Factor target that are ribonucleic acid or deoxyribonucleic acid or mixed ribonucleic acid and deoxyribonucleic acid. Aptamers of the invention may be single stranded ribonucleic acid or deoxyribonucleic acid or mixed ribonucleic acid and deoxyribonucleic acid. In some embodiments, the aptamer of the invention comprises at least one chemical modification. In some embodiments, the chemical modification is selected from the group consisting of: a chemical substitution at a sugar position; a chemical substitution at a phosphate position; and a chemical substitution at a base position, of the nucleic acid. In other embodiments, the chemical modification is selected from the group consisting of: incorporation of a modified nucleotide, 3' capping, conjugation to a high molecular weight, non-immunogenic compound, conjugation to a lipophilic compound, and incorporation of phosphorothioate into the phosphate back bone. In a preferred embodiment, the non-immunogenic, high molecular weight compound is polyalkylene glycol, more preferably polyethylene glycol.

[0057] In some embodiments of the present invention, an aptamer, e.g. a von Willebrand Factor aptamer, that binds specifically to a target wherein the aptamer comprises a nucleotide sequence having no more than four, no more than three, no more than two or no more than one phosphorothioate backbone modifications, and the aptamer has a binding affinity for the target wherein the binding affinity is increased relative to a second aptamer having the same nucleotide sequence but lacking phosphorothioate back bone modification is provided. In some embodiments, the target is a protein or peptide not having the known function of binding nucleic acid, particularly not have the known primary function of binding nucleic acid.

[0058] In some embodiments, the aptamer of the invention modulates a function of any one of the group consisting of: the von Willebrand Factor target, the von Willebrand Factor domain Al target and a variant of either target. In some embodiments, the modulated function is platelet aggregation mediation. In some embodiments, the aptamer of the invention inhibits von Willebrand Factor mediated platelet aggregation in vivo. In other embodiments, the aptamer of the invention prevents binding of any one of the group consisting of: the von Willebrand Factor target, the von Willebrand Factor domain Al target and a variant thereof, to a platelet. In other embodiments, the aptamer of the invention prevents binding of any one of the group consisting of: the von Willebrand Factor target, the von Willebrand Factor domain Al target and a variant of either target, to a platelet receptor protein. In yet other embodiments, the aptamer of the invention prevents binding of a.ny one of the group consisting of: the von Willebrand Factor target, the von Willebrand Factor domain Al target and a variant of either target, to the platelet receptor protein GPIb. In some embodiments, the aptamer of the invention prevents vWF Factor mediated platelet aggregation while not significantly increasing bleeding time. In some embodiments, a non-significant increase in bleeding time is less than 15, minutes, preferably less than 10 minutes, more preferably less than 5 minutes, and in some embodiments, less than 3 minutes relative to the bleeding time of a subject not treated with the aptamer of the invention. In some embodiments the bleeding time is determined by cutaneous (or template) bleeding time.

[00591 In some embodiments, the aptamer of the invention has substantially the same ability to bind any one of the group consisting of: the von Willebrand Factor target, the von Willebrand Factor domain Al target and a variant thereof, as that of an aptamer selected from the group consisting of: SEQ ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS
98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO
177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ
ID NO 198, SEQ ID NO 201, SEQ 1D NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1115 (SEQ ID NO 221), ARC1172 (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO
323). In other embodiments, the aptamer of the invention has substantially the same structure and substantially the same ability to bind of any one of the group consisting of: the von Willebrand Factor target, the von Willebrand Factor domain Al target and a variant thereof, as that of an aptamer selected from the group of sequences consisting of: SEQ
ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ
ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID
NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO
205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1115 (SEQ ID NO 221), ARC1172 (SEQ
ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ
ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ
ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ

ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID
NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ
ID NO 322) to ARC1885 (SEQ ID NO 323). In yet other embodiments, the aptamer of the invention is selected from the group consisting of: SEQ ID NOS 11 to 50, SEQ
ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID
NO
174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO
189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ ID NO 208, SEQ
IDNOS 212-214, ARC1115 (SEQ IDNO 221), ARC1172 (SEQ IDNO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323).

[0060] In a particular embodiment, the aptamer of the invention comprises the primary nucleic acid sequence of ARC1172 (SEQ ID NO 222) or ARC1115 (SEQ ID NO 221) or ARC1029 (SEQ ID NO 214) or SEQ ID NO 220 and does not comprise a 2'-O-Me substituted nucleotide at position 6 to 9, 20, 22, 24 to 27, 30 or 32 to 33.
In another embodiment, the aptamer of the invention comprises the nucleic acid sequence of ARC1172 (SEQ ID NO 222) or ARC1115 (SEQ ID NO 221) or ARC1029 (SEQ ID NO 214) or SEQ
ID NO 220 and comprises a 2'-O-Me substituted nucleotide at one or more positions, at 5 or more positions, at 10 or more positions , at 15 or more positions, or at 20 or more positions.
In another embodiment, the aptamer of the invention comprises the nucleic acid sequence of ARC1172 (SEQ ID NO 222) or ARC1115 (SEQ ID NO 221) or ARC1029 (SEQ ID NO 214) or SEQ ID NO 220 and comprises a 2'-O-Me substituted nucleotide at all positions selected from the group consisting of: position 1 to 5, position 10 to 19, position 21, position 23, position 28 to 29, and position 34 to 41 wherein the position numbering starts at the 5' end of the nucleic acid sequence.

[0061] In a particular embodiment of the invention, an aptamer comprising a nucleotide sequence selected from the group consisting of: SEQ ID NO 95 to 97 and SEQ ID
NO 217 to 219 wherein: Y = C or T/U, R= A or G, N = any nucleotide but in paired regions it assumes a Watson/Crick base pair; and X = 1 to 4, is provided. In another embodiment, an aptamer of the invention is selected from the group consisting of: SEQ ID NO 217 and 220 wherein NX
Nx NX NX , or N(3_10) may be replaced with a PEG linker. In yet another embodiment, an aptamer of the invention is selected from the group consisting of SEQ ID NOs 325-327, where Y= C or T, R= A or G.

[0062] In a particular embodiment, the aptamer that binds specifically to von Willebrand Factor comprises a three way helix junction secondary structure motif having the consensus sequence structure of SEQ ID NO 220 depicted in Figure 15. In another particular embodiment, the aptamer having the three way helix junction comprises the consensus structure depicted in Figure 19 A(ARC1368 (SEQ ID NO 291)). While in another embodiment, the aptamer having the three way helix junction comprises the consensus structure depicted in Figure 19 B (ARC1534 (SEQ ID NO 315)).

[0063] In another embodiment, the aptamer that binds specifically to von Willebrand Factor comprises a stem-loop-stem-loop secondary structure motif having the consensus sequence structure of SEQ ID NO 217 depicted in Figure 10. In another embodiment, the aptamer that specifically binds to von Willebrand Factor comprises the stem-loop-loop secondary structure motif having the consensus sequence structure of SEQ ID NO

depicted in Figure 12. In another embodiment, the aptamer that binds specifically to von Willebrand Factor comprises a three way junction secondary structure motif with two helical stems and a stem- loop of SEQ ID NO 19 as depicted in Figure 13. In some embodiments, the secondary structure motif of the aptamer of the invention is predicted by:
RNAstructure, Version 4.1 (Mathews, D.H.; Disney, M.D.; Childs, J.L.; Schroeder, S.J.;
Zuker, M.; and Turner, D.H., "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure," 2004. Proceedings of the National Academy of Sciences, US, 101, 7287-7292).

[0064] In a preferred embodiment, an aptamer that specifically binds to a human von Willebrand Factor target and to a non-human von Willebrand Factor target is provided.

[0065] In one embodiment, an aptamer comprising the following structure or a salt thereof is provided:

ii H
H3C(OCH2CH2),f-O-C-N~~~~~-5' Aptamer 3' wherein: n is about 454 ethylene oxide units (PEG = 20 kDa) - is a linker, and the aptamer is an anti-vWF aptamer of the invention. In a particular embodiment, the aptamer comprises the following nucleic acid sequence or fragment thereof: mGmCmGmUdGdCdAniGmUmGmCmCmUmUmCmGmGmCdCmG-s-dTmGdCdGdGTmGmCdCmUdCdCmGmUdCmAmCmGmC-3T (SEQ ID NO 291) wherein m refers to a 2'-OMe substitution, the "d" refers to a deoxy nucleotide, the "s" refers to a phosphorothioate substitution and "3T" refers to an inverted deoxy thymidine.
In another embodiment, the aptamer comprises the following nucleic acid sequence or fragment thereof:
dGdGdCdGdTdGdCdAdGdTdGdCdCdTdTdCdGdGdCdCdGdTdGdCdGdGdTdGdCdCdTdC
dCdGdTdCdAdCdGdCdC-3T (SEQ ID NO 323) wherein "d" refers to a deoxy nucleotide and "3T" refers to an inverted deoxy thymidine. In some embodiments of this aspect of the invention the linker is an alkyl linker. In particular embodiments, the alkyl linker comprises 2 to 18 consecutive CHa groups. In preferred embodiments, the alkyl linker comprises 2 to 12 consecutive CH2 groups. In particularly preferred embodiments the alkyl linker comprises 3 to 6 consecutive CH2 groups.

[0066] In a particular embodiment, the aptamer of the invention comprises the following structure:

~~'o. ,o H3C(OCH2CHz)~ O-C-N P, H - 0 I 0-5' Aptamer 3' wherein: n is about 454 ethylene oxide units (PEG = 20 kDa), and the aptamer nucleic acid sequence is an anti-vWF aptamer of the invention.
In a particular embodiment, the aptamer comprises the following nucleic acid sequence or fragment thereof mGmCmGmUdGdCdAmGmUmGmCmCmUmUmCmGmGmCdCmG-s-dTmGdCdGdGTmGmCdCmUdCdCmGmUdCmAmCmGmC-3T (SEQ ID NO 291) wherein m refers to a 2'-OMe substitution, the "d" refers to a deoxy nucleotide, the "s" refers to a phosphorothioate substitution and "3T" refers to an inverted deoxy thymidine.
In another embodiment, the aptamer comprises the following nucleic acid sequence or fragment thereof:
dGdGdCdGdTdGdCdAdGdTdGdCdCdTdTdCdGdGdCdCdGdTdGdCdGdGdTdGdCdCdTdC
dCdGdTdCdAdCdGdCdC-3T (SEQ ID NO 323) wherein "d" refers to a deoxy nucleotide and "3T" refers to an inverted deoxy thymidine.

[0067] In another embodiment, a salt of an aptamer of the invention is provided. In a particular embodiment, the following salt of an aptamer is provided:
N-(methoxy-polyethyleneglycol)-6-aminohexylyl-(l ->5' )-2' -OMe-guanylyl-(3' ->5' )-2' -OMe-cytidylyl-(3' ->5' )-2' -OMe-guanylyl-(3' ->5' )-2' -OMe-uracylyl-(3' ->5')-2'-deoxyguanylyl-(3' -3 5')-2'-deoxycytidylyl-(3' ->5')-2'-deoxyadenylyl-(3' ->5' )-2' -OMe-guanylyl-(3' ->5' )-2' -OMe-uracylyl-(3' ->5' )-2' -OMe-guanylyl-(3' ->5')-2'-OMe-cytidylyl-(3' ->5')-2'-OMe-cytidylyl-(3' ->5')-2'-OMe-uracylyl-(3' ->5' )-2' -OMe-uracylyl-(3' ->5' )-2' -OMe-cytidylyl-(3' ->5')-2' -OMe-guanylyl-(3' ->5')-2'-OMe-guanylyl-(3' ->5')-2'-OMe-cytidylyl-(3' ->5')-2'-deoxycytidylyl-(3' ->5' )-2' -OMe-P-thioguanylyl-(3' ->5' )-2' -deoxythymidylyl-(3' ->5')-2' -OMe-guanylyl-(3' -3 5')-2'-deoxycytidylyl-(3' ->5')-2'-deoxyguanylyl-(3' ->5')-2'-deoxyguanylyl-(3' ->5' )-2' -deoxythymidylyl-(3' ->5')-2' -OMe-guanylyl-(3' ->5' )-2' -OMe-cytidylyl-(3' ->5' )-2' -deoxycytidylyl-(3' ->5' )-2' -OMe-uracylyl-(3' ->5' )-2' -deoxycytidylyl-(3' ->5' )-2' -deoxycytidylyl-(3' ->5' )-2' -OMe-guanylyl-(3' ->5' )-2' -OMe-uracylyl-(3' ->5' )-2' -deoxycytidylyl-(3' -3 5' )-2' -OMe-adenylyl-(3' ->5')-2' -OMe-cytidylyl-(3' ->5' )-2' -OMe-guanylyl-(3' ->5' )-2' -OMe-cytidylyl-(3' ->5')-(3'->3')-2'-deoxythymidine, 40-sodium salt, wherein the methoxy polyethyleneglycol comprises a molecular weight of 20 kDa.

[0068] In yet another embodiment, a pharmaceutical composition comprising a therapeutically effective amount of any one of the aptamers of the invention or a salt thereof and a pharmaceutically acceptable carrier or diluent is provided. In a particular embodiment, the pharmaceutical composition of the invention comprises ARC 1779. In a more particular embodiment the pharmaceutical composition comprises an aptamer having the following structure or a salt thereof:

O
H3C(OCH2CH2)ri O-C-NF.
H - O 0-5 ' Aptamer 3' wherein: n is about 454 ethylene oxide units (PEG = 20 kDa), and the aptamer comprises the following nucleic acid sequence or fragment thereof:
mGmCmGmUdGdCdAmGmUmGmCmCmUmUmCmGmGmCdCmG-s-dTmGdCdGdGTmGmCdCmUdCdCmGmUdCmAmCmGmC-3T (SEQ ID NO 291) wherein m refers to a 2'-OMe substitution, the "d" refers to a deoxy nucleotide, the "s" refers to a phosphorothioate substitution and "3T" refers to an inverted deoxy thymidine.

[0069] The invention provides a method of treating, preventing or ameliorating a disease mediated by von Willebrand Factor, comprising administering an aptamer or a pharmaceutical composition of the invention to a vertebrate, preferably a mammal, more preferably a human.
In some embodiments, the disease to be treated, prevented or ameliorated is selected from the group consisting of: essential thrombocytopenia, thrombotic thrombocopenic purpura ("TTP"), Type IIb von Willebrand's disease, pseudo von Willebrand disease, peripheral artery disease, e.g. peripheral arterial occlusive disease, unstable angina, angina pectoris, arterial thrombosis, atherosclerosis, myocardial infarction, acute coronary syndrome, atrial fibrillation, carotid stenosis, cerebral infarction, cerebral thrombosis, ischemic stroke, and transient cerebral ischemic attack. In some embodiments, the pharmaceutical composition of the invention is administered prior to/during and/or after dialysis, CABG
surgery, percutaneous coronary intervention or heart valve replacement.

[00701 The length of the in vivo half life of the aptamer of the invention may vary depending on the disease to be treated. ameliorated and/or prevented. For example, in some embodiments in which chronic aptamer administration is desirable due to the characteristics of the disease to be treated, ameliorated and/or prevented, the aptamer of the invention may comprise a relatively long half life, e.g. a half life greater than five hours in humans.

[0071] In other embodiments, the aptamer of the invention comprises a desired functional half life or duration of effect. Functional half life or duration of effect is a function of both pharmacokinetic half life and pharmacodynamic activity of the aptamer. In some embodiments, the desired human functional half-life or duration of effect for an anti-vWF
therapeutic aptamer is on the order of 1-5 hours for the proposed indications elective PCI and ACS. Aptamers with such kinetics represent a balance between the dual objectives of (1) minimizing total aptamer dose (achieved with longer half-life) and (2) allowing rapid normalization of platelet function following cessation of treatment (achieved with shorter half-life). In some embodiments, rapid normalization of platelet function is important as it allows clinicians the option of rapid intervention (e.g. CABG) should a patient fail to stabilize in response to treatment.

[0072] Accordingly, in some embodiments the aptamer for use in the methods of treatment and/or pharmaceutical compositions of the invention comprises a relatively short functional half life, e.g. a functional half life in humans of about 1 to 5 hours. In some embodiments, the functional half life in humans is at least 1 hour, at least 2 hours, at least 3 hours, at least 4 hours and not more than about 5 hours. In some embodiments, the functional half life or duration of effect is about the same as the distribution half life T 1i2a, of the aptamer.

[0073] In some embodiments, the aptamer of the invention comprising the short functional half life in humans is for use in methods and compositions for the treatment, amelioration or prevention of diseases that potentially may require surgical intervention, such as acute coronary syndrome. In some embodiments, the aptamer of this aspect of the invention comprising a short functional half life in humans is conjugated to a PEG, e.g. a 5, or 20 kDa PEG. In some embodiments, the aptamer of this aspect of the invention comprising a short half life in humans is ARC 1779.

[0074] The invention also provides a diagnostic method comprising contacting an aptamer of the invention with a composition suspected of comprising von Willebrand Factor, von Willebrand Factor domain Al or a variant thereof and detecting the presence or absence of von Willebrand Factor, von Willebrand Factor domain Al or a variant thereof.
In some embodiments, the diagnostic method is for use in vitro while in other embodiments, the diagnostic method is for use in vivo.

[0075] The invention also provides a method for identifying an aptamer that blocks a biological function in vivo comprising:

a) preparing a candidate mixture of single-stranded nucleic acids;

b) contacting the candidate mixture with both a full length protein target and a domain of the full length protein target;

c) partitioning the nucleic acids having an increased affinity for the full length protein target or the protein target domain; and d) amplifying the increased affinity nucleic acids, in vitro, to yield a protein target specific enriched aptamer mixture.

[0076] In some embodiments, the identification method fixrther comprises;

e) contacting the target specific enriched aptamer mixture with the full length protein target;

f) partitioning the nucleic acids having an increased affinity for the full length protein target; and g) amplifying the increased affinity nucleic acids, in vitro; to yield a target specific enriched aptamer mixture;

h) contacting the target specific enriched aptamer mixture with the protein target domain;

i) partitioning the nucleic acids having an increased affinity for the protein target domain; and j) amplifying the increased affinity nucleic acids, in vitro, to yield a protein target specific enriched aptamer mixture.

[0077] In some embodiments, the identification method further comprises selecting an aptamer that blocks a biological function of the full length protein target in vivo while in other embodiments, the method further comprises selecting an aptamer that blocks a biological function of the protein target domain in vivo. In some embodiments of the identification method of the invention, the full length protein target is from a first species and the protein target domain is from a second species. In further embodiments of the identification method of the invention, the method further comprises selecting an aptamer capable of binding to both protein targets of both the first and second species, preferably selecting an aptamer that blocks a biological function of the protein target in both the first and second species. In some embodiments of the identification method of the invention, the full length target protein target is von Willebrand Factor. In some embodiments of the identification method of the invention, the full length target protein target is von Willebrand Factor, wherein it is preferred that the selected aptamer blocks von Willebrand Factor mediated platelet aggregation.
In some embodiments the protein target domain is von Willebrand Factor domain Al.The invention also provides an aptamer identified by the identification method of the invention.

[0078] In some embodiments, the invention also provides an aptamer that specifically binds to von Willebrand Factor comprising a primary nucleic acid sequence at least 80%
identical, particularly at least 90% identical, and more particularly at least 95% identical to any one of the primary nucleic acid sequences selected from the group consisting of SEQ ID
NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID
NO
169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO
183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ
ID NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1 115 (SEQ ID NO 221), ARC 1172 (SEQ ID NO 222), ARC 1194 (SEQ ID NO 223) to ARC 1240 (SEQ ID NO
269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), ARC1779 to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ
ID NO 322) to ARC1885 (SEQ ID NO 323). In some embodiments, the % sequence identity of the aptamers of the invention is BLAST sequence identity.

[0079] In another embodiment, the aptainer of the invention comprises a nucleic acid sequence having chemical modifications that including chemical modifications is at least 80%
identical, particularly 90% identical, and more particularly at least 95%
identical to any one of the nucleic acid sequences selected from the group consisting of: SEQ ID NOS
11 to 50, SEQ
ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO
172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO
186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ
ID NO 208, SEQ ID NOS 212-214, ARC 1115 (SEQ ID NO 221), ARC 1172 (SEQ ID NO
222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO
273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO
304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO
316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO

318), ARC1779 to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323).

[0080] In yet another embodiment, the invention provides an aptamer that upon binding a von Willebrand Factor target modulates a von Willebrand Factor function, preferably in vivo and comprises a sequence of 30 contiguous nucleotides that are identical to a sequence of 30 contiguous nucleotides comprised in any one of the sequences selected from the group of:
SEQ ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ
ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID
NO 201, SEQ ID NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1115 (SEQ ID NO
221), ARC1172 (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO
269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO
284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO
307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO
319), ARC1759 (SEQ ID NO 318), ARC1779 to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323). In yet another embodiment, the aptamer of the invention upon binding a von Willebrand Factor target modulates a von Willebrand Factor function, preferably in vivo, and comprises 20 contiguous nucleotides that are identical to a sequence of 20 contiguous nucleotides in the unique sequence region of any one of the aptamer selected from the group of: SEQ ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID
NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ
ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID
NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ ID NO 208, SEQ ID NOS
212-214, ARC 1115 (SEQ ID NO 221), ARC 1172 (SEQ ID NO 222), ARC 1194 (SEQ ID
NO
223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO
281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO
305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO
317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), ARC1779 to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323). In yet another embodiment, the aptamer of the invention upon binding a von Willebrand Factor target modulates a von Willebrand Factor function, preferably in vivo, and comprises 8 contiguous nucleotides that are identical to a sequence of 8 contiguous nucleotides in the unique sequence region of any one of the aptamer selected from the group of:
SEQ ID NOS
11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO
169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ
ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID
NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1115 (SEQ ID NO 221), ARC1172 (SEQ ID NO 222) (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO
269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO
284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO
307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO
319), ARC1759 (SEQ ID NO 318), ARC1779 to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323). In yet another embodiment, the aptamer of the invention upon binding a von Willebrand Factor target modulates a von Willebrand Factor function, preferably in vivo, and comprises 4 contiguous nucleotides that are identical to a sequence of 4 contiguous nucleotides in the unique sequence region of any one of the aptamer selected from the group of: SEQ ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID
NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ
ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID
NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ ID NO 208, SEQ ID NOS
212-214, ARC1115 (SEQ ID NO 221), ARC1172 (SEQ ID NO 222) (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), ARC1779 to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323).

DETAILED DESCRIPTION OF THE INVENTION

[0081] The details of one or more embodiments of the invention are set forth in the accompanying description below. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. Other features, objects, and advantages of the invention will be apparent from the description. In the specification, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the case of conflict, the present Specification will control.

THE SELEXTM METHOD

[00821 A suitable method for generating an aptamer is with the process entitled "Systematic Evolution of Ligands by Exponential Enrichment" ("SELE)TM") generally depicted in Figure 1. The SELEXTM process is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described in, e.g., U.S.
patent application Ser. No. 07/536,428, filed Jun. 11, 1990, now abandoned, U.S. Pat. No.
5,475,096 entitled "Nucleic Acid Ligands", and U.S. Pat. No. 5,270,163 (see also WO
91/19813) entitled "Nucleic Acid Ligands". Each SELEXTM-identified nucleic acid ligand, i.e., each aptamer, is a specific ligand of a given target compound or molecule. The SELEXTM
process is based on the unique insight that nucleic acids have sufficient capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with virtually any chemical compound, whether monomeric or polymeric. Molecules of any size or composition can serve as targets.

[0083] SELEXTM relies as a starting point upon a large library or pool of single stranded oligonucleotides comprising randomized sequences. The oligonucleotides can be modified or unmodified DNA, RNA, or DNA/RNA hybrids. In some examples, the pool comprises 100%
random or partially random oligonucleotides. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed sequence and/or conserved sequence incorporated within randomized sequence. In other examples, the pool comprises random or partially random oligonucleotides containing at least one fixed and/or conserved sequence at its 5' and/or 3' end which may comprise a sequence shared by all the molecules of the oligonucleotide pool. Fixed sequences are sequences common to oligonucleotides in the pool which are incorporated for a preselected purpose, such as CpG motifs described further below, hybridization sites for PCR primers, promoter sequences for RNA
polymerases (e.g., T3, T4, T7, and SP6), restriction sites, or homopolymeric sequences, such as poly A or poly T tracts, catalytic cores, sites for selective binding to affinity columns, and other sequences to facilitate cloning and/or sequencing of an oligonucleotide of interest. Conserved sequences are sequences, other than the previously described fixed sequences, shared by a number of aptamers that bind to the same target.

[0084] The oligonucleotides of the pool preferably include a randomized sequence portion as well as fixed sequences necessary for efficient amplification. Typically the oligonucleotides of the starting pool contain fixed 5' and 3' terminal sequences which flank an internal region of 30-50 random nucleotides. The randomized nucleotides can be produced in a number of ways including chemical synthesis and size selection from randomly cleaved cellular nucleic acids. Sequence variation in test nucleic acids can also be introduced or increased by mutagenesis before or during the selection/amplification iterations.

[0085] The random sequence portion of the oligonucleotide can be of any length and can comprise ribonucleotides and/or deoxyribonucleotides and can include modified or non-natural nucleotides or nucleotide analogs. See, e.g., U.S. Patent No.
5,958,691; U.S. Patent No. 5,660,985; U.S. Patent No. 5,958,691; U.S. Patent No. 5,698,687; U.S.
Patent No.
5,817,635; U.S. Patent No. 5,672,695, and PCT Publication WO 92/07065. Random oligonucleotides can be synthesized from phosphodiester-linked nucleotides using solid phase oligonucleotide synthesis techniques well known in the art. See, e.g., Froehler et al., Nucl.
Acid Res. 14:5399-5467 (1986) and Froehler et al., Tet. Lett. 27:5575-5578 (1986). Random oligonucleotides can also be synthesized using solution phase methods such as triester synthesis methods. See, e.g., Sood et al., Nucl. Acid Res. 4:2557 (1977) and Hirose et al., Tet. Lett., 28:2449 (1978). Typical syntheses carried out on automated DNA
synthesis equipment yield 1014-1016 individual molecules, a number sufficient for most SELEXTM
experiments. Sufficiently large regions of random sequence in the sequence design increases the likelihood that each synthesized molecule is likely to represent a unique sequence.

[0086] The starting library of oligonucleotides may be generated by automated chemical synthesis on a DNA synthesizer. To synthesize randomized sequences, mixtures of all four nucleotides are added at each nucleotide addition step during the synthesis process, allowing for random incorporation of nucleotides. As stated above, in one embodiment, random oligonucleotides comprise entirely random sequences; however, in other embodiments, random oligonucleotides can comprise stretches of nonrandom or partially random sequences.
Partially random sequences can be created by adding the four nucleotides in different molar ratios at each addition step.

[0087] The starting library of oligonucleotides may be either RNA or DNA, or substituted RNA or DNA. In those instances where an RNA library is to be used as the starting library it is typically generated by synthesizing a DNA library, optionally PCR
amplifying, then transcribing the DNA library in vitro using T7 RNA polymerase or modified T7 RNA polymerases, and purifying the transcribed library. The RNA or DNA
library is then mixed with the target under conditions favorable for binding and subjected to step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. More specifically, starting with a mixture containing the starting pool of nucleic acids, the SELEXTM method includes steps of: (a) contacting the mixture with the target under conditions favorable for binding; (b) partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules; (c) dissociating the nucleic acid-target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids; and (e) reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule. In those instances where RNA aptamers are being selected, the SELEXTM method further comprises the steps of: (i) reverse transcribing the nucleic acids dissociated from the nucleic acid-target complexes before amplification in step (d); and (ii) transcribing the amplified nucleic acids from step (d) before restarting the process.

[0088] Within a nucleic acid mixture containing a large number of possible sequences and structures, there is a wide range of binding affinities for a given target. A
nucleic acid mixture comprising, for example, a 20 nucleotide randomized segment can have 4 20 candidate possibilities. Those which have the higher affinity (lower dissociation constants) for the target are most likely to bind to the target. After partitioning, dissociation and amplification, a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates.
Additional rounds of selection progressively favor the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested for binding affinity as pure ligands or aptamers.
[0089] Cycles of selection and amplification are repeated until a desired goal is achieved.
In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle. The method is typically used to sample approximately 1014 different nucleic acid species but may be used to sample as many as about 1018 different nucleic acid species. Generally, nucleic acid aptamer molecules are selected in a 5 to 20 cycle procedure. In one embodiment, heterogeneity is introduced only in the initial selection stages and does not occur throughout the replicating process.

[0090] In one embodiment of SELEX'm", the selection process is so efficient at isolating those nucleic acid ligands that bind most strongly to the selected target, that only one cycle of selection and amplification is required. Such an efficient selection may occur, for example, in a chromatographic-type process wherein the ability of nucleic acids to associate with targets bound on a column operates in such a manner that the column is sufficiently able to allow separation and isolation of the highest affinity nucleic acid ligands.

[0091] In many cases, it is not necessarily desirable to perform the iterative steps of SELEXTM until a single nucleic acid ligand is identified. The target-specific nucleic acid ligand solution may include a family of nucleic acid structures or motifs that have a number of conserved sequences and a number of sequences which can be substituted or added without significantly affecting the affinity of the nucleic acid ligands to the target. By terminating the SELEXTM process prior to completion, it is possible to determine the sequence of a number of members of the nucleic acid ligand solution family.

[0092] A variety of nucleic acid primary, secondary and tertiary structures are known to exist. The structures or motifs that have been shown most commonly to be involved in non-Watson-Crick type interactions are referred to as hairpin loops, symmetric and asymmetric bulges, pseudoknots and myriad combinations of the same. Almost all known cases of such motifs suggest that they can be formed in a nucleic acid sequence of no more than 30 nucleotides. For this reason, it is often preferred that SELEXTM procedures with contiguous randomized segments be initiated with nucleic acid sequences containing a randomized segment of between about 20 to about 50 nucleotides, and of about 30 to about 40 nucleotides in some embodiments. In one example, the 5'-fixed:random:3'-fixed sequence comprises a random sequence of about 30 to about 50 nucleotides.

[0093] The core SELEXTM method has been modified to achieve a number of specific objectives. For example, U.S. Patent No. 5,707,796 describes the use of SELEXTM in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. Patent No. 5,763,177 describes SELEXTM
based methods for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S.
Patent No.
5,567,588 and U.S. Patent No. 5,861,254 describe SELEXTM based methods which achieve highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. Patent No. 5,496,938 describes methods for obtaining improved nucleic acid ligands after the SELEXTM process has been performed. U.S. Patent No.
5,705,337 describes methods for covalently linking a ligand to its target.

[0094] SELEXTM can also be used to obtain nucleic acid ligands that bind to more than one site on the target molecule, and to obtain nucleic acid ligands that include non-nucleic acid species that bind to specific sites on the target. SELEXTM provides means for isolating and identifying nucleic acid ligands which bind to any envisionable target, including large and small biomolecules such as nucleic acid-binding proteins and proteins not known to bind nucleic acids as part of their biological function as well as cofactors and other small molecules. For example, U.S. Patent No. 5,580,737 discloses nucleic acid sequences identified through SELEXTM which are capable of binding with high affinity to caffeine and the closely related analog, theophylline.

[0095] Counter-SELEXTM is a method for improving the specificity of nucleic acid ligands to a target molecule by eliminating nucleic acid ligand sequences with cross-reactivity to one or more non-target molecules. Counter- SELEXTM is comprised of the steps of:
(a) preparing a candidate mixture of nucleic acids; (b) contacting the candidate mixture with the target, wherein nucleic acids having an increased affinity to the target relative to the candidate mixture may be partitioned from the remainder of the candidate mixture; (c) partitioning the increased affinity nucleic acids from the remainder of the candidate mixture;
(d) dissociating the increased affinity nucleic acids from the target; (e) contacting the increased affinity nucleic acids with one or more non-target molecules such that nucleic acid ligands with specific affinity for the non-target molecule(s) are removed; and (f) amplifying the nucleic acids with specific affinity only to the target molecule to yield a mixture of nucleic acids enriched for nucleic acid sequences with a relatively higher affinity and specificity for binding to the target molecule. As described above for SELEXTM cycles of selection and amplification are repeated as necessary until a desired goal is achieved.

[0096] One potential problem encountered in the use of nucleic acids as therapeutics and vaccines is that oligonucleotides in their phosphodiester form may be quickly degraded in body fluids by intracellular and extracellular enzymes such as endonucleases and exonucleases before the desired effect is manifest. The SELEXTM method thus encompasses the identification of high-affinity nucleic acid ligands containing modified nucleotides conferring improved characteristics on the ligand, such as improved in vivo stability or improved delivery characteristics. Examples of such modifications include chemical substitutions at the sugar and/or phosphate and/or base positions. SELEXTM-identified nucleic acid ligands containing modified nucleotides are described, e.g., in U.S.
Patent No. 5,660,985, which describes oligonucleotides containing nucleotide derivatives chemically modified at the 2' position of ribose, 5 position of pyrimidines, and 8 position of purines, U.S. Patent No.
5,756,703 which describes oligonucleotides containing various 2'-modified pyrimidines, and U.S. Patent No. 5,580,737 which describes highly specific nucleic acid ligands containing one or more nucleotides modified with 2'-amino (2'-NH2), 2'-fluoro (2'-F), and/or 2'-OMe substituents.

[0097] Modifications of the nucleic acid ligands contemplated in this invention include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrophobicity, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or to the nucleic acid ligand as a whole.
Modifications to generate oligonucleotide populations which are resistant to nucleases can also include one or more substitute intemucleotide linkages, altered sugars, altered bases, or combinations thereof. Such modifications include, but are not limited to, 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, phosphorothioate or alkyl phosphate modifications, methylations, and unusual base-pairing combinations such as the isobases isocytidine and isoguanidine. Modifications can also include 3' and 5' modifications such as capping.

[0098] In one embodiment, oligonucleotides are provided in which the P(O)0 group is replaced by P(O)S ("thioate"), P(S)S ("dithioate"), P(O)NR2 ("amidate"), P(O)R, P(O)OR', CO or CH2 ("formacetal") or 3'-amine (-NH-CH2-CH2-), wherein each R or R' is independently H or substituted or unsubstituted alkyl. Linkage groups can be attached to adjacent nucleotides through an -0-, -N-, or -S- linkage. Not all linkages in the oligonucleotide are required to be identical. As used herein, the term phosphorothioate encompasses one or more non-bridging oxygen atoms in a phosphodiester bond replaced by one or more sulfur atoms [0099] In fixrther embodiments, the oligonucleotides comprise modified sugar groups, for example, one or more of the hydroxyl groups is replaced with halogen, aliphatic groups, or functionalized as ethers or amines. In one embodiment, the 2'-position of the furanose residue is substituted by any of an 0-methyl, 0-alkyl, 0-allyl, S-alkyl, S-allyl, or halo group.
Methods of synthesis of 2'-modified sugars are described, e.g., in Sproat, et al., Nucl. Acid Res. 19:733-738 (1991); Cotten, et al., Nucl. Acid Res. 19:2629-2635 (1991);
and Hobbs, et al., Biochemistry 12:5138-5145 (1973). Other modifications are known to one of ordinary skill in the art. Such modifications may be pre-SELEXTM process modifications or post-SELEXTM process modifications (modification of previously identified unmodified ligands) or may be made by incorporation into the SELEXTM process.

[001001 Pre-SELEXTM process modifications or those made by incorporation into the SELEX process yield nucleic acid ligands with both specificity for their SELEXiM target and improved stability, e.g., in vivo stability. Post-SELEXTM process modifications made to nucleic acid ligands may result in improved stability, e.g., in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand.

[00101] The SELEXTM method encompasses combining selected oligonucleotides with other selected oligonucleotides and non-oligonucleotide functional units as described in U.S.
Patent No. 5,637,459 and U.S. Patent No. 5,683,867. The SELEXTM method further encompasses combining selected nucleic acid ligands with lipophilic or non-immunogenic high molecular weight compounds in a diagnostic or therapeutic complex, as described, e.g., in U.S. Patent No. 6,011,020, U.S. Patent No. 6,051,698, and PCT Publication No. WO
98/18480. These patents and applications teach the combination of a broad array of shapes and other properties, with the efficient amplification and replication properties of oligonucleotides, and with the desirable properties of other molecules.

[00102] The identification of nucleic acid ligands to small, flexible peptides via the SELEXTM method has also been explored. Small peptides have flexible structures and usually exist in solution in an equilibrium of multiple conformers, and thus it was initially thought that binding affinities may be limited by the conformational entropy lost upon binding a flexible peptide. However, the feasibility of identifying nucleic acid ligands to small peptides in solution was demonstrated in U.S. Patent No. 5,648,214 in which high affinity RNA
nucleic acid ligands to substance P, an 11 amino acid peptide, were identified.

[00103] The aptamers with specificity and binding affinity to the target(s) of the present invention are typically selected by the SELEXTM process as described herein.
As part of the SELEXTM process, the sequences selected to bind to the target are then optionally minimized to determine the minimal sequence having the desired binding affinity. The selected aptamer sequences and/or the minimized aptamer sequences are optionally optimized by performing random or directed mutagenesis of the sequence to increase binding affinity or alternatively to determine which positions in the sequence are essential for binding activity.
For example, a "doped reselections" may be used to explore the sequence requirements within an aptamer.
During doped reselection, selections are carried out with a synthetic, degenerate pool that has been designed based on a single sequence. The level of degeneracy usually varies from 70%
to 85% wild type nucleotide. In general, neutral mutations are observed following doped reselection but in some cases sequence changes can result in improvements in affinity.
Additionally, selections can be performed with sequences incorporating modified sequences to stabilize the aptamer molecules against degradation in vivo.

2'MODIFIED SELEXTM

[00104] In order for an aptamer to be suitable for use as a therapeutic, it is preferably inexpensive to synthesize, safe and stable in vivo. Wild-type RNA and DNA
aptamers are typically not stable in vivo because of their susceptibility to degradation by nucleases.
Resistance to nuclease degradation can be greatly increased, if desired, by the incorporation of modifying groups at the 2'-position.

[00105] 2'-fluoro and 2'-amino groups have been successfully incorporated into oligonucleotide libraries from which aptamers have been subsequently selected.
However, these modifications greatly increase the cost of synthesis of the resultant aptamer, and may introduce safety concerns in some cases because of the possibility that the modified nucleotides could be recycled into host DNA by degradation of the modified oligonucleotides and subsequent use of the nucleotides as substrates for DNA synthesis.

[00106] Aptamers that contain 2'-O-methyl ("2'-OMe") nucleotides, as provided in some embodiments herein, overcome many of these drawbacks. Oligonucleotides containing 2'-OMe nucleotides are nuclease-resistant and inexpensive to synthesize. Although 2'-OMe nucleotides are ubiquitous in biological systems, natural polymerases do not accept 2'-OMe NTPs as substrates under physiological conditions, thus there are no safety concerns over the recycling of 2'-OMe nucleotides into host DNA. The SELEXTM methods used to generate 2'-modified aptamers is described, e.g., in U.S. Provisional Patent Application Serial No.
60/430,761, filed December 3, 2002, U.S. Provisional Patent Application Serial No.
60/487,474, filed July 15, 2003, U.S. Provisional Patent Application Serial No. 60/517,039, filed November 4, 2003, U.S. Patent Application No. 10/729,58 1, filed December 3, 2003, U.S. Patent Application No. 10/873,856 filed June 21, 2004, entitled "Method for in vitro Selection of 2'-OMe Substituted Nucleic Acids", and U.S. Provisional Patent Application Serial No. 60/696,295, filed June 30, 2005, entitled "Improved Materials and Methods for the Generation of Fully 2'-Modified Containing Nucleic Acid Transcripts", each of which is herein incorporated by reference in its entirety.

[00107] The present invention includes aptamers that bind to and modulate the function of von Willebrand Factor which contain modified nucleotides (e.g., nucleotides which have a modification at the 2'position) to make the oligonucleotide more stable than the unmodified oligonucleotide to enzymatic and chemical degradation as well as thermal and physical degradation. Although there are several examples of 2'-OMe containing aptamers in the literature (see, e.g., Ruckman et al., J.Biol.Chem, 1998 273, 20556-20567-695) these were generated by the in vitro selection of libraries of modified transcripts in which the C and U
residues were 2'-fluoro (2'-F) substituted and the A and G residues were 2'-OH. Once functional sequences were identified then each A and G residue was tested for tolerance to 2'-OMe substitution, and the aptamer was re-synthesized having all A and G
residues which tolerated 2'-OMe substitution as 2'-OMe residues. Most of the A and G residues of aptamers generated in this two-step fashion tolerate substitution with 2'-OMe residues, although, on average, approximately 20% do not. Consequently, aptamers generated using this method tend to contain from two to four 2'-OH residues, and stability and cost of synthesis are compromised as a result. By incorporating modified nucleotides into the transcription reaction which generate stabilized oligonucleotides used in oligonucleotide libraries from which aptamers are selected and enriched by SELEX'm (andlor any of its variations and improvements, including those described herein), the methods of the present invention eliminate the need for stabilizing the selected aptamer oligonucleotides (e.g., by resynthesizing the aptamer oligonucleotides with modified nucleotides).

[001081 In one embodiment, the present invention provides aptamers comprising combinations of 2'-OH, 2'-F, 2'-deoxy, and 2'-OMe modifications of the ATP, GTP, CTP, TTP, and UTP nucleotides. In another embodiment, the present invention provides aptamers comprising combinations of 2'-OH, 2'-F, 2'-deoxy, 2'-OMe, 2'-NH2, and 2'-methoxyethyl modifications of the ATP, GTP, CTP, TTP, and UTP nucleotides. In another embodiment, the present invention provides aptamers comprising 56 combinations of 2'-OH, 2'-F, 2'-deoxy, 2'-OMe, 2'-NH2, and 2'-methoxyethyl modifications of the ATP, GTP, CTP, TTP, and UTP nucleotides.

2'- modified aptamers of some embodiments of the invention are created using modified polymerases, e.g., a modified T7 polymerase, having a rate of incorporation of modified nucleotides having bulky substituents at the furanose 2' position that is higher than that of wild-type polymerases. For example, a single mutant T7 polymerase (Y639F) in which the tyrosine residue at position 639 has been changed to phenylalanine readily utilizes 2'deoxy, 2'amino-, and 2'fluoro- nucleotide triphosphates (NTPs) as substrates and has been widely used to synthesize modified RNAs for a variety of applications. However, this mutant T7 polymerase reportedly can not readily utilize (i.e., incorporate) NTPs with bulky 2'-substituents such as 2'-OMe or 2'-azido (2'-N3) substituents. For incorporation of bulky 2' substituents, a double T7 polymerase mutant (Y639F/H784A) having the histidine at position 784 changed to an alanine residue in addition to the Y639F mutation has been described and has been used in limited circumstances to incorporate modified pyrimidine NTPs. See Padilla, R. and Sousa, R., Nucleic Acids Res., 2002, 30(24): 138. A

mutant T7 RNA polymerase has been used in limited circumstances to incorporate modified purine and pyrimidine NTPs, e.g., 2'-OMe NPTs, but requires a spike of 2'-OH
GTP for transcription. See Burmeister et.al., Chemistry and Biology, 2005, 12: 25-33.
A single mutant T7 polymerase (H784A) having the histidine at position 784 changed to an alanine residue has also been described. Padilla et al., Nucleic Acids Research, 2002, 30:
138. In both the Y639F/H784A double mutant and H784A single mutant T7 polymerases, the change to a smaller amino acid residue such as alanine allows for the incorporation of bulkier nucleotide substrates, e.g., 2'-O methyl substituted nucleotides. See Chelliserry, K. and Ellington, A.D., Nature Biotech, 2004, 9:1155-60. Additional T7 RNA polymerase have been described with mutations in the active site of the T7 RNA polymerase which more readily incorporate bulky 2'-modified substrates, e.g. a single T7 mutant RNA polymerase having the tyrosine residue at position 639 changed to a leucine (Y639L). However activity is often sacrificed for increased substrate specificity conferred by such mutations, leading to low transcript yields.
See Padilla R and Sousa, R., Nucleic Acids Res., 1999, 27(6): 1561.

[00109] Generally, it has been found that under the conditions disclosed herein, the Y693F
single mutant can be used for the incorporation of all 2'-OMe substituted NTPs except GTP
and the Y639F/H784A, Y639F/H784A/K378R, Y639L/H784A, and Y639L/H784A/K378R
mutant T7 RNA polymerases can be used for the incorporation of all 2'-OMe substituted NTPs including GTP. It is expected that the H784A single mutant possesses properties similar to the Y639F and the Y639F/H784A mutants when used under the conditions disclosed herein. -2'-modified oligonucleotides may be synthesized entirely of modified nucleotides, or with a subset of modified nucleotides. All nucleotides may be modified, and all may contain the same modification. All nucleotides may be modified, but contain different modifications, e.g., all nucleotides containing the same base may have one type of modification, while nucleotides containing other bases may have different types of modification.
All purine nucleotides may have one type of modification (or are unmodified), while all pyrimidine nucleotides have another, different type of modification (or are unmodified).
In this way, transcripts, or libraries of transcripts are generated using any combination of modifications, including for example, ribonucleotides (2'-OH), deoxyribonucleotides (2'-deoxy), 2'-F, and 2'-OMe nucleotides. A transcription mixture containing 2'-OMe C and U and 2'-OH A and G is referred to as a "rRmY" mixture and aptamers selected therefrom are referred to as "rRmY" aptamers. A transcription mixture containing deoxy A and G and 2'-OMe U
and C
is referred to as a "dRmY" mixture and aptamers selected therefrom are referred to as "dRmY" aptamers. A transcription mixture containing 2'-OMe A, C, and U, and 2'-OH G is referred to as a"rGmH" mixture and aptamers selected therefrom are referred to as "rGmH"
aptamers. A transcription mixture alternately containing 2'-OMe A, C, U and G
and 2'-OMe A, U and C and 2'-F G is referred to as a"alternating mixture" and aptamers selected therefrom are referred to as "alternating mixture" aptamers. A transcription mixture containing 2'-OMe A, U, C, and G, where up to 10% of the G's are ribonucleotides is referred to as a"r/mGmH" mixture and aptamers selected therefrom are referred to as "r/mGmH"
aptamers. A transcription mixture containing 2'-OMe A, U, and C, and 2'-F G is referred to as a"fGmH" mixture and aptamers selected therefrom are referred to as "fGmH"
aptamers.
A transcription mixture containing 2'-OMe A, U, and C, and deoxy G is referred to as a "dGmH" mixture and aptamers selected therefrom are referred to as "dGmH"
aptamers. A
transcription mixture containing deoxy A, and 2'-OMe C, G and U is referred to as a "dAmB" mixture and aptamers selected therefrom are referred to as "dAmB"
aptamers, and a transcription mixture containing all 2'-OH nucleotides is referred to as a "rN" mixture and aptamers selected therefrom are referred to as "rN", "rRrY", or "RNA"
aptamers. A
transcription mixture containing 2'-OH adenosine triphosphate and guanosine triphosphate and deoxy cytidine triphosphate and thymidine triphosphate is referred to as a rRdY mixture and aptamers selected therefrom are referred to as "rRdY' aptamers. A"mRmY"
aptamer is one containing only 2'-OMe nucleotides except for the starting nucleotide which is 2'-hydroxy.

[00110] A preferred embodiment includes any combination of 2'-OH, 2'-deoxy and 2'-OMe nucleotides. Another embodiment includes any combination of 2'-deoxy and 2'-OMe nucleotides. Yet another embodiment includes any combination of 2'-deoxy and 2'-OMe nucleotides in which the pyrimidines are 2'-OMe (such as dRmY, mRmY or dGmH).
[00111] Incorporation of modified nucleotides into the aptamers of the invention may be accomplished before (pre-) the selection process (e.g., a pre-SELEXTM process modification).
Optionally, aptamers of the invention in which modified nucleotides have been incorporated by pre-SELEXTM process modification can be further modified by a post-SELEXTM
modification process (i.e., a post-SELEXTM process modification after a pre-SELEXT"i modification). Pre-SELEXTm process modifications yield modified nucleic acid ligands with specificity for the SELEXTM target and also improved in vivo stability. Post-SELEX'M process modifications, i.e., modification (e.g., truncation, deletion, substitution or additional nucleotide modifications of previously identified ligands having nucleotides incorporated by pre-SELEX'm process modification) can result in a further improvement of in vivo stability without adversely affecting the binding capacity of the nucleic acid ligand having nucleotides incorporated by pre-SELEXTM"1"' process modification.

[00112] To generate pools of 2'-modified (e.g., 2'-OMe) RNA transcripts in conditions under which a polymerase accepts 2'-modified NTPs the Y693F, Y693F/ K378R, Y693F/H784A, Y693F/H784A/K378R, Y693L/H784A, Y693L/H784A/K378R Y639L, or the Y639L/K378Rmutant T7 RNA polymerases can be used. A preferred polymerase is the Y639L/H784A mutant T7 RNA polymerase. Another preferred polymerase is the Y639L/H784A/K378R mutant T7 RNA polymerase. Other T7 RNA polymerases, particularly those that exhibit a high tolerance for bulky 2'-substituents, may also be used in the present invention. When used in a template-directed polymerization using the conditions disclosed herein, the Y639L/H784A or the Y639L/H784A/K378R mutant T7 RNA polymerase can be used for the incorporation of all 2'-OMe NTPs, including GTP, with higher transcript yields than achieved by using the Y639F, Y639F/K378R, Y639F/H784A, Y639F/H784A/K378R, Y639L, or the Y639L/K378R mutant T7 RNA polymerases. The Y639L/H784A and Y639L/H784A/K378R mutant T7 RNA polymerases can be used with but does not require 2'-OH GTP to achieve high yields of 2'-modified, e.g., 2'-OMe containing oligonucleotides.
[00113] A number of factors have been determined to be important for the transcription conditions useful in the methods disclosed herein. For example, increases in the yields of modified transcript are observed when a leader sequence is incorporated into the 5' end of the DNA transcription template. The leader sequence is typically 6-15 nucleotides long, and may be composed of all purines, or a mixture of purine and pyrimidine nucleotides.

[00114] Transcription can be divided into two phases: the first phase is initiation, during which an NTP is added to the 3'-hydroxyl end of GTP (or another substituted guanosine) to yield a dinucleotide which is then extended by about 10-12 nucleotides; the second phase is elongation, during which transcription proceeds beyond the addition of the first about 10-12 nucleotides. It has been found that small amounts of 2'-OH GTP added to a transcription mixture containing an excess of 2'-OMe GTP are sufficient to enable the polymerase to initiate transcription using 2'-OH GTP, but once transcription enters the elongation phase the reduced discrimination between 2'-OMe and 2'-OH GTP, and the excess of 2'-OMe GTP
over 2'-OH GTP allows the incorporation of principally the 2'-OMe GTP.

[00115] Another important factor in the incorporation of 2'-OMe substituted nucleotides into transcripts is the use of both divalent magnesium and manganese in the transcription mixture. Different combinations of concentrations of magnesium chloride and manganese chloride have been found to affect yields of 2'-O-methylated transcripts, the optimum concentration of the magnesium and manganese chloride being dependent on the concentration in the transcription reaction mixture of NTPs which complex divalent metal ions. To obtain the greatest yields of maximally 2'- 0-methylated transcripts (i.e., a112'-OMe A, C, and U and about 90% of G nucleotides), concentrations of approximately 5 mM
magnesium chloride and 1.5 mM manganese chloride are preferred when each NTP
is present at a concentration of 0.5 mM. When the concentration of each NTP is 1.0 mM, concentrations of approximately 6.5 mM magnesium chloride and 2.0 mM manganese chloride are preferred. When the concentration of each NTP is 2.0 mM, concentrations of approximately 9.5 mM magnesium chloride and 3.0 mM manganese chloride are preferred.

In any case, departures from these concentrations of up to two-fold still give significant amounts of modified transcripts.

[00116] Priming transcription with GMP or guanosine, or another non-2'-OMe non-triphosphate is also important. This effect results from the specificity of the polymerase for the initiating nucleotide. As a result, the 5'-terminal nucleotide of any transcript generated in this fashion is likely to be 2'-OH G. The preferred concentration of GMP (or guanosine) is 0.5 mM and even more preferably 1 mM. It has also been found that including PEG, preferably PEG-8000, in the transcription reaction is useful to maximize incorporation of modified nucleotides.

[00117] For maximum incorporation of 2'-OMe ATP (100%), UTP (100%), CTP(100 10) and GTP (-90%) ("r/mGmH") into transcripts the following conditions are preferred: HEPES
buffer 200 mM, DTT 40 mM, spermidine 2 mM, PEG-8000 10% (w/v), Triton X-100 0.01%
(w/v), MgC12 5 mM (6.5 mM where the concentration of each 2'-OMe NTP is 1.0 mM), MnC121.5 mM (2.0 mM where the concentration of each 2'-OMe NTP is 1.0 mM), 2'-OMe NTP (each) 500 M (more preferably, 1.0 mM), 2'-OH GTP 30 M, 2'-OH GMP 500 M, pH 7.5, Y639F/H784A T7 RNA Polymerase 200 nM, inorganic pyrophosphatase 5 units/ml, and an all-purine leader sequence of at least 8 nucleotides long. As used herein, one unit of the Y639F/H784A mutant T7 RNA polymerase (or any other mutant T7 RNA
polymerase specified herein) is defined as the amount of enzyme required to incorporate 1 nmole of 2'-OMe NTPs into transcripts under the r/mGmH conditions. As used herein, one unit of inorganic pyrophosphatase is defined as the amount of enzyme that will liberate 1.0 mole of inorganic orthophosphate per minute at pH 7.2 and 25 C.

[001181 For maximum incorporation (100%) of 2'-OMe ATP, UTP and CTP ("rGmH") into transcripts the following conditions are preferred: HEPES buffer 200 mM, DTT 40 mM, spermidine 2 mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl2 5 mM (9.5 mM
where the concentration of each 2'-OMe NTP is 2.0 mM), MnCla 1.5 mM (3.0 mM
where the concentration of each 2'-OMe NTP is 2.0 mM), 2'-OMe NTP (each) 500 M (more preferably, 2.0 mM), pH 7.5, Y639F T7 RNA Polymerase 200 nM, inorganic pyrophosphatase 5 units/ml, and an all-purine leader sequence of at least 8 nucleotides long.

[00119] For maximum incorporation of 2'-OMe ATP (100%), 2'-OMe UTP (100%), 2'-OMe CTP (100%) and 2'-OMe GTP (100%) ("mRmY") into transcripts the following conditions are preferred: HEPES buffer 200 mM, DTT 40 mM, spermidine 2 mM, PEG-10% (w/v), Triton X-100 0.01 %(w/v), MgC12 8 mM, MnC12 2.5 mM, 2' -OMe NTP
(each) 1.5 mM, 2'-OH GMP 1 mM, pH 7.5, Y639L/H784A/K378R mutant T7 RNA Polymerase 200nM, inorganic pyrophosphatase 5 units/ml, and a leader sequence that increases the transcription yield under the derived transcription conditions. In one embodiment, the leader sequence is an all purine leader sequence. In another embodiment, the leader sequence is a mixture of purines and pyrimidines. As used herein, one unit of inorganic pyrophosphatase is defined as the amount of enzyme that will liberate 1.0 mole of inorganic orthophosphate per minute at pH 7.2 and 25 C.

[00120] For maximum incorporation (100%) of 2'-OMe UTP and CTP ("rRmY") into transcripts the following conditions are preferred: HEPES buffer 200 mM, DTT
40 mM, spermidine 2 mM, PEG-8000 10% (w/v), Triton X-100 0.01 10 (w/v), MgC12 5 mM
(9.5 mM
where the concentration of each 2'-OMe NTP is 2.0 mM), MnC12 1.5 mM (3.0 mM
where the concentration of each 2'-OMe NTP is 2.0 mM), 2'-OMe NTP (each) 500 M (more preferably, 2.0 mM), pH 7.5, Y639F/H784A T7 RNA Polymerase 200 nM, inorganic pyrophosphatase 5 units/ml, and an all-purine leader sequence of at least 8 nucleotides long.
[00121] For maximum incorporation (100%) of deoxy ATP and GTP and 2'-OMe UTP
and CTP ("dRmY") into transcripts the following conditions are preferred:
HEPES buffer 200 mM, DTT 40 mM, spermine 2 mM, spermidine 2 mM, PEG-8000 10% (w/v), Triton X-0.01% (w/v), MgC12 9.5 mM, MnC12 3.0 mM, 2'-OMe NTP (each) 2.0 mM, pH 7.5, T7 RNA Polymerase 200 nM, inorganic pyrophosphatase 5 units/ml, and an all-purine leader sequence of at least 8 nucleotides long.

[00122] For maximum incorporation (100%) of 2'-OMe ATP, UTP and CTP and 2'-F
GTP
("fGmH") into transcripts the following conditions are preferred: HEPES buffer 200 mM, DTT 40 mM, spermidine 2 mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCla 9.5 mM, MnC1a 3.0 mM, 2'-OMe NTP (each) 2.0 mM, pH 7.5, Y639F T7 RNA Polymerase nM, inorganic pyrophosphatase 5 units/ml, and an all-purine leader sequence of at least 8 nucleotides long.

[00123] For maximum incorporation (100%) of deoxy ATP and 2'-OMe UTP, GTP and CTP ("dAmB") into transcripts the following conditions are preferred: HEPES
buffer 200 mM, DTT 40 mM, spermidine 2 mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgC12 9.5 mM, MnC12 3.0 mM, 2'-OMe NTP (each) 2.0 mM, pH 7.5, Y639F T7 RNA
Polymerase 200 nM, inorganic pyrophosphatase 5 units/ml, and an all-purine leader sequence of at least 8 nucleotides long.

[00124] For each of the above (a) transcription is preferably performed at a temperature of from about 20 C to about 50 C, preferably from about 30 C to 45 C, and more preferably at about 37 C for a period of at least two hours and (b) 50-300 nM of a double stranded DNA
transcription template is used (200 nM template is used in round 1 to increase diversity (300 nM template is used in dRmY transcriptions)), and for subsequent rounds approximately 50 nM, a 1/10 dilution of an optimized PCR reaction, using conditions described herein, is used).
The preferred DNA transcription templates are described below (where ARC254 and ARC256 transcribe under all 2'-OMe conditions and ARC255 transcribes under rRmY
conditions).

SEQ ID NO: 1 5'-CATCGATGCTAGTCGTAACGATCC CGAGAACGTTCTCTCCTCTCCCTATA
GTGAGTCGTATTA-3' SEQ ID NO: 2 5'-CATGCATCGCGACTGACTAGCC GTAGAACGTTCTCTCCTCTCCCTATAG
TGAGTCGTATTA-3' SEQ ID NO 3:
5'-CATCGATCGATCGATCGACAGCG GTAGAACGTTCTCTCCTCTCCCTATAG
TGAGTCGTATTA-3' [00125] Under rN transcription conditions of the present invention, the transcription reaction mixture comprises 2'-OH adenosine triphosphates (ATP), 2'-OH
guanosine triphosphates (GTP), 2'-OH cytidine triphosphates (CTP), and 2'-OH uridine triphosphates (UTP). The modified oligonucleotides produced using the rN transcription mixtures of the present invention comprise substantially al12'-OH adenosine, 2'-OH guanosine, 2'-OH
cytidine, and 2'-OH uridine. In a preferred embodiment of rN transcription, the resulting modified oligonucleotides comprise a sequence where at least 80% of all adenosine nucleotides are 2'-OH adenosine, at least 80% of all guanosine nucleotides are 2'-OH
guanosine, at least 80% of all cytidine nucleotides are 2'-OH cytidine, and at least 80% of all uridine nucleotides are 2'-OH uridine. In a more preferred embodiment of rN
transcription, the resulting modified oligonucleotides of the present invention comprise a sequence where at least 90% of all adenosine nucleotides are 2'-OH adenosine, at least 90% of all guanosine nucleotides are 2'-OH guanosine, at least 90% of all cytidine nucleotides are 2'-OH cytidine, and at least 90% of all uridine nucleotides are 2'-OH uridine. In a most preferred embodiment of rN transcription, the modified oligonucleotides of the present invention comprise a sequence where 100% of all adenosine nucleotides are 2'-OH adenosine, 100% of all guanosine nucleotides are 2'-OH guanosine, 100% of all cytidine nucleotides are 2'-OH
cytidine, and 100% of all uridine nucleotides are 2'-OH uridine.

[00126] Under rRmY transcription conditions of the present invention, the transcription reaction mixture comprises 2'-OH adenosine triphosphates, 2'-OH guanosine triphosphates, 2'-OMe cytidine triphosphates, and 2'-OMe uridine triphosphates. The modified oligonucleotides produced using the rRmY transcription mixtures of the present invention comprise substantially all 2'-OH adenosine, 2'-OH guanosine, 2'-OMe cytidine and 2'-OMe uridine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 80% of all adenosine nucleotides are 2'-OH adenosine, at least 80%
of all guanosine nucleotides are 2'-OH guanosine, at least 80% of all cytidine nucleotides are 2'-OMe cytidine and at least 80% of all uridine nucleotides are 2'-OMe uridine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 90% of all adenosine nucleotides are 2'-OH adenosine, at least 90% of all guanosine nucleotides are 2'-OH guanosine, at least 90% of all cytidine nucleotides are 2'-OMe cytidine and at least 90% of all uridine nucleotides are 2'-OMe uridine In a most preferred embodiment, the resulting modified oligonucleotides comprise a sequence where 100% of all adenosine nucleotides are 2'-OH adenosine, 100% of all guanosine nucleotides are 2'-OH
guanosine, 100% of all cytidine nucleotides are 2'-OMe cytidine and 100% of all uridine nucleotides are 2'-OMe uridine.

[00127] Under dRmY transcription conditions of the present invention, the transcription reaction mixture comprises 2'-deoxy adenosine triphosphates, 2'-deoxy guanosine triphosphates, 2'-O-methyl cytidine triphosphates, and 2'-O-methyl uridine triphosphates.

The modified oligonucleotides produced using the dRmY transcription conditions of the present invention comprise substantially all 2'-deoxy adenosine, 2'-deoxy guanosine, 2'-O-methyl cytidine, and 2'-O-methyl uridine. In a preferred embodiment, the resulting modified oligonucleotides of the present invention comprise a sequence where at least 80% of all adenosine nucleotides are 2'-deoxy adenosine, at least 80% of all guanosine nucleotides are 2'-deoxy guanosine, at least 80% of all cytidine nucleotides are 2'-O-methyl cytidine, and at least 80% of all uridine nucleotides are 2'-O-methyl uridine. In a more preferred embodiment, the resulting modified oligonucleotides of the present invention comprise a sequence where at least 90% of all adenosine nucleotides are 2'-deoxy adenosine, at least 90 % of all guanosine nucleotides are 2'-deoxy guanosine, at least 90% of all cytidine nucleotides are 2'-O-methyl cytidine, and at least 90% of all uridine nucleotides are 2'-O-methyl uridine. In a most preferred embodiment, the resulting modified oligonucleotides of the present invention comprise a sequence where 100% of all adenosine nucleotides are 2'-deoxy adenosine, 100% of all guanosine nucleotides are 2'-deoxy guanosine, 100% of all cytidine nucleotides are 2'-O-methyl cytidine, and 100% of all uridine nucleotides are 2'-0-methyl uridine.

[00128) Under rGmH transcription conditions of the present invention, the transcription reaction mixture comprises 2'-OH guanosine triphosphates, 2'-O-methyl cytidine triphosphates, 2'-O-methyl uridine triphosphates, and 2'-O-methyl adenosine triphosphates.
The modified oligonucleotides produced using the rGmH transcription mixtures of the present invention comprise substantially all 2'-OH guanosine, 2'-O-methyl cytidine, 2'-O-methyl uridine, and 2'-O-methyl adenosine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 80% of all guanosine nucleotides are 2'-OH guanosine, at least 80% of all cytidine nucleotides are 2'-O-methyl cytidine, at least 80%
of all uridine nucleotides are 2'-O-methyl uridine, and at least 80% of all adenosine nucleotides are 2'-O-methyl adenosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 90% of all guanosine nucleotides are 2'-OH guanosine, at least 90% of all cytidine nucleotides are 2'-O-methyl cytidine, at least 90% of all uridine nucleotides are 2'-O-methyl uridine, and at least 90% of all adenosine nucleotides are 2'-O-methyl adenosine. In a most preferred embodiment, the resulting modified oligonucleotides comprise a sequence where 100% of all guanosine nucleotides are 2'-OH guanosine, 100% of all cytidine nucleotides are 2'-O-methyl cytidine, 100% of all uridine nucleotides are 2'-O-methyl uridine, and 100% of all adenosine nucleotides are 2'-O-methyl adenosine.

[00129] Under r/mGmH transcription conditions of the present invention, the transcription reaction mixture comprises 2'-O-methyl adenosine triphosphate, 2'-O-methyl cytidine triphosphate, 2'-O-methyl guanosine triphosphate, 2'-O-methyl uridine triphosphate and 2'-OH guanosine triphosphate. The resulting modified oligonucleotides produced using the r/mGmH transcription mixtures of the present invention comprise substantially all 2'-0=
methyl adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine, wherein the population of guanosine nucleotides has a maximum of about 10% 2'-OH
guanosine. In a preferred embodiment, the resulting r/mGmH modified oligonucleotides of the present invention comprise a sequence where at least 80% of all adenosine nucleotides are 2'-O-methyl adenosine, at least 80% of all cytidine nucleotides are 2'-O-methyl cytidine, at least 80% of all guanosine nucleotides are 2'-O-methyl guanosine, at least 80%
of all uridine nucleotides are 2'-O-methyl uridine, and no more than about 10% of all guanosine nucleotides are 2'-OH guanosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 90% of all adenosine nucleotides are 2'-0-methyl adenosine, at least 90% of all cytidine nucleotides are 2'-O-methyl cytidine, at least 90% of all guanosine nucleotides are 2'-O-methyl guanosine, at least 90% of all uridine nucleotides are 2'-O-methyl uridine, and no more than about 10% of all guanosine nucleotides are 2'-OH guanosine. In a most preferred embodiment, the resulting modified oligonucleotides comprise a sequence where 100% of all adenosine nucleotides are 2'-O-methyl adenosine, 100% of all cytidine nucleotides are 2'-O-methyl cytidine, 90% of all guanosine nucleotides are 2'-O-methyl guanosine, and 100% of all uridine nucleotides are 2'-0-methyl uridine, and no more than about 10% of all guanosine nucleotides are 2'-OH
guanosine.

[00130] Under mRmY transcription conditions of the present invention, the transcription mixture comprises only 2'-O-methyl adenosine triphosphate, 2'-O-methyl cytidine triphosphate, 2'-O-methyl guanosine triphosphate, 2'-O-methyl uridine triphosphate.. The resulting modified oligonucleotides produced using the mRmY transcription mixture of the present invention comprise a sequence where 100% of all adenosine nucleotides are 2'-0-methyl adenosine, 100% of all cytidine nucleotides are 2'-0-methyl cytidine, 100% of all guanosine nucleotides are 2'-O-methyl guanosine, and 100% of all uridine nucleotides are 2'-0-methyl uridine.

[00131] Under fGmH transcription conditions of the present invention, the transcription reaction mixture comprises 2'-O-methyl adenosine triphosphates, 2'-O-methyl uridine triphosphates, 2'-O-methyl cytidine triphosphates, and 2'-F guanosine triphosphates. The modified oligonucleotides produced using the fGmH transcription conditions of the present invention comprise substantially all 2'-O-methyl adenosine, 2'-O-methyl uridine, 2'-O-methyl cytidine, and 2'-F guanosine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 80% of all adenosine nucleotides are 2'-0-methyl adenosine, at least 80% of all uridine nucleotides are 2'-O-methyl uridine, at least 80% of all cytidine nucleotides are 2'-O-methyl cytidine, and at least 80% of all guanosine nucleotides are 2'-F guanosine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 90% of all adenosine nucleotides are 2'-0-methyl adenosine, at least 90% of all uridine nucleotides are 2'-O-methyl uridine, at least 90% of all cytidine nucleotides are 2'-O-methyl cytidine, and at least 90% of all guanosine nucleotides are 2'-F guanosine. In a most preferred embodiment, the resulting modified oligonucleotides comprise a sequence where 100% of all adenosine nucleotides are 2'-O-methyl adenosine, 100% of all uridine nucleotides are 2'-O-methyl uridine, 100% of all cytidine nucleotides are 2'-O-methyl cytidine, and 100% of all guanosine nucleotides are 2'-F
guanosine.

[00132] Under dAmB transcription conditions of the present invention, the transcription reaction mixture comprises 2'-deoxy adenosine triphosphates, 2'-O-methyl cytidine triphosphates, 2'-O-methyl guanosine triphosphates, and 2'-O-methyl uridine triphosphates.
The modified oligonucleotides produced using the dAinB transcription mixtures of the present invention comprise substantially all 2'-deoxy adenosine, 2'-O-methyl cytidine, 2'-O-methyl guanosine, and 2'-O-methyl uridine. In a preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 80% of all adenosine nucleotides are 2'-deoxy adenosine, at least 80% of all cytidine nucleotides are 2'-O-methyl cytidine, at least 80% of all guanosine nucleotides are 2'-O-methyl guanosine, and at least 80%
of all uridine nucleotides are 2'-O-methyl uridine. In a more preferred embodiment, the resulting modified oligonucleotides comprise a sequence where at least 90% of all adenosine nucleotides are 2'-deoxy adenosine, at least 90% of all cytidine nucleotides are 2'-O-methyl cytidine, at least 90% of all guanosine nucleotides are 2'-O-methyl guanosine, and at least 90%
of all uridine nucleotides are 2'-O-methyl uridine. In a most preferred embodiment, the resulting modified oligonucleotides of the present invention comprise a sequence where 100% of all adenosine nucleotides are 2'-deoxy adenosine, 100% of all cytidine nucleotides are 2'-O-methyl cytidine, 100% of all guanosine nucleotides are 2'-O-methyl guanosine, and 100% of all uridine nucleotides are 2'-O-methyl uridine.

[00133] In each case, the transcription products can then be used for input into the SELEXTM process to identify aptamers and/or to determine a conserved sequences that has binding specificity to a given target. The resulting sequences are already partially stabilized, eliminating this step from the post-SELEXTM process to arrive at an optimized aptamer sequence and giving a more highly stabilized aptamer as a result. Another advantage of the 2'-OMe SELEXTM process is that the resulting sequences are likely to have fewer 2'-OH
nucleotides required in the sequence, possibly none. To the extent 2'OH
nucleotides remain they may be removed by performing post-SELEXTM modifications.

[00134] As described below, lower but still useful yields of transcripts fully incorporating 2' substituted nucleotides can be obtained under conditions other than the optimized conditions described above. For example, variations to the above transcription conditions include:

[00135] The HEPES buffer concentration can range from 0 to 1 M. The present invention also contemplates the use of other buffering agents having a pKa between 5 and 10 including, for example, Tris-hydroxymethyl-aminomethane.

[00136] The DTT concentration can range from 0 to 400 mM. The methods of the present invention also provide for the use of other reducing agents including, for example, mercaptoethanol.

[00137] The spermidine and/or spermine concentration can range from 0 to 20 mM.

[00138] The PEG-8000 concentration can range from 0 to 50 %(w/v). The methods of the present invention also provide for the use of other hydrophilic polymer including, for example, other molecular weight PEG or other polyalkylene glycols.

[00139] The Triton X-100 concentration can range from 0 to 0.1% (w/v). The methods of the present invention also provide for the use of other non-ionic detergents including, for example, other detergents, including other Triton-X detergents.

[00140] The MgC12 concentration can range from 0.5 mM to 50 mM. The MnCl2 concentration can range from 0.15 mM to 15 mM. Both MgC12 and MnC12 must be present within the ranges described and in a preferred embodiment are present in about a 10 to about 3 ratio of MgC12:MnC12, preferably, the ratio is about 3-5:1, more preferably, the ratio is about 3-4:1.

[00141] The 2'-OMe NTP concentration (each NTP) can range from 5 M to 5 mM.
[00142] The 2'-OH GTP concentration can range from 0 M to 300 M.

[00143] The 2'-OH GMP concentration can range from 0 to 5 mM.

[00144] The pH can range from pH 6 to pH 9. The methods of the present invention can be practiced within the pH range of activity of most polymerases that incorporate modified nucleotides. In addition, the methods of the present invention provide for the optional use of chelating agents in the transcription reaction condition including, for example, EDTA, EGTA, and DTT.

APTAMER MEDICINAL CHEMISTRY

[00145] Aptamer Medicinal Chemistry is an aptamer improvement technique in which sets of variant aptamers are chemically synthesized. These sets of variants typically differ from the parent aptamer by the introduction of a single substituent, and differ from each other by the location of this substituent. These variants are then compared to each other and to the parent. Improvements in characteristics may be profound enough that the inclusion of a single substituent may be all that is necessary to achieve a particular therapeutic criterion.
[00146] Alternatively the information gleaned from the set of single variants may be used to design further sets of variants in which more than one substituent is introduced simultaneously. In one design strategy, all of the single substituent variants are ranked, the top 4 are chosen and all possible double (6), triple (4) and quadruple (1) combinations of these 4 single substituent variants are synthesized and assayed. In a second design strategy, the best single substituent variant is considered to be the new parent and all possible double substituent variants that include this highest-ranked single substituent variant are synthesized and assayed. Other strategies may be used, and these strategies may be applied repeatedly such that the number of substituents is gradually increased while continuing to identify further-improved variants.

[001471 Aptamer Medicinal Chemistry may be used particularly as a method to explore the local, rather than the global, introduction of substituents. Because aptamers are discovered within libraries that are generated by transcription, any substituents that are introduced during the SELEXTM process must be introduced globally. For example, if it is desired to introduce phosphorothioate linkages between nucleotides then they can only be introduced at every A (or every G, C, T, U etc.) (globally substituted).
Aptamers which require phosphorothioates at some As (or some G, C, T, U etc.) (locally substituted) but cannot tolerate it at other As cannot be readily discovered by this process.

[00148] The kinds of substituent that can be utilized by the Aptamer Medicinal Chemistry process are only limited by the ability to generate them as solid-phase synthesis reagents and introduce them into an oligomer synthesis scheme. The process is certainly not limited to nucleotides alone. Aptamer Medicinal Chemistry schemes may include substituents that introduce steric bulk, hydrophobicity, hydrophilicity, lipophilicity, lipophobicity, positive charge, negative charge, neutral charge, zwitterions, polarizability, nuclease-resistance, conformational rigidity, conformational flexibility, protein-binding characteristics, mass etc.
Aptamer Medicinal Chemistry schemes may include base-modifications, sugar-modifications or phosphodiester linkage-modifications.

[00149] When considering the kinds of substituents that are likely to be beneficial within the context of a therapeutic aptamer, it may be desirable to introduce substitutions that fall into one or more of the following categories:

(1) Substituents already present in the body, e.g., 2'-deoxy, 2'-ribo, 2'-O-methyl purines or pyrimidines or 5-methyl cytosine.

(2) Substituents already part of an approved therapeutic, e.g., phosphorothioate-linked oligonucleotides.
(3) Substituents that hydrolyze or degrade to one of the above two categories, e.g., methylphosphonate-linked oligonucleotides.

[00150] The vWF aptamers of the invention include aptamers developed through aptamer medicinal chemistry as described herein.

vON WILLEBRAND FACTOR SPECIFIC BINDING APTAMERS

[00151] The materials of the present invention comprise a series of nucleic acid aptamers of 29 to 76 nucleotides in length which bind specifically to von Willebrand Factor. In one embodiment, materials of the present invention comprise a series of nucleic acid aptamers of 29 to 76 nucleotides in length which bind specifically to von Willebrand Factor and which functionally modulate, e.g., block, an activity of von Willebrand Factor in vivo and/or cell-based assays.

[00152] Aptamers specifically capable of binding and modulating full length von Willebrand Factor and/or von Willebrand Factor domain Al are set forth herein.
These aptamers provide a low-toxicity, safe, and effective modality of treating and/or preventing cardiovascular diseases or disorders. In one embodiment, the aptamers of the invention are used in a method to treat and/or prevent coronary artery diseases, including any one of the disorders selected from the group consisting of: arterial thrombosis and acute coronary syndromes such as unstable angina and myocardial infarction which are known to be caused by or otherwise associated with von Willebrand Factor mediated platelet aggregation. In particular embodiments, the aptamers of the invention are used in a method to treat and/or prevent coronary artery diseases, including any one of the disorders selected from the group consisting of: arterial thrombosis and acute coronary syndromes such as unstable angina and myocardial infarction which are known to be caused by or otherwise associated with von Willebrand Factor mediated platelet aggregation while minimizing bleeding side effects. In another embodiment, the aptamers of the invention are used in a method to treat and/or prevent peripheral vascular diseases which are known to be caused by or otherwise associated with von Willebrand Factor mediated platelet aggregation. In a particular embodiment, the aptamers of the invention are used in a method to treat and/or prevent peripheral vascular diseases which are known to be caused by or otherwise associated with von Willebrand Factor mediated platelet aggregation, preferably, while minimizing bleeding side effects. In another embodiment, the aptamers of the invention are used to treat and/or prevent cerebrovascular diseases, including any one of the disorders selected from the group consisting of: transient cerebral ischemic attack, stroke and carotid stenosis which are known to be caused by or otherwise associated with von Willebrand Factor mediated platelet aggregation, preferably, while minimizing bleeding side effects. Further, aptamers of the invention are useful to inhibit von Willebrand Factor mediated platelet aggregation in a subject prior to, during, and/or after a subject has undergone percutaneous coronary intervention including angioplasty, thrombolytic treatment or coronary bypass surgery. Aptamers of the invention are also useful for maintaining blood vessel patency in a subject prior to, during and/or after the subject has undergone coronary bypass surgery. The aptamers of the invention are also useful for treating a patient undergoing dialysis. The aptamers of the invention are also useful for inhibiting von Willebrand Factor mediated thrombosis in a subject, preferably while also minimizing bleeding side effects. The thrombosis to be treated and/or inhibited may be associated with an inflammatory response.

[00153] In one embodiment, the von Willebrand Factor specific binding aptamer for use in therapeutics and/or diagnostics is selected from the group consisting of: SEQ
ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ
ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID
NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO
205, SEQ IDNO 208, SEQ IDNOS 212-214, ARC1115 (SEQ IDNO 221), ARC1172 (SEQ
ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ
ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ
ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ
ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635, ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323).

[00154] In another embodiment, von Willebrand Factor specific binding aptamers for use as therapeutics and/or diagnostics include any one of the following sequences:
SEQ ID NO
23, SEQ ID NO 44, SEQ ID NO 49, SEQ ID NOS 98-100, SEQ ID NO 106, SEQ ID NO
109, SEQ ID NOS 114 to115, SEQ ID NO 118, SEQ ID NO 127, SEQ ID NO 134, SEQ ID
NO 164, SEQ ID N0165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO
177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID NO
192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 208, and SEQ ID NOS 212 to 214. In some embodiments, von Willebrand Factor specific bind aptamers for use as therapeutics and/or diagnostics include any one of the following sequences: ARC1029 (SEQ ID NO
214), ARC1115 (SEQ IDNO 221) , ARC1172 (SEQ ID NO 222), ARC1346 (SEQ IDNO 281) , ARC1361 (SEQ ID NO 284), ARC1368 (SEQ ID NO 291), ARC1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320), ARC 1780 (SEQ ID NO 321), ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323).

[00155] Other aptamers of the invention that bind von Willebrand Factor are described below in Examples 1 and 2.

[00156] These aptamers may include modifications as described herein including, e.g., conjugation to lipophilic or high molecular weight compounds (e.g., PEG), incorporation of a capping moiety, incorporation of modified nucleotides, and phosphate back bone modification (including incorporation of phosphorothioate into the phosphate backbone).

[00157] In one embodiment of the invention an isolated, non-naturally occurring aptamer that binds to von Willebrand Factor is provided. In another embodiment, the aptamer of the invention modulates a function of von Willebrand Factor. In another embodiment, the aptamer of the invention inhibits a function of von Willebrand Factor while in another embodiment the aptamer stimulates a function of von Willebrand Factor. In another embodiment of the invention, the aptamer binds and/or modulates a function of a von Willebrand Factor variant. A von Willebrand Factor variant as used herein encompasses variants that perform essentially the same function as a von Willebrand Factor function, preferably comprises substantially the same structure and in some embodiments comprises at least 70% sequence identity, preferably at least 80% sequence identity, more preferably at least 90% sequence identity, and more preferably at least 95% sequence identity to the amino acid sequence of human von Willebrand Factor.

[00158] In another embodiment of the invention, the aptamer has substantially the same ability to bind von Willebrand Factor as that of an aptamer comprising any one of SEQ ID
NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID
NO
169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO
183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ
ID NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC 1115, ARC 1172 (SEQ ID NO
222) (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC 1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635, ARC1759 (SEQ ID
NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ
ID NO 322) to ARC1885 (SEQ ID NO 323). In another embodiment of the invention, the aptamer has substantially the same structure and ability to bind von Willebrand Factor as that of an aptamer comprising any one of SEQ ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID
NOS 98 to 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ
ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID
NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1115, ARC1172 (SEQ ID NO 222) (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635, ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID
NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323). In another embodiment, the aptamers of the invention comprise a sequence according to any one of SEQ
ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 165, SEQ ID NO 169, SEQ
ID
NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO
186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO
205, SEQ ID NO 208, SEQ ID NOS 212-213, ARC1115, ARC1172 (SEQ ID NO 222) (SEQ ID
NO 222), ARC1 194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID

NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID
NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID
NO 316), ARC1546 (SEQ ID NO 317), ARC1635, ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323). In another embodiment, the aptamers of the invention comprise a sequence that is at least 80% identical, preferably at least 90% identical and in some embodiments at least 95% identical to a sequence according to any one of SEQ

to 50, SEQ ID NOS 54 to 94, SEQ ID NOS 98 to 164, SEQ ID NO 165, SEQ ID NO
169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ
ID NO 186, SEQ ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID
NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC 1115, ARC 1172 (SEQ ID NO 222) (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1635, ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO
322) to ARC1885 (SEQ ID NO 323). In another embodiment, the aptamers of the invention specifically bind von Willebrand Factor and comprise a sequence of 30 contiguous nucleotides that are identical to 30 contiguous nucleotides in any one of the aptamers selected from the group consisting of: SEQ ID NOS 11 to 50, SEQ ID NOS 54 to 94, SEQ ID

to 164, SEQ ID NO 165, SEQ ID NO 169, SEQ ID NO 172, SEQ ID NO 174, SEQ ID NO
177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ ID NO 189, SEQ ID
NO.192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ ID NO 208, SEQ ID NOS 212-214, ARC1115, ARC1172 (SEQ ID NO 222) (SEQ ID NO 222), ARC1194 (SEQ ID NO
223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO
281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO
305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO
317), ARC1635, ARC1759 (SEQ ID NO 318), ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO 322) to ARC1885 (SEQ ID NO 323). In another embodiment, the aptamers of the invention are used as an active ingredient in pharmaceutical compositions. In another embodiment, the aptamers of the invention or compositions comprising the aptamers of the invention are used to treat thrombotic disease such as cardiovascular disorders, including acute coronary syndrome;
peripheral arterial disease; and cerebrovascular disorders, including stroke. In some embodiments, the aptamers of the invention or compositions comprising the aptamers of the invention are use to treat, prevent or ameliorate a disorder selected from the group consisting of:
essential thrombocytopenia,: thrombotic thrombocopenic purpura ("TTP"), Type IIb von Willebrand's disease, pseudo von Willebrand disease, peripheral artery disease, e.g.
peripheral arterial occlusive disease, unstable angina, angina pectoris, arterial thrombosis, atherosclerosis, myocardial infarction, acute coronary syndrome, atrial fibrillation, carotid stenosis, cerebral infarction, cerebral thrombosis, ischemic stroke, and transient cerebral ischemic attack. In some embodiments, the pharmaceutical composition of the invention is administered prior to/during and/or after dialysis, CABG surgery, percutaneous coronary intervention or heart valve replacement.

[00159] In some embodiments, aptamer therapeutics of the present invention have great affinity and specificity to their targets while reducing the deleterious side effects from non-naturally occurring nucleotide substitutions if the aptamer therapeutics break down in the body of patients or subjects. hi some embodiments, the therapeutic compositions containing the aptamer therapeutics of the present invention are free of or have a reduced amount of fluorinated nucleotides.

[00160] The aptamers of the present invention can be synthesized using any oligonucleotide synthesis techniques known in the art including solid phase oligonucleotide synthesis techniques (see, e.g., Froehler et al., Nucl. Acid Res. 14:5399-5467 (1986) and Froehler et al., Tet. Lett. 27:5575-5578 (1986)) and solution phase methods such as triester synthesis methods (see, e.g., Sood et al., Nucl. Acid Res. 4:2557 (1977) and Hirose et al., Tet.
Lett, 28:2449 (1978)) both of which are well known in the art.

PHARMACEUTICAL COMPOSITIONS

[00161] The invention also includes phannaceutical compositions containing aptamer molecules that bind to von Willebrand Factor. In some embodiments, the compositions are suitable for internal use and include an effective amount of a pharmacologically active compound of the invention, alone or in combination, with one or more pharmaceutically acceptable carriers. The compounds are especially useful in that they have very low, if any toxicity.

[00162] Compositions of the invention can be used to treat or prevent a pathology, such as a disease or disorder, or alleviate the symptoms of such disease or disorder in a patient. For example, compositions of the present invention can be used to treat or prevent a pathology associated with platelet aggregation. In some embodiments, the disease to be treated, prevented or ameliorated is selected from the group consisting of: essential thrombocytopenia,: thrombotic thrombocopenic purpura ("TTP"), Type IIb von Willebrand's disease, pseudo von Willebrand disease, peripheral artery disease, e.g.
peripheral arterial occlusive disease, unstable angina, angina pectoris, arterial thrombosis, atherosclerosis, myocardial infarction, acute coronary syndrome, atrial fibrillation, carotid stenosis, cerebral infarction, cerebral thrombosis, ischemic stroke, and transient cerebral ischemic attack. In some embodiments, the pharmaceutical composition of the invention is administered prior to, during and/or after dialysis, CABG surgery, percutaneous coronary intervention or heart valve replacement.

[00163] Compositions of the invention are useful for administration to a subject suffering from, or predisposed to, a disease or disorder which is related to or derived from a target to which the aptamers of the invention specifically bind.

[00164] Compositions of the invention can be used in a method for treating a patient or subject having a pathology. The method involves administering to the patient or subject an aptamer or a composition comprising aptamers that bind to von Willebrand Factor involved with the pathology, so that binding of the aptamer to the target alters the biological function of von Willebrand Factor, thereby treating the pathology.

[00165] The patient or subject having a pathology, i.e., the patient or subject treated by the methods of this invention can be a mammal, more particularly a vertebrate, or more particularly, a human.

[00166] In practice, the aptamers or their pharmaceutically acceptable salts, are administered in amounts which will be sufficient to exert their desired biological activity, e.g., preventing vWF dependent platelet aggregation.

[00167] One aspect of the invention comprises an aptamer composition of the invention in combination with other treatments for thrombotic related disorders. The aptamer composition of the invention may contain, for example, more than one aptamer, e.g. an anti-thrombin aptamer and an anti-vWF aptamer. In some examples, an aptamer composition of the invention, containing one or more aptamers of the invention, is administered in combination with another useful composition such as an anti-inflammatory agent, an immunosuppressant, an antiviral agent, or the like. In general, the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.

[00168] "Combination therapy" (or "co-therapy") includes the administration of an aptamer composition of the invention and at least a second agent as part of a specific treatment regimen intended to provide the beneficial effect from the co-action of these therapeutic agents. The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents. Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).

[00169] "Combination therapy" may, but generally is not, intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy regimens that incidentally and arbitrarily result in the combinations of the present invention.
"Combination therapy" is intended to embrace administration of these therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.

[00170] Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination selected may be administered by injection while the other therapeutic agents of the combination may be administered topically.

[00171] Alternatively, for example, all therapeutic agents may be administered topically or all therapeutic agents may be administered by injection. The sequence in which the therapeutic agents are administered is not narrowly critical unless noted otherwise.
"Combination therapy" also can embrace the administration of the therapeutic agents as described above in further combination with other biologically active ingredients. Where the combination therapy further comprises a non-drug treatment, the non-drug treatment may be conducted at any suitable time so long as a beneficial effect from the co-action of the combination of the therapeutic agents and non-drug treatment is achieved. For example, in appropriate cases, the beneficial effect is still achieved when the non-drug treatment is temporally removed from the administration of the therapeutic agents, perhaps by days or even weeks.

[00172] Therapeutic or pharmacological compositions of the present invention will generally comprise an effective amount of the active component(s) of the therapy, dissolved or dispersed in a pharmaceutically acceptable medium. Pharmaceutically acceptable media or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art.
Supplementary active ingredients can also be incorporated into the therapeutic compositions of the present invention.

[00173] The preparation of pharmaceutical or pharmacological compositions will be known to those of skill in the art in light of the present disclosure.
Typically, such compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection;
as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inlialants and the like. The use of sterile formulations, such as saline-based washes, by surgeons, physicians or health care workers to treat a particular area in the operating field may also be particularly useful. Compositions may also be delivered via microdevice, microparticle or sponge.

[00174] Upon formulation, therapeutics will be administered in a manner compatible with the dosage formulation, and in such amount as is pharmacologically effective.
The formulations are easily administered in a variety of dosage forms. In a preferred embodiment the aptamer of the invention is formulated as an injectable solution described above, but drug release capsules and the like can also be employed.

[00175] In this context, the quantity of active ingredient and volume of composition to be administered depends on the host animal to be treated. Precise amounts of active compound required for administration depend on the judgment of the practitioner and are peculiar to each individual.

[00176] A minimal volume of a composition required to disperse the active compounds is typically utilized. Suitable regimes for administration are also variable, but would be typified by initially administering the compound and monitoring the results and then giving further controlled doses at further intervals. The effects of administration of the anti-vWF aptamer of the invention could be monitored by measuring platelet aggregation formation such as measuring botrocetin induced platelet aggregation ("BIPA") and/or shear force induced hemostatic plug formation using the PFA-100 instrument as described in Example 3 below.
[00177] For instance, for oral administration in the form of a tablet or capsule (e.g., a gelatin capsule), the active drug component can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like.
Moreover, when desired or necessary, suitable binders, lubricants, disintegrating agents and coloring agents can also be incorporated into the mixture. Suitable binders include starch, magnesium aluminum silicate, starch paste, gelatin, methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, polyethylene glycol, waxes and the like. Lubricants used in these dosage forms include sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride, silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol and the like. Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum starches, agar, alginic acid or its sodium salt, or effervescent mixtures, and the like. Diluents, include, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine.

[00178] Injectable compositions are preferably aqueous isotonic solutions or suspensions, and suppositories are advantageously prepared from fatty emulsions or suspensions. The compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances.
The compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and typically contain about 0.1 to 75%, preferably about 1 to 50%, of the active ingredient.

[00179] The compounds of the invention can also be administered in such oral dosage forms as timed release and sustained release tablets or capsules, pills, powders, granules, elixirs, tinctures, suspensions, syrups and emulsions.

[00180] Liquid, particularly injectable compositions can, for example, be prepared by dissolving, dispersing, etc. The active compound is dissolved in or mixed with a pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form the injectable solution or suspension.
Additionally, solid forms suitable for dissolving in liquid prior to injection can be formulated.

[00181] The compounds of the present invention can be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions.

[00182] Parenteral injectable administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, one approach for parenteral administration employs the implantation of a slow-release or sustained-released systems, which assures that a constant level of dosage is maintained, according to U.S. Pat.
No. 3,710,795, incorporated herein by reference.

[00183] Furthermore, preferred compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, inhalants, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Other preferred topical preparations include creams, ointments, lotions, aerosol sprays and gels, wherein the concentration of active ingredient would typically range from 0.01 % to 15%, w/w or w/v.

[00184] For solid compositions, excipients include pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like may be used. The active compound defined above, may be also formulated as suppositories using for example, polyalkylene glycols, for example, propylene glycol, as the carrier. In some embodiments, suppositories are advantageously prepared from fatty emulsions or suspensions.

[00185] The compounds of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid components is hydrated with an aqueous solution of drug to a fonn lipid layer encapsulating the drug, as described in U.S. Pat. No. 5,262,564. For example, the aptamer molecules described herein can be provided as a complex with a lipophilic compound or non-immunogenic, high molecular weight compound constructed using methods known in the art.
Additionally, liposomes may bear aptamers on their surface for targeting and carrying cytotoxic agents internally to mediate cell killing. An example of nucleic-acid associated complexes is provided in U.S. Patent No. 6,011,020.

[00186] The compounds of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl-methacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues.
Furthermore, the compounds of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels.
[00187] If desired, the pharmaceutical composition to be administered may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH
buffering agents, and other substances such as for example, sodium acetate, and triethanolamine oleate.

[00188] The dosage regimen utilizing the aptamers is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular aptamer or salt thereof employed.
An ordinarily skilled physician or veterinarian can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition.

[00189] Oral dosages of the present invention, when used for the indicated effects, will range between about 0.05 to 7500 mg/day orally. The compositions are preferably provided in the form of scored tablets containing 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100.0, 250.0, 500.0 and 1000.0 mg of active ingredient. Infused dosages, intranasal dosages and transdermal dosages will range between 0.05 to 7500 mg/day. Subcutaneous, intravenous and intraperitoneal dosages will range between 0.05 to 3800 mg/day.

[00190] Compounds of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily.
[00191] Effective plasma levels of the compounds of the present invention range from 0.002 mg/mL to 50 mg/mL. In the dosages of the present invention, mass refers only to the molecular weight of the oligonucleotide portion of the aptamer, irrespective of the mass conferred by PEG conjugation.

MODULATION OF PHARMACOKINETICS AND BIODISTRIBUTION OF APTAMER
THERAPEUTICS

[00192] It is important that the pharmacokinetic properties for all oligonucleotide-based therapeutics, including aptamers, be tailored to match the desired pharmaceutical application.
While aptamers directed against extracellular targets do not suffer from difficulties associated with intracellular delivery (as is the case with antisense and RNAi-based therapeutics), such aptamers must still be able to be distributed to target organs and tissues, and remain in the body (unmodified) for a period of time consistent with the desired dosing regimen.

[00193] Thus, the present invention provides materials and methods to affect the pharmacokinetics of aptamer compositions, and, in particular, the ability to tune aptamer pharmacokinetics. The tunability of (i.e., the ability to modulate) aptamer pharmacokinetics is achieved through conjugation of modifying moieties (e.g., PEG polymers) to the aptamer and/or the incorporation of modified nucleotides (e.g., 2'-fluoro or 2'-O-methyl) to alter the chemical composition of the nucleic acid. The ability to tune aptamer pharmacokinetics is used in the improvement of existing therapeutic applications, or alternatively, in the development of new therapeutic applications. For example, in some therapeutic applications, e.g., in anti-neoplastic or acute care settings where rapid drug clearance or turn-off may be desired, it is desirable to decrease the residence times of aptamers in the circulation.
Alternatively, in other therapeutic applications, e.g., maintenance therapies where systemic circulation of a therapeutic is desired, it may be desirable to increase the residence times of aptamers in circulation.

[00194] In addition, the tunability of aptamer pharmacokinetics is used to modify the biodistribution of an aptamer therapeutic in a subject. For example, in some therapeutic applications, it may be desirable to alter the biodistribution of an aptamer therapeutic in an effort to target a particular type of tissue or a specific organ (or set of organs). In these applications, the aptamer therapeutic preferentially accumulates in a specific tissue or organ(s). In other therapeutic applications, it may be desirable to target tissues displaying a cellular marker or a symptom associated with a given disease, cellular injury or other abnormal pathology, such that the aptamer therapeutic preferentially accumulates in the affected tissue. For example, as described in copending provisional application United States Serial No. 60/550790, filed on March 5, 2004, and entitled "Controlled Modulation of the Pharmacokinetics and Biodistribution of Aptamer Therapeutics), PEGylation of an aptamer therapeutic (e.g., PEGylation with a 20 kDa PEG polymer) is used to target inflamed tissues, such that the PEGylated aptamer therapeutic preferentially accumulates in inflamed tissue.
[00195] To determine the pharmacokinetic and biodistribution profiles of aptamer therapeutics (e.g., aptamer conjugates or aptamers having altered chemistries, such as modified nucleotides) a variety of parameters are monitored. Such parameters include, for example, the half-life (tliZ), the plasma clearance (CL), the volume of distribution (Vss), the area under the concentration-time curve (AUC), maximum observed serum or plasma concentration (C,,,aX), and the mean residence time (MRT) of an aptamer composition. As used herein, the term "AUC" refers to the area under the plot of the plasma concentration of an aptamer therapeutic versus the time after aptamer administration. The AUC
value is used to estimate the bioavailability (i.e., the percentage of administered aptamer therapeutic in the circulation after aptamer administration) and/or total clearance (CL) (i.e., the rate at which the aptamer therapeutic is removed from circulation) of a given aptamer therapeutic. The volume of distribution relates the plasma concentration of an aptamer therapeutic to the amount of aptamer present in the body. The larger the Vss, the more an aptamer is found outside of the plasma (i.e., the more extravasation).

[00196] The present invention provides materials and methods to modulate, in a controlled manner, the pharmacokinetics and biodistribution of stabilized aptamer compositions in vivo by conjugating an aptamer to a modulating moiety such as a small molecule, peptide, or polymer terminal group, or by incorporating modified nucleotides into an aptamer. As described herein, conjugation of a modifying moiety and/or altering nucleotide(s) chemical composition alter fundamental aspects of aptamer residence time in circulation and distribution to tissues.

[00197] In addition to clearance by nucleases, oligonucleotide therapeutics are subject to elimination via renal filtration. As such, a nuclease-resistant oligonucleotide administered intravenously typically exhibits an in vivo half-life of <10 min, unless filtration can be blocked. This can be accomplished by either facilitating rapid distribution out of the blood stream into tissues or by increasing the apparent molecular weight of the oligonucleotide above the effective size cut-off for the glomerulus. Conjugation of small therapeutics to a PEG polymer (PEGylation), described below, can dramatically lengthen residence times of aptamers in circulation, thereby decreasing dosing frequency and enhancing effectiveness against vascular targets.

[00198] Aptamers can be conjugated to a variety of modifying moieties, such as high molecular weight polymers, e.g., PEG; peptides, e.g., Tat (a 13-amino acid fragment of the HIV Tat protein (Vives, et al., (1997), J. Biol. Chem. 272(25): 16010-7)), Ant (a 16-amino acid sequence derived from the third helix of the Drosophila antennapedia homeotic protein (Pietersz, et al., (2001), Vaccine 19(11-12): 1397-405)) and Arg7 (a short, positively charged cell-permeating peptides composed of polyarginine (Arg7) (Rothbard, et al., (2000), Nat.
Med. 6(11): 1253-7; Rothbard, J et al., (2002), J. Med. Chem. 45(17): 3612-8)); and small molecules, e.g., lipophilic compounds such as cholesterol. Among the various conjugates described herein, in vivo properties of aptamers are altered most profoundly by complexation with PEG groups. For example, complexation of a mixed 2'F and 2'-OMe modified aptamer therapeutic with a 20 kDa PEG polymer hinders renal filtration and promotes aptamer distribution to both healthy and inflamed tissues. Furthermore, the 20 kDa PEG
polymer-aptamer conjugate proves nearly as effective as a 40 kDa PEG polymer in preventing renal filtration of aptamers. While one effect of PEGylation is on aptamer clearance, the prolonged systemic exposure afforded by presence of the 20 kDa moiety also facilitates distribution of aptamer to tissues, particularly those of highly perfused organs and those at the site of inflammation. The aptamer-20 kDa PEG polymer conjugate directs aptamer distribution to the site of inflammation, such that the PEGylated aptamer preferentially accumulates in inflamed tissue. In some instances, the 20 kDa PEGylated aptamer conjugate is able to access the interior of cells, such as, for example, kidney cells.

[00199] Modified nucleotides can also be used to modulate the plasma clearance of aptamers. For example, an unconjugated aptamer which incorporates both 2'-F
and 2'-OMe stabilizing chemistries, which is typical of current generation aptamers as it exhibits a high degree of nuclease stability in vitro and in vivo, displays rapid loss from plasma (i.e., rapid plasma clearance) and a rapid distribution into tissues, primarily into the kidney, when compared to unmodified aptamer.

PEG-DERIVATIZED NUCLEIC ACIDS

[00200] As described above, derivatization of nucleic acids with high molecular weight non-immunogenic polymers has the potential to alter the pharmacokinetic and pharmacodynamic properties of nucleic acids making them more effective therapeutic agents.
Favorable changes in activity can include increased resistance to degradation by nucleases, decreased filtration through the kidneys, decreased exposure to the immune system, and altered distribution of the therapeutic through the body.

[00201] The aptamer compositions of the invention may be derivatized with polyalkylene glycol (PAG) moieties. Examples of PAG-derivatized nucleic acids are found in United States Patent Application Ser. No. 10/718,833, filed on November 21, 2003, which is herein incorporated by reference in its entirety. Typical polymers used in the invention include poly(ethylene glycol) (PEG), also known as poly(ethylene oxide) (PEO) and polypropylene glycol (including poly isopropylene glycol). Additionally, random or block copolymers of different alkylene oxides (e.g., ethylene oxide and propylene oxide) can be used in many applications. In its most common form, a polyalkylene glycol, such as PEG, is a linear polymer terminated at each end with hydroxyl groups: HO-CH2CH2O-(CH2CH2O) n CH2CHa-OH. This polymer, alpha-, omega-dihydroxylpoly(ethylene glycol), can also be represented as HO-PEG-OH, where it is understood that the -PEG- symbol represents the following structural unit: -CH2CH2O-(CH2CH2O) n CHZCH2- where n typically ranges from about 4 to about 10,000.

[00202] As shown, the PEG molecule is di-functional and is sometimes referred to as "PEG diol." The terminal portions of the PEG molecule are relatively non-reactive hydroxyl moieties, the -OH groups, that can be activated, or converted to functional moieties, for attachment of the PEG to other compounds at reactive sites on the compound.
Such activated PEG diols are referred to herein as bi-activated PEGs. For example, the terminal moieties of PEG diol have been functionalized as active carbonate ester for selective reaction with amino moieties by substitution of the relatively nonreactive hydroxyl moieties, -OH, with succinimidyl active ester moieties from N-hydroxy succinimide.

[00203] In many applications, it is desirable to cap the PEG molecule on one end with an essentially non-reactive moiety so that the PEG molecule is mono-functional (or mono-activated). In the case of protein therapeutics which generally display multiple reaction sites for activated PEGs, bi-functional activated PEGs lead to extensive cross-linking, yielding poorly functional aggregates. To generate mono-activated PEGs, one hydroxyl moiety on the terminus of the PEG diol molecule typically is substituted with non-reactive methoxy end moiety, -OCH3. The other, un-capped terminus of the PEG molecule typically is converted to a reactive end moiety that can be activated for attachment at a reactive site on a surface or a molecule such as a protein.

[00204] PAGs are polymers which typically have the properties of solubility in water and in many organic solvents, lack of toxicity, and lack of immunogenicity. One use of PAGs is to covalently attach the polymer to insoluble molecules to make the resulting PAG-molecule "conjugate" soluble. For example, it has been shown that the water-insoluble drug paclitaxel, when coupled to PEG, becomes water-soluble. Greenwald, et al., J. Org. Chem., 60:331-336 (1995). PAG conjugates are often used not only to enhance solubility and stability but also to prolong the blood circulation half-life of molecules.

[00205] Polyalkylated compounds of the invention are typically between 5 and 80 kDa in size however any size can be used, the choice dependent on the aptamer and application.
Other PAG compounds of the invention are between 10 and 80 kDa in size. Still other PAG
compounds of the invention are between 10 and 60 kDa in size. For example, a PAG polymer may be at least 10, 20, 30, 40, 50, 60, or 80 kDa in size. Such polymers can be linear or branched.

[00206] In contrast to biologically-expressed protein therapeutics, nucleic acid therapeutics are typically chemically synthesized from activated monomer nucleotides. PEG-nucleic acid conjugates may be prepared by incorporating the PEG using the same iterative monomer synthesis. For example, PEGs activated by conversion to a phosphoramidite form can be incorporated into solid-phase oligonucleotide synthesis. Alternatively, oligonucleotide synthesis can be completed with site-specific incorporation of a reactive PEG
attachment site.
Most commonly this has been accomplished by addition of a free primary amine at the 5'-terminus (incorporated using a modifier phosphoramidite in the last coupling step of solid phase synthesis). Using this approach, a reactive PEG (e.g., one which is activated so that it will react and form a bond with an amine) is combined with the purified oligonucleotide and the coupling reaction is carried out in solution.

[00207] The ability of PEG conjugation to alter the biodistribution of a therapeutic is related to a number of factors including the apparent size (e.g., as measured in terms of hydrodynamic radius) of the conjugate. Larger conjugates (>lOkDa) are known to more effectively block filtration via the kidney and to consequently increase the serum half-life of small macromolecules (e.g., peptides, antisense oligonucleotides). The ability of PEG
conjugates to block filtration has been shown to increase with PEG size up to approximately 50 kDa (further increases have minimal beneficial effect as half life becomes defined by macrophage-mediated metabolism rather than elimination via the kidneys).

[00208] Production of high molecular weight PEGs (>10 kDa) can be difficult, inefficient, and expensive. As a route towards the synthesis of high molecular weight PEG-nucleic acid conjugates, previous work has been focused towards the generation of higher molecular weight activated PEGs. One method for generating such molecules involves the formation of a branched activated PEG in which two or more PEGs are attached to a central core carrying the activated group. The terminal portions of these higher molecular weight PEG molecules, i.e., the relatively non-reactive hydroxyl (-OH) moieties, can be activated, or converted to functional moieties, for attachment of one or more of the PEGs to other compounds at reactive sites on the compound. Branched activated PEGs will have more than two termini, and in cases where two or more termini have been activated, such activated higher molecular weight PEG molecules are referred to herein as, multi-activated PEGs. In some cases, not all termini in a branch PEG molecule are activated. In cases where any two termini of a branch PEG molecule are activated, such PEG molecules are referred to as bi-activated PEGs. In some cases where only one terminus in a branch PEG molecule is activated, such PEG
molecules are referred to as mono-activated. As an example of this approach, activated PEG
prepared by the attachment of two monomethoxy PEGs to a lysine core which is subsequently activated for reaction has been described (Harris et al., Nature, vol.2: 214-221, 2003).

[00209] The present invention provides another cost effective route to the synthesis of high molecular weight PEG-nucleic acid (preferably, aptamer) conjugates including multiply PEGylated nucleic acids. The present invention also encompasses PEG-linked multimeric oligonucleotides, e.g., dimerized aptamers. The present invention also relates to high molecular weight compositions where a PEG stabilizing moiety is a linker which separates different portions of an aptamer, e.g., the PEG is conjugated within a single aptamer sequence, such that the linear arrangement of the high molecular weight aptamer composition is, e.g., nucleic acid - PEG - nucleic acid (- PEG - nucleic acid)r, where n is greater than or equal to 1.

[00210] High molecular weight compositions of the invention include those having a molecular weight of at least 10 kDa. Compositions typically have a molecular weight between 10 and 80 kDa in size. High molecular weight compositions of the invention are at least 10, 20, 30, 40, 50, 60, or 80 kDa in size.

[00211] A stabilizing moiety is a molecule, or portion of a molecule, which improves pharmacokinetic and pharmacodynamic properties of the high molecular weight aptamer compositions of the invention. In some cases, a stabilizing moiety is a molecule or portion of a molecule which brings two or more aptamers, or aptamer domains, into proximity, or provides decreased overall rotational freedom of the high molecular weight aptamer compositions of the invention. A stabilizing moiety can be a polyalkylene glycol, such a polyethylene glycol, which can be linear or branched, a homopolymer or a heteropolymer.
Other stabilizing moieties include polymers such as peptide nucleic acids (PNA).
Oligonucleotides can also be stabilizing moieties; such oligonucleotides can include modified nucleotides, and/or modified linkages, such as phosphorothioates. A
stabilizing moiety can be an integral part of an aptamer composition, i.e., it is covalently bonded to the aptamer.

[00212] Compositions of the invention include high molecular weight aptamer compositions in which two or more nucleic acid moieties are covalently conjugated to at least one polyalkylene glycol moiety. The polyalkylene glycol moieties serve as stabilizing moieties. In compositions where a polyalkylene glycol moiety is covalently bound at either end to an aptamer, such that the polyalkylene glycol joins the nucleic acid moieties together in one molecule, the polyalkylene glycol is said to be a linking moiety. In such compositions, the primary structure of the covalent molecule includes the linear arrangement nucleic acid-PAG-nucleic acid. One example is a composition having the primary structure nucleic acid-PEG-nucleic acid. Another example is a linear arrangement of: nucleic acid -PEG - nucleic acid - PEG - nucleic acid.

[00213] To produce the nucleic acid-PEG-nucleic acid conjugate, the nucleic acid is originally synthesized such that it bears a single reactive site (e.g., it is mono-activated). In a preferred embodiment, this reactive site is an amino group introduced at the 5'-terminus by addition of a modifier phosphoramidite as the last step in solid phase synthesis of the oligonucleotide. Following deprotection and purification of the modified oligonucleotide, it is reconstituted at high concentration in a solution that minimizes spontaneous hydrolysis of the activated PEG. In a preferred embodiment, the concentration of oligonucleotide is 1 mM and the reconstituted solution contains 200 mM NaHCO3-buffer, pH 8.3. Synthesis of the conjugate is initiated by slow, step-wise addition of highly purified bi-functional PEG. In a preferred embodiment, the PEG diol is activated at both ends (bi-activated) by derivatization with succinimidyl propionate. Following reaction, the PEG-nucleic acid conjugate is purified by gel electrophoresis or liquid chromatography to separate fully-, partially-, and un-conjugated species. Multiple PAG molecules concatenated (e.g., as random or block copolymers) or smaller PAG chains can be linked to achieve various lengths (or molecular weights). Non-PAG linkers can be used between PAG chains of varying lengths.

[00214] The 2'-O-methyl, 2'-fluoro and other modified nucleotide modifications stabilize the aptamer against nucleases and increase its half life in vivo. The 3'-3'-dT
cap also increases exonuclease resistance. See, e.g., U.S. Patents 5,674,685;
5,668,264; 6,207,816;
and 6,229,002, each of which is incorporated by reference herein in its entirety.

PAG-DERIVATIZATION OF A REACTIVE NUCLEIC ACID

[00215] High molecular weight PAG-nucleic acid-PAG conjugates can be prepared by reaction of a mono-functional activated PEG with a nucleic acid containing more than one reactive site. In one embodiment, the nucleic acid is bi-reactive, or bi-activated, and contains two reactive sites: a 5'-amino group and a 3'-amino group introduced into the oligonucleotide through conventional phosphoramidite synthesis, for example: 3'-5'-di-PEGylation as illustrated in Figure 2. In alternative embodiments, reactive sites can be introduced at internal positions, using for example, the 5-position of pyrimidines, the 8-position of purines, or the 2'-position of ribose as sites for attachment of primary amines. In such embodiments, the nucleic acid can have several activated or reactive sites and is said to be multiply activated.
Following synthesis and purification, the modified oligonucleotide is combined with the mono-activated PEG under conditions that promote selective reaction with the oligonucleotide reactive sites while minimizing spontaneous hydrolysis. In the preferred embodiment, monomethoxy-PEG is activated with succinimidyl propionate and the coupled reaction is carried out at pH 8.3. To drive synthesis of the bi-substituted PEG, stoichiometric excess PEG is provided relative to the oligonucleotide. Following reaction, the PEG-nucleic acid conjugate is purified by gel electrophoresis or liquid chromatography to separate fully-, partially-, and un-conjugated species.

[00216] The linking domains can also have one or more polyalkylene glycol moieties attached thereto. Such PAGs can be of varying lengths and may be used in appropriate combinations to achieve the desired molecular weight of the composition.

[00217] The effect of a particular linker can be influenced by both its chemical composition and length. A linker that is too long, too short, or forms unfavorable steric and/or ionic interactions with the target will preclude the formation of complex between aptamer and target. A linker, which is longer than necessary to span the distance between nucleic acids, may reduce binding stability by diminishing the effective concentration of the ligand. Thus, it is often necessary to optimize linker compositions and lengths in order to maximize the affinity of an aptamer to a target.

[00218] All publications and patent documents cited herein are incorporated herein by reference as if each such publication or document was specifically and individually indicated to be incorporated herein by reference. Citation of publications and patent documents is not intended as an admission that any is pertinent prior art, nor does it constitute any admission as to the contents or date of the same. The invention having now been described by way of written description, those of skill in the art will recognize that the invention can be practiced in a variety of embodiments and that the foregoing description and examples below are for purposes of illustration and not limitation of the claims that follow.

EXAMPLES
EXAMPLE 1: APTAMER SELECTION AND SEQUENCES

EXAMPLE 1A: Selection of rRfY vWF domain Al aptamers [00219] Selections were performed to identify aptamers that bind to human or rabbit vWF
Al domain using a nucleotide pool consisting of 2'-OH purine and 2'-F
pyrimidine nucleotides (rRfY). The selection strategy yielded high affinity aptamers specific for human and rabbit vWF Al domains which had been immobilized on a hydrophobic plate.

Pool Preparation [00220] A DNA template with the sequence 5'-GGAGCGCACTCAGCCAC
NNNNNNNTTTCGACCTCTCTGCTAGC 3' (SEQ ID NO 8) was synthesized using an ABI EXPEDITETM DNA synthesizer, and deprotected by standard methods. The series of N's in the DNA template (SEQ ID NO 8) can be any combination of nucleotides and gives rise to the unique sequence region of the resulting aptamers. The template was amplified with the primers 5' -TAATACGACTCACTATAGGAGCGCACTCAGCCAC -3' (SEQ ID NO 9) and 5'- GCTAGCAGAGAGGTCGAAA -3' (SEQ ID NO 10) and then used as a template for in vitro transcription with T7 RNA polymerase (Y639F). Transcriptions were, typically, incubated at 37 C overnight, using 40 mM Tris pH 8.0, 40 mM DTT, 1 mM
spermidine-HCl, 0.002% TritonX-100, 4% (w/v) PEG-8000, 12 mM MgClz, 3 mM 2'-F-CTP, 3 mM 2'-F-UTP, 3 mM GTP, 3 mM ATP, 0.5X inorganic pyrophosphatase, and 1X T7 polymerase (Y639F), and approximately.5 M template DNA.

Selection [00221] For the human vWF Al domain selection, the first ten rounds were initiated by immobilizing 24 pmoles of human vWF Al domain ( SEQ ID NO 4, Figure 4) to the surface of a Nunc Maxisorp hydrophobic plate (Nunc Cat.# 446612, Rochester, NY) for 1 hour at room temperature in 100 L of 1X Dulbecco's PBS (Gibco BRL Cat.# 14040-133, Carlsbad, CA). For Rounds eleven and twelve, 12 pmoles of full length human vWF (SEQ ID
NO 7, accession number vwHU, available from Calbiochem Cat.# 681300, La Jolla, CA) were immobilized to the hydrophobic plate. For the rabbit vWF selection, each round was initiated by immobilizing 24 pmoles of rabbit vWF Al domain (SEQ ID NO 6: accession numberAAB51555, Figure 3) under the same conditions as for human vWF Al domain.
[00222] In all cases, after one hour of protein immobilization, the supematant was removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. The protein-immobilized well was then blocked with 100 uL blocking buffer (1X Dulbecco's PBS with 1% BSA) for 1 hour at room temperature. In Round one, 333 pmoles of pool RNA
(2 x 1014 unique molecules) were incubated in 100 L 1X Dulbecco's PBS in the wells containing BSA-blocked immobilized protein target for 1 hour at room temperature. The supernatant was then removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. In later rounds, additional washes were added to increase the stringency of the positive selection step (see Tables 1 and 2). Starting at Round 2 and in all subsequent rounds, two negative selection steps were included before the positive selection step. First, the pool RNA was incubated for 1 hour at room temperature in an unblocked well to remove any plastic binding sequences from the pool. In the second negative selection step, the RNA was transferred to a BSA blocked well (not containing the protein target) for 1 hour at room temperature to remove any BSA binding sequences from the pool prior to the positive selection. Starting at Round 2 and in all subsequent rounds, 0.1 mg/mL tRNA and 0.1 mg/mL salmon sperm DNA
were spiked into the positive selection reaction as non-specific competitors.
In all cases, the pool RNA bound to the immobilized protein target was reverse transcribed directly in the selection plate with the addition of RT mix (Round 1: 100 uL; Round 2+: 50 uL;
containing the 3'-primer according to SEQ ID NO 10 and Thermoscript RT (Invitrogen Cat. #

016, Carlsbad, CA) followed by incubation at 65 C for 1 hour.

[00223] The resulting cDNA was used as a template for PCR (Round 1: 500 uL;
Round 2+: 250 uL; containing the 5'-primer according to (SEQ ID NO 9), the 3'-primer according to (SEQ ID NO 10), and Taq polymerase (New England Biolabs Cat.# M0267L, Beverly, MA)). PCR reactions were done under the following conditions: a) denaturation step: 94 C
for 2 minutes; b) cycling steps: 94 C for 30 seconds, 60 C for 30 seconds, 72 C for 1 minute;
c) final extension step: 72 C for 3 minutes. The cycles were repeated until sufficient PCR
product was generated. The minimum number of cycles required to generate sufficient PCR

product is reported in Tables 1 and 2 as the "PCR Threshold". The amplified pool template DNA was then isopropanol precipitated and half of the PCR product was used as template for the transcription of pool RNA for the next round of selection. The transcribed RNA pool was gel purified using a 10% polyacrylamide gel every third round. When not gel-purified, the transcribed RNA pool was desalted using two Centri-Spin 10 columns (Princeton Separations Cat. # CS-101, Adelphia, NJ). In all cases, an equivalent of one-tenth of the total transcription product was carried forward as the starting pool for the subsequent round of selection.

Table 1 Human vWF Al domain selection conditions using an rRfY pool Round Target Washes PCR Purification Threshold 1 24 pmol hAl 4 x 120uL 16 Desalt (2x) 2 24 pmol hAl 4 x 120uL 18 Desalt (2x) 3 24 pmol hAl 4 x 120uL 16 Gel purify 4 24 pmol hAl 8 x 120uL 15 Desalt (2x) 24 pmol hAl 8 x 120uL 15 Desalt (2x) 6 24 pmol hAl 8 x 120uL 15 Gel purify 7 24 pmol hAl 8 x 120uL 12 Desalt (2x) 8 24 pmol hAl 8 x 120uL 12 Desalt (2x) 9 24 pmol hAl 8 x 120uL 10 Gel purify 24 pmol hAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 min. each) 11 12 pmol full length 6 x 120uL; 20 Desalt (2x) VWF 2 x 120uL (15 min. each) 12 12 pmol full length 6 x 120uL; 15 Gel purify vVYT 2 x 120uL (15 min. each) Table 2. Rabbit vWF Al domain selection conditions using an rRfY pool Round Target Washes PCR Purification Threshold 1 24 pmol rAl 4 x 120uL 16 Desalt (2x) 2 24 pmol rAl 4 x 120uL 18 Desalt (2x) 3 24 pmol rAl 4 x 120uL 16 Gel purify 4 24 pmol rAl 8 x 120uL 15 Desalt (2x) 24 pmol rAl 8 x 120uL 15 Desalt (2x) 6 24 pmol rAl 8 x 120uL 15 Gel purify 7 24 pmol rAl 8 x 120uL 12 Desalt (2x) 8 24 pmol rAl 8 x 120uL 12 Desalt (2x) 9 24 pmol rAl 8 x 120uL 10 Gel purify 24 pmol rAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 min. each) 11 24 pmol rAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 min. each) 12 24 pmol rAl 6 x 120uL; 10 Gel purify 2x120uL(15 min. each) vWF domain Al Binding Analysis [00224] The selection progress was monitored using a sandwich filter binding assay. The 5' 32P-labeled pool RNA (trace concentration) was incubated with either a no target protein control, 100 nM human vWF Al domain (SEQ ID NO 4) or 100 nM rabbit vWF Al domain (SEQ ID NO 6) in 1X Dulbecco's PBS containing 0.1 mg/mL tRNA, and 0.1 mg/mL
salmon sperm DNA (in a final volume of 50 uL) for 30 minutes at room temperature and then applied to a nitrocellulose and nylon filter sandwich in a dot blot apparatus (Schleicher and Schuell, Keene, NH). The percentage of pool RNA bound to the nitrocellulose was calculated after Rounds 6, 9, and 12 with a three point screen (100 nM human vWF Al domain, 100 nM
rabbit vWF Al domain, and a no-target control). Pool binding was compared to that of the naive pool RNA (Round 0). The results of the rRfY pool binding analyses are found in Table 3.

Table 3. vWF Al domain rRfY selection pool binding assays.

Selection Pool Round 100nM human 100nM rabbit No Protein Al Al Naive Pool Round 0 11.2% 14.3% 10.5%
Human vWF Al Round 6 16.0% 16.9% 13.8%
Rabbit vWF Al Round 6 15.2% 17.9% 14.7%
Human vWF Al Round 9 14.7% 14.3% 10.5%
Rabbit vWF Al Round 9 13.7% 14.7% 10.1%
Human vWF Al Round 12 31.8% 33.1% 13.2%
Rabbit vWF Al Round 12 24.1% 17.7% 10.3%
[00225] When a significant positive ratio of binding of RNA in the presence of human or rabbit vWF Al domain versus in the absence of protein was seen, the pools were cloned using the TOPO TA cloning kit (Invitrogen, Cat.# 45-0641, Carlsbad, CA) according to the manufacturer's instructions. Round 9 and 12 pool templates were cloned and sequenced (125 total sequences), producing 48 unique clones. All unique clones were transcribed, desalted, 5-32p end-labeled, and assayed in a 3-point dot blot screen (no protein target control, 100 nM
human vWF Al domain (SEQ ID NO 5, Figure 3), or 100 nM rabbit vWF Al domain (SEQ
ID NO 6, Figure 3). The data is presented in the third and fourth columns of Table 4 below as the ratio of the fraction of the aptamer bound to the nitrocellulose in the presence of the target protein to the fraction of aptamer bound in the absence of the target protein.

[00226] Based on this initial screen, KDs were determined for 12 of the best vWF
dependent binding sequences using the dot blot assay and are reported in column 5 of Table 4 below. For KD determination, aptamers transcripts were purified on 10%
denaturing polyacrylamide gels, 5'end labeled with y-32P ATP. An 8 point titration of human vWF Al domain (SEQ ID NO 5) was used in the dot blot assay (1 uM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 0 nM), and KD values were calculated by fitting the equation y=
(max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Software) For all dot blot assays used to determine single clone KDS in the Examples described herein, the target protein, e.g. human vWF Al domain, is diluted with 1X Dulbecco's PBS buffer which includes 0.1 mg/mL BSA and incubated with labeled aptamer for 30 minutes at 24 C
prior to filtration and quantitation.

Table 4. Human and rabbit vWF Al domain rRfY aptamer binding activity*
(ND= not done) Aptamer Screen- Screen- human Human/No Protein Rabbit/No Protein Al KD
(nM) (AMX201.B1) (SEQ ND ND 19 ID NO 11) (AMX198.G1)SEQ 1.89 1.90 45 (ANIX201.H3)SEQ 1.88 1.89 90 (AMX201.B3)SEQ 1.69 1.64 ND

(AlVIX201.G1)SEQ 2.14 2.20 190 (AMX198.C6)SEQ 3.03 4.62 249 (AMX201.B11)SEQ 1.55 1.52 ND

(AMX201.D10)SEQ 1.59 1.52 ND

(AMX198.C10)SEQ 1.40 3.39 555 (ANIX201.H4) SEQ 1.79 1.86 ND

(AlVIX201.G9)SEQ 2.06 2.11 182 (A1VIX201.H11)SEQ 1.75 1.40 ND

(AlVIX201.C8)SEQ 2.47 1.50 0.2 (AMX201.H1)SEQ 2.61 2.46 189 (AMX198.E11)SEQ 1.03 2.37 1056 (AMX198.A10)SEQ 1.26 5.74 1860 (AIvIX201.D4)SEQ 2.23 2.46 ND

(AMX201.D3)SEQ 1.76 1.52 ND

(AlVIX201.A8)SEQ 1.82 1.51 ND

(A1VIX198.E5)SEQ 1.60 1.56 172 * used human vWF Al domain SEQ ID NO 5 for aptamer screen and aptamer KDs [00227] The nucleic acid sequences of the rRfY aptamers characterized in Table above are given below. The unique sequence of each aptamer below begins at nucleotide 18, immediately following the sequence GGAGCGCACTCAGCCAC (SEQ ID NO 221), and runs until it meets the 3'fixed nucleic acid sequence TTTCGACCTCTCTGCTAGC (SEQ
ID
NO 222).

[002281 Unless noted otherwise, individual sequences listed below are represented in the 5' to 3' orientation and were selected under rRfY SELEXTM conditions wherein the purines (A
and G) are 2'-OH (ribo) and the pyrimidines (U and C) are 2'-fluoro.

(AMX201.B1) SEQ ID NO 11 GGAGCGCACUCAGCCACAGAGCCCUGAGUGUAUGAUCGCCUAGAUCUAUCGAUGCUUUUUCGACCUCUCUGCUAGC
(AMX198.Gl) SEQ ID NO 12 GGAGCGCACUCAGCCACAACACUAAUGGGGAAAGUUCAAGGAUUCUUGACCGGUGCGUUUCGACCUCUCUGCUAGC
(AMX201.H3) SEQ ID NO 13 DnVnDDnDnDnDDVDDnnnOZ)vDVDVDDDnnVDDnDDDnDVVDnDnOnVDnnnDdnDnnDvnDDdDnDVnnDndnn 0~ ON CII OHS (9H'86IXWV) nDVnDDnDnDnnDVDnnnnnnDnnnODDDDdnDndDvVnnnnnndDnndDvnDnDnDvnDDdDnDdDnDDVDn 6Z ON CII baS (8V' I OZXYid) DDVnDnnDnDnDDVDDnnnDnnDDDa nnDnvDnnnDvnDnDVnvnnVVVDnDDdDDDnDvnDDdDna danDDdDn 8Z ON cli bas (~Q'iOZXwv) anVnDnnnnDnDDdnDnnnnnDDnvnnwDnnnDnnnDvnvDndDnDnnnvDnanDnnnDdDDOdDna dDnnDVDn LZ ON CII 69S (t,(I'iOZXWV) a DVnDDnDna nDavDDnnnnDnnDnnVDnDnnnDvnnnnOnDDnnnDnDnDnnVnnndDDVDDDVDnDVanDDvDD
9Z ON GI 69S (OiV'861XWd) DDvnDDnDnDnDDVnDnnnnDnDa nn~~~DVVnnnna nndDDnDDDnnnDnnvDvVnnnnVDDOdDnDVanDnVDD
SZ ON GI baS (i IT86IXWV) nnvnnnnDnDnDDvDDnnnDDnnnnDvnnndnDDnnDDnnDnDnDnDVV'VnnDnDdnnnnVDDDdDnDdDnDDv~D
t7Z ON GI 69S (IH'IOZXWV) D
1JVnDDf1DI1onDOYJDnnnn DI1D99f1a9aa9n9Rna 'dLJntVDVVnnnnV~ 9VV39DnDD3V3D9VD
nDF~DDDDdJJ
~Z ON CEI 6RS (0t,8a2iV) (8D' IOZXYVV) DDVnDDnDnDnDDVnDnnnnnnnDnnnvnDnwtVDDndDnnVnDDnnnnDnDnnDnDDDdDa DVDnDVDnDndDn ZZ ON GI OAS Q IH'iOZXYIV) DnVnDnnDnDnDOdnnnnnnDDndDndvDddDnndnVVVnDdDndDnDndDnDDnDvVnDdDa ndDnDdDnDDVDD
IZ ON CE[ aaS (60 'IOZXWV) DnVnDnnDnDnDadDDnnnDnnnvnnvdDwDnnvnVVnDVDnvDnDnVnnn~~DVVnnVDDDdOnDdDnDndDD
OZ ON (If aaS (bH'IOZXYiV) DnVnDnnDnDnDDdDDnnnnnnDndDnnnDDDVnDndnDdnnnnndnDDdnnDDnnnnDVDDndDnDdDnnDdnn 6i ON GI 69S (Oia"861XWV) DndnDnnDnDnDDdnDnnndnnnnDnnDnnDdvnnVDdDDdnDndndnDnDnDdDna VDvDDnvDnDvDnDDVDn 81 ON CEI 6aS (O i Q' I OZXWV) DndnDnnDnDna DVDDnnnVVDnnDDnDDnDwDndDVnDdnDnVnVDDnDDnVnDDvDdDDDda nDVDnDnvnn L I ON CEI aHS (I I g' I OZXYid) DDdnDDnDnDnDDVnDnnnnnDnnnDnDnvDnnnwnndnndnVDnDdDnnvDnnDnnnDVODDdDnDdDDa DdDn 91 ON GI OHS (9D'861XWV) DnvnDDnDnDnDDVna nnnnDnnnnnDvnDnnnnVVnDDnvnnnnvwDDnnnDDDnDnDdDDnvDnDvDnDDdDD
Si ON CEI 6aS (iJ'IOZXWV) DDdnDnnDnDnDDdDDnnnnnDDnvgDnVnDndDvDDDnDndgndnnnDVDnDDa nVndDdDDDda nOVDDDDdDn t, I ON cli aaS (~g'IOZXwN) DnvnDnnDnDnDDdDDnnnnDDnVDndvDvdDnDVnVVVnDVnndDnOndnnnDnDvVnDvDDDdDnDvDnDDVDD
b~iZ~o/00ZS11/13a bS8~~0/900Z OAc1 SO-~0-LOOZ bL~6LSZ0 FIO

[00229] While not wishing to be bound by any theory, based on the binding data presented in Table 4 above and the activity in cellular assays presented in Table 21 below for both the full length aptamers from this SELEXTM selection and the minimized aptamer sequences (see Example 2a below) the predicted generic secondary structure and predicted core nucleic acid sequence required for binding to the vWF target of all embodiments of the invention derived from this aptamer selection is depicted in Figure 10 as SEQ ID NO 217 (RNAstructure, Version 4.1, Mathews, D.H.; Disney, M.D.; Childs, J.L.; Schroeder, S.J.;
Zuker, M.; and Turner, D.H., "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure," 2004. Proceedings of tlze National Acadefny of Sciences, US, 101, 7287-7292).. ARC840 (SEQ ID NO 23) is one example of an aptamer having the sequence depicted in Figure 10 wherein the bold, underlined regions shown in the sequence listed above denote required bases.

EXAMPLE 1B: Selection of rRdY vWF domain Al aptamers [00230] Selections were performed to identify aptamers that bind to (1) human vWF Al domain, (2) rabbit vWF Al domain, or (3) human and rabbit vWF Al domains using a nucleotide pool consisting of 2'-OH purine and deoxy-pyrimidine nucleotides (rRdY). The selection strategy yielded high affinity aptamers specific for human and rabbit vWF Al domains which had been immobilized on a hydrophobic plate.

Pool Preparation [00231] A DNA template with the sequence 5'-GGAGCGCACTCAGCCAC
NNNNNNNTTTCGACCTCTCTGCTAGC 3' (SEQ ID NO 8) was synthesized using an ABI EXPEDITETM DNA synthesizer, and deprotected by standard methods. The series of N's in the DNA template (SEQ ID NO 8) can be any combination of nucleotides and gives rise to the unique sequence region of the resulting aptamers. The template was amplified with the primers 5'- TAATACGACTCACTATAGGAGCGCACTCAGCCAC -3' (SEQ ID NO 9) and 5'- GCTAGCAGAGAGGTCGAAA -3' (SEQ ID NO 10) and then used as a template for in vitro transcription with T7 RNA polymerase (Y639F). Transcriptions were, typically, incubated at 37 C overnight, using 40 mM Tris pH 8.0,40 mM DTT, 1 mM
spermidine-HC1, 0.002 % Triton X-100, 4% (w/v) PEG-8000, 12 mM MgC12, 3 mM dCTP, 3 mM dTTP, 3 mM rGTP, 3 mM rATP, 0.5X inorganic pyrophosphatase, and 1X T7 polymerase (Y639F), and approximately.5 M template DNA.

Selection [00232] For the human vWF selection, the first ten rounds were initiated by immobilizing 24 pmoles of human vWF Al domain (SEQ ID NO 4) to the surface of a Nunc Maxisorp hydrophobic plate (Nunc, Cat.# 446612 Rochester, NY) for 1 hour at room temperature in 100 L of 1X Dulbecco's PBS (Gibco BRL Cat.# 14040-133, Carlsbad, CA). For Rounds eleven and twelve, 12 pmoles of full length human vWF (SEQ ID NO 7, Figure 4) were immobilized to the hydrophobic plate. For the rabbit vWF selection, each round was initiated by immobilizing 24 pmoles of rabbit vWF Al domain (SEQ ID NO 6) under the same conditions. For the first two rounds of the human/rabbit alternating selection 12 pmoles of human vWF Al domain (SEQ ID NO 4) and 12 pmoles of rabbit vWF Al domain (SEQ
ID
NO 6) were immobilized to a hydrophobic plate as previously described. In the subsequent rounds of the alternating selection, the protein target was alternated each round between the human and rabbit vWF Al domain (SEQ ID NOS 4 and 5, respectively), except in round 11, human full length vWF (SEQ ID NO 7) was used.

[00233] In all cases, after one hour of protein immobilization, the supernatant was removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. The protein-immobilized well was then blocked with 100 uL blocking buffer (1X Dulbecco's PBS with 1% BSA) for 1 hour at room temperature. In Round one, 333 pmoles of pool RNA
(2 x 1014 unique molecules) were incubated in 100 L 1X Dulbecco's PBS in the wells containing BSA-blocked immobilized protein target for 1 hour at room temperature. The supernatant was then removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. In later rounds, additional washes were added to increase the stringency of the positive selection step (see Tables 5, 6, and 7). Starting at Round 2 and in all subsequent rounds, two negative selection steps were included before the positive selection step. First, the pool RNA was incubated for 1 hour at room temperature in an unblocked well to remove any plastic binding sequences from the pool. In the second negative selection step, the RNA was transferred to a BSA blocked well (not containing the protein target) for 1 hour at room temperature to remove any BSA binding sequences from the pool prior to the positive selection. Starting at Round 2 and in all subsequent rounds, 0.1 mg/mL tRNA and 0.1 mg/mL salmon sperm DNA
were spiked into the positive selection reaction as non-specific competitors.

[00234] In all cases, the pool RNA bound to the immobilized protein target was reverse transcribed directly in the selection plate with the addition of RT mix (Round 1: 100 uL;
Round 2+: 50 uL; containing the 3'-primer according to (SEQ ID NO 10) and Thermoscript RT (Invitrogen, Cat.# 11146-016, Carlsbad, CA) followed by incubation at 65 C
for 1 hour.
The resulting cDNA was used as a template for PCR (Round 1: 500 uL; Round 2+:
250 uL:
containing the 5'-primer according to (SEQ ID NO 9), the 3'-primer according to (SEQ ID
NO 10), and Taq polymerase (New England Biolabs, Cat.# M0267L, Beverly, MA)).
PCR
reactions were done under the following conditions: a) denaturation step: 94 C
for 2 minutes;
b) cycling steps: 94 C for 30 seconds, 60 C for 30 seconds, 72 C for 1 minute;
c) final extension step: 72 C for 3 minutes. The cycles were repeated until sufficient PCR product was generated. The minimum number of cycles required to generate sufficient PCR product is reported in Tables 5, 6 and 7 as the "PCR Threshold". The amplified pool template DNA was then isopropanol precipitated and half of the PCR product was used as template for the transcription of pool RNA for the next round of selection. The transcribed RNA
pool was gel purified using a 10% polyacrylamide gel every two rounds. When not gel-purified, the transcribed pool was desalted using two Centri-Spin 10 columns (Princeton Separations Cat. #
CS-101, Adelphia, NJ). In all cases, an equivalent of one-tenth of the total transcription product was carried forward as the starting pool for the subsequent round of selection.

Table 5. Human vWF Al domain selection conditions using an rRdY pool Round Target Washes PCR Purification Threshold 1 24 pmol hAl 4 x 120uL 13 Desalt (2x) 2 24 pmol hAl 4 x 120uL 18 Desalt (2x) 3 24 pmol hAl 4 x 120uL 16 Gel purify 4 24 pmol hAl 8 x 120uL 15 Desalt (2x) 24 pmol hAl 8 x 120uL 15 Desalt (2x) 6 24 pmol hAl 8 x 120uL 15 Gel purify 7 24 pmol hAl 8 x 120uL 12 Desalt (2x) 8 24 pmol hAl 8 x 120uL 12 Desalt (2x) 9 24 pmol hA1 8 x 120uL 10 Gel purify 24 pmol hAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 min. each) 11 12 pmol full 6 x 120uL; 20 Desalt (2x) length vWF 2 x 120uL (15 min. each) 12 12 pmol full 6 x 120uL; 20 Gel purify length vWF 2 x 120uL (15 min.each) Table 6. Rabbit vWF Al domain selection conditions using an rRdY pool Round Target Washes PCR Threshold Purification 1 24 pmol rAl 4 x 120uL 13 Desalt (2x) 2 24 pmol rAl 4 x 120uL 18 Desalt (2x) 3 24 pmol rAl 4 x 120uL 10 Gel purify 4 24 pmol rAl 8 x 120uL 15 Desalt (2x) 24 pmol rAl 8 x 120uL 15 Desalt (2x) 6 24 pmol rAl 8 x 120uL 15 Gel purify 7 24 pmol rAl 8 x 120uL 15 Desalt (2x) 8 24 pmol rAl 8 x 120uL 12 Desalt (2x) 9 24 pmol rAl 8 x 120uL 10 Gel purify 24 pmol rAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 niin. each) 11 24 pmol rAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 min. each) 12 24 pmol rAl 6 x 120uL; 10 Gel purify 2 x 120uL (15 min. each) Table 7. Human/rabbit vWF Al domain alternating selection conditions using an rRdY pool Round Target Washes PCR Purification Threshold 1 12 pmol hAl/ 4 x 120uL 13 Desalt (2x) 12pmo1 rAl 2 12 pmol hAl/ 4 x 120uL 18 Desalt (2x) 12pmol rAl 3 24 pmol hAl 4 x 120uL 16 Gel purify 4 24 pmol rAl 8 x 120uL 15 Desalt (2x) 24 pmol hAl 8 x 120uL 15 Desalt (2x) 6 24 pmol rAl 8 x 120uL 15 Gel purify 7 24 pmol hAl 8 x 120uL 12 Desalt (2x) 8 24 pmol rAl 8 x 120uL 12 Desalt (2x) 9 24 pmol hAl 8 x 120uL 10 Gel purify 24 pmol rAl 6 x 120uL; 10 Desalt (2x) 2 x 120uL (15 min. each) 11 12 pmol full 6 x 120uL; 20 Desalt (2x) length vWF 2 x 120uL (15 min. each) 12 24 pmol rAl 6 x 120uL; 10 Gel purify 2 x 120uL (15 min. each) vWFBindin Analysis [00235] The selection progress was monitored using a sandwich filter binding assay. The 5' 32P-labeled pool RNA (trace concentration) was incubated with either a no target protein control, 100 nM human vWF Al domain or 100 nM rabbit vWF Al domain, in 1X
Dulbecco's PBS containing 0.1 mg/mL tRNA, and 0.1 mg/mL salmon sperm DNA (in a final volume of 50 uL) for 30 minutes at room temperature and then applied to a nitrocellulose and nylon filter sandwich in a dot blot apparatus (Schleicher and Schuell, Keene, NH). The percentage of pool RNA bound to the nitrocellulose was calculated after Rounds 6, 9, and 12 with a three point screen (100 nM human vWF A1 domain, 100 nM rabbit vWF Al domain, and a no-target control). Pool binding was compared to that of the naive pool RNA (Round 0). The results of the rRdY pool binding analyses are found in Table 8.

Table 8. vWF Al domain rRdY selection pool binding assays.

Selection Pool Round lOOnM hAl lOOnM rAl No Protein Naive Pool Round 0 9.7% 10.4% 10.5%
Human vWF Al Round 6 19.6% 19.7% 15.3%
Rabbit vWF Al Round 6 14.3% 14.4% 12.3%
hAl/rAl Round 6 19.8% 19.8% 15.9%
Human vWF Al Round 9 23.8% 24.3% 15.6%
Rabbit vWF Al Round 9 24.4% 24.0% 16.6%
hAl/rAl Round 9 19.6% 19.4% 14.6%
Human vWF Al Round 12 25.8% 23.0% 17.0%
Rabbit vWF Al Round 12 20.7% 20.5% 13.8%
hAl/rAl Round 12 25.2% 26.3% 16.8%
[00236] When a significant positive ratio of binding of RNA in the presence of human or rabbit vWF Al domain (SEQ ID NOS 4 and 6, respectively) versus in the absence of protein was seen, the pools were cloned using the TOPO TA cloning kit (Invitrogen Cat.# 45-0641, Carlsbad, CA) according to the manufacturer's instructions. Round 9 and 12 pool templates were cloned and sequenced (185 total sequences), producing 78 unique clones within 3 sequence families. All unique clones were transcribed, desalted, 5 32P end-labeled, and assayed in a 3-point dot blot screen (no protein target control, 100 nM human vWF Al domain (SEQ ID NO 5), or 100 nM rabbit vWF Al domain (SEQ ID NO 6). The data are presented in the third and fourth columns of Table 9 below as the ratio of the fraction of the aptamer bound to the nitrocellulose in the presence of the target protein to the fraction of aptamer bound in the absence of the target protein. Of the three sequence families, members of Family #1 and # 2 and two individual, non-family aptamers, bound to both human vWF
domain Al (SEQ ID NO 5) and rabbit vWF domain Al (SEQ ID NO 6).

[00237] Based on this initial screen, KD's were determined for 16 of the best vWF
dependent binding sequences using the dot blot assay. For KD determination, aptamers were purified on denaturing polyacrylamide gels and 5'-end labeled with y-32P ATP.
A 6 point protein titration of human vWF Al domain (SEQ ID NO 5) was used in the dot blot assay (333 nM, 100 nM, 33 nM, 10 nM, 3 nM, 0 nM) in 1X DPBS plus 0.1 mg/mL BSA at room temperature for 30 minutes. KD values were calculated by fitting the equation y=
(max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Software).
[00238] Results of protein binding characterization are tabulated in the final column of Table 9 below.

Table 9. Human and rabbit vWF Al domain rRdY aptamer binding activity*

# Aptamer Screen- Screen- Human Al Human/No Rabbit/No Protein KD (nM) Protein 1 (AMX203.D6) SEQ 1.92 1.57 523 2 (A1VX205.H8) SEQ 2.04 2.84 788 3 (A1VX205.H11) SEQ 2.18 2.41 144 4 (ANX205.A7) SEQ 1.24 1.37 ND

(AMX205.Dl1) 2.22 2.07 124 6 (A1V1X206.F9) SEQ 2.98 3.00 139 7 (AMX206.H9) SEQ 1.98 2.31 109 8 (A1VIX206.Al0) 2.62 2.58 111 9 (AMX205.F9) SEQ 2.22 2.47 145 (AMX206.E7) SEQ 2.11 2.26 151 11 (AMX206.D7) SEQ 2.19 2.08 187 12 (ANM03.A6) SEQ 1.16 1.16 ND

13 (AMX203.A1) SEQ 2.99 2.67 1148 14 (A1v1X203.G9) SEQ 1.65 1.35 1.3 15 (AMX205.H9) SEQ 2.36 3.14 178 16 (A1VIX206.D8) SEQ 2.80 3.76 370 17 (AlVIX203.F9) SEQ 1.45 1.29 ND

18 (A1VIX205.G9) SEQ 1.30 1.73 ND

19 (A1VM05.F7) SEQ 3.13 2.37 1.5 20 (ANIX205.H10) 1.88 2.47 397 * used human vWF Al domain (SEQ ID NO 5) for aptamer screen and aptamer Kos ND= not done [00239] The nucleic acid sequences of the rRdY aptamers characterized in Table above are described below. The unique sequence of each aptamer below begins at nucleotide 18, immediately following the sequence GGAGCGCACTCAGCCAC (SEQ ID NO 221), and runs until it meets the 3'fixed nucleic acid sequence TTTCGACCTCTCTGCTAGC (SEQ
ID
NO 222).

[00240] Unless noted otherwise, individual sequences listed below are represented in the 5' to 3' orientation and were selected under rRdY SELEXTM conditions wherein adenosine triphosphate and guanosine triphosphate are 2'-OH and cytidine triphosphate and thymidine triphosphate are deoxy.

vWF fRdYSELEe Family #1 [00241] The core target protein binding motifs for vWF rRdY Family #1 are shown in bold and underlined in the sequences below:

(AMX203.G9) (ARC842) SEQ ID NO 44 GGAGCGCACT CAGCCACGGGGTGGGTAGACGGCGGGTATGTGGCTG GTGTCGAAGGGTTTCGACCTCTCTGCTAGC
(AlVIX203.F9) SEQ ID NO 47 GGAGCGCACTCAGC CACTGAAGGGTAAGGACGAGGAGGGTATACAGTG
TGCGCGTGTATTTCGACCTCTCTGCTAGC
(AMX203.A6) SEQ ID NO 42 GGAGCGCACTCA GCCACCACGGGGACGGGTAGGGCGGGCGAGGTGGTGGC ATTAGCGTTTCGACCTCTCTGCTAGC

[00242] The predicted secondary structure and core nucleic acid sequences required for binding to the vWF target of some embodiments of the invention is depicted in Figure 12 as SEQIDNO218.

vWF rRdY SELEY M Farnil)' #2 (AMX203.D6) SEQ ID NO 31 GGAGCGCACTCAGCCACAGTTCTGTCGGTGATGAATTAGCGCGAGAGCTGTGGGACGTTTCGACCTCTCTGCTAGC

(AMX205.H8), SEQ ID NO 32 GGAGCGCACTCAGCCACAAACGGACGGTGATGGATTAACGCGGGTTTATGGCAAGGTTTCGACCTCTCTGCTAGC
(AMX205.H11), SEQ ID NO 33 GGAGCGCACTCAGCCACGGCACGACGGTGATGGATTAGCGCGGTGTCGGTGGTGTCATTTCGACCTCTCTGCTAGC
(AMX205.D11), SEQ ID NO 35 GGAGCGCACTCAGCCACGGCACGACGGTGATGAATTAGCGCGGTGTCGGTGGTGTCATTTCGACCTCTCTGCTAGC
(AMX206.F9), SEQ ID NO 36 GGAGCGCACTCAGCCACGGAGCGTCGGTGATGGATTAGCGCGGCTCCGTGGTACACATTTCGACCTCTCTGCTAGC
(AlVIX206.H9), SEQ ID NO 37 GGAGCGCACTCAGCCACGGAGCGTCGGTGATGGATTAGCGCGGTTCCGTGGTACACCTTTCGACCTCTCTGCTAGC
(AMX206.A10), SEQ ID NO 38 GGAGCGCACTCAGCCACGGCATGACGGTGATGAATTAGCGCGGTGTCGGTGGTGTCATTTCGACCTCTCTGCTAGC
(AMX205.F9), SEQ ID NO 39 GGAGCGCACTCAGCCACGGAGCGTCGGTGATGGATTAGCGCGGCTCCGTGGTACGCCTTTCGACCTCTCTGCTAGC
(AMX206.E7), SEQ ID NO 40 GGAGCGCACTCAGCCACGGAGCGTCGGTGATGGATTAGCGCGGCTCCGTGGTACACCTTTCGACCTCTCTGCTAGC
(AMX206.D7), SEQ ID NO 41 GGAGCGCACTCAGCCACGGCACGACGGTGATGAATTAGCGCGGTGTCGGTGGTGTTATTTCGACCTCTCTGCTAGC
(AMX203.A1), SEQ ID NO 43 GGAGCGCACTCAGCCACAGTTCTGTCGGTGATGAATTAGCGCGGGAGCTGTGGGACGTTTCGACCTCTCTGCTAGC
(AMX205.H9), SEQ ID NO 45 GGAGCGCACTCAGCCACGACGGTGATGGATTAGCGCGGTGGAGAAGATGCGCTGTTGTTTCGACCTCTCTGCTAGC

(AMX206.D8), SEQ ID NO 46 GGAGCGCACTCAGCCACGACGGTGATGGATTAGCGCGGTGGATCTTAACGTGCGAGTTTCGACCTCTCTGCTAGC
(AMX205.G9), SEQ ID NO 48 GGAGCGCACTCAGCCACAACTGGTTGTCGGTGATGGCATTAACGCGGACCAGGCATGTTTCGACCTCTCTGCTAGC
(AMX205.H10), SEQ ID NO 50 GGAGCGCACTCAGCCACTGTTGCCGACGGTGATGTATTAACGCGGGCAACGTTGGTGTTTCGACCTCTCTGCTAGC
vWF rRdY SELEYM sin lg e sequences [00243] The predicted core nucleic acid binding motif for SEQ ID NO 49 is shown in bold and underlined below:

(AMX205.F7) (ARC 841) SEQ ID NO 49 GGAGCGCACTCAGCCACACGACATTGGCGGGTTGTAATTACCACGCATGGCTGTTTGTTTCGACCTCTCTGCTAGC
(AMX205.A7), SEQ ID NO 34 GGAGCGCACTCAGCCACTCAAGGGGGTCGCGTGGGGACGAAGGGTTGCAGTGTGTCGTTTCGACCTCTCTGCTAGC

[00244] The predicted core nucleic acid sequences and secondary structure required for binding to the vWF target of some embodiments of the invention is depicted in Figure 13 as SEQ ID NO 219.

EXAMPLE 1C: Selection #1 of DNA vWF domain Al aptamers [00245] Selections were performed to identify aptamers that bind to (1) human vWF Al domain, (2) rabbit vWF Al domain, or (3) human and rabbit vWF Al domains, using a nucleotide pool consisting of deoxy-nucleotides (DNA). The selection strategy yielded high affinity aptamers specific for human and rabbit vWF Al domains which had been immobilized on a hydrophobic plate.

Pool Preparation [00246] A DNA template with the sequence 5'-CTACCTACGATCTGACTAGC
NNNNNNNNNNGCTTACTCTCATGTAGTTCC -3' (SEQ ID NO 51) (ARC 493) was synthesized using an ABI EXPEDITETM DNA synthesizer, and deprotected by standard methods. The series of N's in the DNA template (SEQ ID NO 51) can be any combination of nucleotides and gives rise to the unique sequence region of the resulting aptamers. The template was PCR amplified with the primers (5'- CTACCTACGATCTGACTAGC -3') (SEQ ID NO 52) and (5'- AGGAACTACATGAGAGTAAGC(OH) -3') (SEQ ID NO 53) under standard conditions. The PCR product was subjected to alkaline hydrolysis (333 mM
NaOH, 90 C, 15 min) followed by precipitation. The strands were separated on a 10%
denaturing polyacrylamide gel and the single stranded DNA pool, which migrated with a lower mobility, was excised from the gel, passively eluted, and precipitated with isopropanol.
Selection [00247] For the human vWF selection, the first ten rounds were initiated by immobilizing 24 pmoles of human vWF Al domain (SEQ ID NO 4) to the surface of a Nunc Maxisorp hydrophobic plate (Nunc, Cat.# 446612, Rochester, NY) for 1 hour at room temperature in 100 L of 1X Dulbecco's PBS (Gibco BRL, Cat.# 14040-133, Carlsbad, CA). For Rounds eleven and twelve, 12 pmoles of full length human vWF (SEQ ID NO 7) were immobilized to the hydrophobic plate. For the rabbit vWF selection, each round was initiated by immobilizing 24 pmoles of rabbit vWF Al (SEQ ID NO 6) domain under the same conditions. For the first two rounds of the human/rabbit alternating selection, 12 pmoles of human vWF Al domain (SEQ ID NO 4) and 12 pmoles of rabbit vWF Al domain (SEQ
ID
NO 6) were immobilized to a hydrophobic plate as previously described. In the subsequent rounds of the alternating selection, the protein target was alternated each round between human and rabbit vWF Al domain, except in Round 11 human full length vWF (SEQ
ID NO
7) was used.

[00248] In all cases, after one hour of protein immobilization, the supernatant was removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. The protein-immobilized well was then blocked with 100 uL blocking buffer (1X Dulbecco's PBS with 1% BSA) for 1 hour at room temperature. In Round one, 333 pmoles of pool DNA
(2 x 1014 unique molecules) were incubated in 100 L 1X Dulbecco's PBS in the wells containing BSA-blocked immobilized protein target for 1 hour at room temperature. The supernatant was then removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. In later rounds, additional washes were added to increase the stringency of the positive selection step (see Tables 10, 11, and 12). Starting at Round 2 and in all subsequent rounds, two negative selection steps were included before the positive selection step.
First, the pool DNA

was incubated for 1 hour at room temperature in an unblocked well to remove any plastic binding sequences from the pool. In the second negative selection step, the DNA was transferred to a BSA blocked well (not containing the protein target) for 1 hour at room temperature to remove any BSA binding sequences from the pool prior to the positive selection. Starting at Round 2 and in all subsequent rounds, 0.1 mg/mL tRNA
and 0.1 mg/mL
salmon sperm DNA were spiked into the positive selection reaction as non-specific competitors.

[00249] In all cases, the pool DNA bound to the immobilized protein target was eluted with 2 x 100 L washes with elution buffer (preheated to 90 C, 7 M Urea, 100 mM
NaOAc pH
5.3, 3 mM EDTA) for five minutes. Both elutions were pooled and precipitated by the addition of ethanol, then amplified in an initial PCR reaction (100 L
reactions including the 5'-primer according to SEQ ID NO 52, and the 3'-primer according to SEQ ID NO
53, and Taq polymerase (New England BioLabs, Cat.# M0267L, Beverly, MA). PCR reactions were done under the following conditions: a) denaturation step: 94 C for 2 minutes;
b) cycling steps: 94 C for 30 seconds, 52 C for 30 seconds, 72 C for 1 minute; c) final extension step:
72 C for 3 minutes. The cycles were repeated until sufficient PCR product was generated.
The minimum number of cycles required to generate sufficient PCR product is reported in Tables 10, 11 and 12 as the "PCR Threshold". 10 L of the PCR product was added to another 300 L of PCR mix for a prep-scale PCR reaction. The prep- scale PCR
product was ethanol precipitated and was subjected to alkaline hydrolysis (333 mM NaOH, 90 C, 15 min).
The strands were separated on a 10% denaturing polyacrylamide gel and the single stranded DNA pool, which migrated with a lower mobility, was excised from the gel, passively eluted, and precipitated with isopropanol. In all cases, an equivalent of half of the total single stranded DNA product was carried forward as the starting pool for the subsequent round of selection.

Table 10 Human vWF Al domain selection conditions using a DNA pool Round Target Washes PCR Purification Threshold 1 24 pmol hAl 4 x 120uL 10 Gel purify 2 24 pmol hAl 4 x 120uL 15 Gel purify 3 24 pmol hAl 4 x 120uL 13 Gel purify 4 24 pmol hAl 8 x 120uL 15 Gel purify 24 pmol hA1 8 x 120uL 15 Gel purify 6 24 pmol hAl 8 x 120uL 20 Gel purify 7 24 pmol hAl 8 x 120uL 10 Gel purify 8 24 pmol hAl 8 x 120uL 10 Gel purify 9 24 pmol hAl 8 x 120uL 10 Gel purify 24 pmol hAl 6 x 120uL; 12 Gel purify 2x120uL(15min.
each) 11 12 pmol full 6 x 120uL; 18 Gel purify length vWF 2 x 120uL (15 min.
each) 12 12 pmol full 6 x 120uL; 15 Gel purify length vWF 2 x 120uL (15 min.
each) Table 11 Rabbit vWF Al domain selection conditions using a DNA pool Round Target Washes PCR Purification Threshold 1 24 pmol rAl 4 x 120uL 10 Gel purify 2 24 pmol rAl 4 x 120uL 13 Gel purify 3 24 pmol rAl 4 x 120uL 13 Gel purify 4 24 pmol rAl 8 x 120uL 15 Gel purify 5 24 pmol rAl 8 x 120uL 15 Gel purify 6 24 pmol rAl 8 x 120uL 20 Gel purify 7 24 pmol rAl 8 x 120uL 10 Gel purify 8 24 pmol rA1 8 x 120uL 10 Gel purify 9 24 pmol rA1 8 x 120uL 10 Gel purify 24 pmol rAl 6 x 120uL; 12 Gel purify 2 x 120uL (15 min.
each) 11 24 pmol rA1 6 x 120uL; 10 Gel purify 2 x 120uL (15 min.
each) 12 24 pmol rAl 6 x 120uL; 10 Gel purify 2 x 120uL (15 min.
each) Table 12 Human/rabbit vWF Al domain alternating selection conditions using a DNA pool Round Target Washes PCR Purification Threshold 1 12 pmol hAl/ 4 x 120uL 12 Gel purify 12pmo1 rA 1 2 12 pmol hAl/ 4 x 120uL 15 Gel purify 12pmol rAl 3 24 pmol hAl 4 x 120uL 10 Gel purify 4 24 pmol rAl 8 x 120uL 15 Gel purify 24 pmol hAl 8 x 120uL 15 Gel purify 6 24 pmol rAl 8 x 120uL 20 Gel purify 7 24 pmol hAl 8 x 120uL 12 Gel purify 8 24 pmol rAl 8 x 120uL 12 Gel purify 9 24 pmol hAl 8 x 120uL 12 Gel purify 24 pmol rAl 6 x 120uL; 12 Gel purify 2 x 120uL (15 min. each) 11 12 pmol full length 6 x 120uL; 18 Gel purify VWF 2 x 120uL (15 min. each) 12 24 pmol rAl 6 x 120uL; 10 Gel purify 2 x 120uL (15 min. each) vWF Bindink Analysis [00250] The selection progress was monitored using a sandwich filter binding assay. The 5' 32P-labeled pool DNA (trace concentration) was incubated with either a no target protein control, 100 nM human vWF Al domain (SEQ ID NO 4), or 100 nM rabbit vWF Al domain (SEQ ID NO 6), in 1X Dulbecco's PBS containing 0.1 mg/mL tRNA, and 0.1 mg/mL
salmon sperm DNA in a (final volume of 50 uL) for 30 minutes at room temperature and then applied to a nitrocellulose and nylon filter sandwich in a dot blot apparatus (Schleicher and Schuell, Keene, NH). The percentage of pool DNA bound to the nitrocellulose was calculated after Rounds 6, 9, and 12 with a three point screen (no protein target control, 100 nM human vWF

Al domain (SEQ ID NO 5), 100 nM rabbit vWF Al domain (SEQ ID NO 6). Pool binding was compared to that of the na:fve pool DNA (Round 0). The results of the DNA
pool binding analyses are found in Table 13.

Table 13 vWF Al domain DNA selection pool binding assays.

Selection Pool Round lOOnM lOOnM No Protein hAl rAl Naive Pool Round 0 30.1% 35.4% 29.4%
Human vWF Al Round 6 34.4% 36.4% NA
Rabbit vWF Al Round 6 37.9% 36.8% 35.6%
hAl/rAl Round 6 47.9% 50.6% 49.0%
Human vWF Al Round 9 30.4% 43.7% 19.1%
Rabbit vWF Al Round 9 15.9% 35.0% 6.6%
hAl/rAl Round 9 40.8% 49.5% 34.7%
Human vWF A1 Round 12 36.7% 45.9% 33.0%
Rabbit vWF A1 Round 12 23.7% 38.7% 13.4%
hAl/rAl Round 12 21.4% 34.2% 16.4%
[00251] When a significant positive ratio of binding of DNA in the presence of human or rabbit vWF Al domain versus in the absence of protein was seen, the pools were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA, Cat.# 45-0641) according to the manufacturer's instructions. Round 9 and 12 pool templates were cloned and sequenced (243 total sequences), producing 106 unique clones within 8 sequence families, 41 of which bound to the vWF target and fell into the families described below.

[00252] All unique clones were assayed in a 3-point dot blot screen (no protein target control, 100 nM human vWF Al domain (SEQ ID NO 5), or 100 nM rabbit vWF Al domain (SEQ ID NO 6). The data are presented in the third and fourth columns of Table 14 below as the ratio of the fraction of the aptamer bound to the nitrocellulose in the presence of the target protein to the fraction of aptamer bound in the absence of the target protein..

[00253] Based on this initial screen, KD's were determined for 10 of the vWF
dependent binding sequences. For KD determination, aptamers were 5'end labeled with y-32P ATP and a competition dot blot assay was used with a constant protein concentration of 100 nM and an 8 point cold competitor DNA titration (333 nM, 100 nM, 33 nM, 10 nM, 3 nM, 1 n1V4, 33 pM, 0 pM) in 1X DPBS plus 0.1 mg/mL BSA at room temperature for 30 minutes. KD
values were calculated by fitting the equation y= (max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Software). Results of protein binding characterization are tabulated in Table 14.

Table 14 Human and rabbit vWF Al domain DNA aptamer binding activity*

# Aptamer Screen- Screen- Human Al Human/No Rabbit/No KD (nM) Protein Protein 1 1 (AMX199.B3) SEQ 1.76 1.99 30 2 (A1VIX199.D11) SEQ 4.19 3.42 30 3 (A1VIX200.G11) SEQ 1.73 1.28 ND

4 (AMX200.D11) SEQ 3.34 2.04 ND

(AMX200.D8) SEQ 2.86 1.61 ND

6 (AMX200.C11) SEQ 6.00 3.64 26 7 (A1VIX199.G10) SEQ 4.97 2.66 22 8 (AMX199.F7) SEQ ID 5.47 5.00 22 9 (AMX200.A7) SEQ 0.97 0.96 ND

(AMX200.B9) SEQ ID 2.54 2.06 ND

11 (AMX200.B1) SEQ ID 4.01 3.01 ND

12 (AMX199.C2) SEQ ID 5.09 4.61 17 13 (AMX200.B8) SEQ ID 4.13 3.13 ND

14 (A1VX200.F11) SEQ 3.83 3.25 34 QN 16I 10'Z QI baS (9g'66IXYIV) ~~

QN 6L' I 8L' I Q< baS (83'66IXKV) ZE
t,8 ON
H< aHS (8H'OOZXWV) QN LZ'i 98'I i~'~8'6Si'ZQ i~
~8 ON QI
QN 61'1 6t,'i aaS (iiv'OoZXI~Iv) o~

QN Ii'i 61'1 baS (tJ'66IXWV) 6Z
i8ON
QN 9~'I Z~'i GI baS (i3'66IXYiV) 8Z

QN 9Z'1 61'1 baS (10'66IXKV) LZ

QN 6Z'i SZ'i aaS (oIV'661XYIV) 9Z

QN bi'i Z~'i baS (LH'661XWd) SZ
LL ON CEI
QN S~'i tli~'I baS (11 3'66iXT~iV) tZ

QN b~'I it'I baS (90'661XYM ~Z
SL ON
QN 0~'I L~'i CEI baS (93'66IXWV) ZZ
t,L ON CII
QN bZ'I Li'i baS (OI3'661XWV) iz ~L ON
QN ~o' I tlo' I cli bas (8a'oozxwv) oz ZL ON
tl~ 987 09'~ CII baS (t,3'66IXYITV) 61 ILONCEI
9~ it'Z 897 aaS (~Q'ooZXwv) 81 oL ON
6Z 99'~ 80'tl GI baS (Lg'66IXWV) LI

QN 66'0 L6'0 QI baS (63'OOZXYiV) 91 QN 90'1 9Z'1 OHS (i(1'oozXwv) Si b~iZ~o/00ZS11/13a bS8~~0/900Z OAc1 SO-~0-LOOZ bL~6LSZ0 FIO

34 (AMX199.D8) SEQ 1.89 2.00 ND

35 (ANIX200.E10) SEQ 1.69 1.82 ND

36 (A1VIX202.H10) SEQ 1.92 1.76 ND

37 (AMX202.B8) SEQ ID 1.66 1.41 ND

38 (AMX202.D6) SEQ 1.94 1.55 ND

39 (AMX202.A3) SEQ 2.28 2.10 ND

40 DL.159.83.98 1.27 1.27 ND
(AMX202.A8) SEQ ID

41 (AMX202.F6) SEQ ID 1.49 1.46 ND

* used human vWF Al domain (SEQ ID NO 5) for aptamer screen and aptamer KDs ND = not done [00254] The nucleic acid sequences of the DNA aptamers characterized in Table 14 above are described below, The unique sequence of each aptamer below begins at nucleotide 21, immediately following the sequence CTACCTACGATCTGACTAGC (SEQ ID NO 52), and runs until it meets the 3' fixed nucleic acid sequence GCTTACTCTCATGTAGTTCC
(SEQ
ID NO 223).

[00255] Unless noted otherwise, individual sequences listed below are represented in the 5' to 3' orientation and were selected under DNA SELEXTM wherein all of the nucleotides are deoxy.

[00256]
DNA SELEYM 1, Family # 1 [00257] The predicted core nucleic acid binding sequence for DNA SELEXTM 1, Family #1 is shown in bold and underlined for aptamer AMX199.B3 (SEQ ID NO 54) and the consensus sequence (SEQ ID NO 95) below.

ODiiDdiDiVDiDiDViiDDiDDDia DiD.tDDvDiDD.tidDDiDDzDDiVDDdDiVVDDDDVsDdoiDidDDvsDDviD
L9 ON Cl[ 69S (i i3'OOZXWV) DDsiDViDidD,tDiDdsia DiDDD.tDDiDiDDdDDDDiidDDiDDiDDivVDVDiVVDDDDViDdDiDa.VDDdia OdiZ) 99 ON C[I baS (ZO'661XWV) DDiiDdiDidDiDiDViiDDsDDDiDDiDiDDVDiDDssdDDsVDsDDDDdDVDiVVDDDDViDdDzDiVDDViDDViD

Z6 ON CEI baS (~V'ZOZXWV) DDsiDdiDsVaiDiDViiDDiODDiDDiDiDDVDiDDiiVDDiVDiDDidDDVDiVvDDDOVsDdDzDiVDDviDOVs.
D
69 ON CE[ baS (63'00ZXYiV) DDiiDVzDiVDiDiDv.w.DDia DDiDDsa .tiDDVDsDDiidDDiDDz'DDDwDVoiVvDDDDViDdDiDsVDDViDDViD
68 ON CII OSS (OiH'ZOZXWV) DDiiDViDiVDiDiDvsiDDiDDDia DiDiDDVDiDDiivDD.LVDia DiVsDVDiVvDDDDVsa dDiDiVDDdiDOviD
06 ON CII baS (89'zozxYiV) DDiiDviDidDia iDviaDD.cDdDiDDsDiDDdDiDDi.LVDDiVDiDDivdDVDiVvDDDDdiDdDiDiVOOViDDViD
~9 ON CII baS (6g'00ZXYiV) a DiiDviDidDiDiDvisDDiODDiDDiDiDDda dDDiidDDivDiDDiwDVDiVvDDDDViDVDiDzdOOdiDDViD
99 ON cli bas (8g'OOZXwv) ODiiDdiDiVDiDsDVsiDDiDDDiDDzDiDDdDiDDiiVDDiDDiiDidvDVDiVVDDDDViDVDiDivDOVia DViD
09 ON QI aEIS (0 I0'66iXWV) Do.iiDviDiV3ioiDvis.a D.tiDDDsa DiDiDDdDDDDiiVDDidDiDDiVVDVDiwDDDDVia VDiDidDDdsDDvio ti9 ON cil 6aS (Ig'oOZXwv) DDiiDdiDidDiDiDViiDDiDDDiDDia iDDdDiDDiidDDsdDiODDvvDVDiVVDDDDdiDVDiDivDDdsDDdiD
16 ON CII baS (9Q'ZOZXYiV) DDisDViDivDiDiDdiiDDiDDDiDDiDiDDdDiiDiiVDDivDiDDiwDVDiVVODDDViOvDiDiVDDViDDViD
Z9 ON CII baS (LV'OOZXYiV) DDiiDViDiVDiDiDV.t,iDDiODDiDDiDiDDVa iDDiidDDiDDiDDiDdDVDswDDODV.i.OdDiDidDDViDDVi0 19 ON CII OaS (L3'66iXWV) DDiiDdiDidDiDiDdiiDDiDDDiDDiDiDDVO,cDDiidDDidD.r.DDivdDVVidvDDDDViOdDiDiVDDVa.D
DViD
LS ON CEI OaS (IiQ'OOZXYM
DDiiDviDidDiDiDVi.cDDiDDDiDDiDiDDdDiDDiidDDivDisDivdDdDiVVDDDDdiDdDiDidDDdiDDvi D
8S ON cli ibaS (8(1'00ZXwv) DDiiDViDidDiDsDdiiDDiDDDiDDiDiDOVDiDDiiVDD.cDDiDDivVDvDiVVDDDDdiDVDiDiVDDdiDDdi D
SS ON CEI OaS (i I(1'66IXWV) DDiiDd.i.DidOiDiOviiDDiDDDiDDiDiDDVOiDD,i.iVDDidDiDDiVVDd~DVVDDDDdiDVDiDidDDdiD
DviD
99 ON CEI aaS (i i J'OOZXYNIV) a DiiDdiDidDia iDviiDDiDDDsa DiDiDDdDiDDiidDDidDiDDiDVDdDiVVDDDDviDdDsDidDDdiDDdsD
69 ON ~ OEIS (i I0'00ZXYid) ~~ L LrJF~ LrJ L~~ L~ L~~ L L~JS~'J'J L~JS ~s 'J'J~~ L~'J L L~"J'J Ld'J1 ~J
L~J~'J I~VrJiJDDV.LDdrJ.LD.LVJDd.LDDV.LD
tlS ON CEI 6aS (~9'661XWd) b~iZ~o/00Z811/13a bS8~~0/900Z OAc1 SO-~0-LOOZ bL~6LSZ0 FIO

(AMX200.D1) SEQ ID NO 68 CTACCTACGATCTGACTAGCGGAATGAGAGTGCTGATGGATTGCTCAGGTCTACTGGCTGCTTACTCTCATGTAGTTCC

(AMX199.C4) SEQ ID NO 72 CTACCTACGATCTGACTAGCGGAATGAGGATGCTGATGGATTGCACAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

(AMX200.D3) SEQ ID NO 71 CTACCTACGATCTGACTAGCGCAATGAGGATGCTGATGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

(AMX199.B7) SEQ ID NO 70 CTACCTACGATCTGACTAGCGGGATGAGAGTGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

(AMX200.E8) SEQ ID NO 73 CTACCTACGATCTGACTAGCGGAATGAGGATGCTGGTGGATTGCTCAGGTCTGTTGGCTGCTTACTCTCATGTAGTTCC

[002581 The Consensus sequence for DNA SELEXTM 1, Family #1 is as follows:

CTACCTACGATCTGACTAGCGGAATGAGRATGYTGRTGGATTGCHCAGGTCTRYTGRCTGCTTACTCTCATGTAGTTCC

Where Y = C or T, R = A or G and H = A, C or T
DNA SELEXM 1 Family #2 (AMX199.F10) SEQ ID NO 74 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTTCCGTTCTGCTTACTCTCATGTAGTTCC

AMX199.F6) SEQ ID NO 75 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTCCCGCTCTGCTTACTCTCATGTAGTTCC

(AMX199.H7) SEQ ID NO 78 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTTCCGCTTTGCTTACTCTCATGTAGTTCC

(AMX199.G5) SEQ ID NO 76 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTCCCGCCCTGCTTACTCTCATGTAGTTCC

(AMX199.F11) SEQ ID NO 77 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTTCTGCTCTGCTTACTCTCATGTAGTTCC

(AMX199.A10) SEQ ID NO 79 CTACCTACGATCTGACTAGCGGAACACTAGGTTGGTTAGGATTGGTGTGTTCCCGTTTTGCTTACTCTCATGTAGTTCC

(AMX199.G1) SEQ ID NO 80 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTCCCGCTTTGCTTACTCTCATGTAGTTCC

(AMX199.G4) SEQ ID NO 82 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGGTTGGTGTGTTCCCGCTTTGCTTACTCTCATGTAGTTCC

(AMX199.F1) SEQ ID NO 81 CTACCTACGATCTGACTAGCGAAACACTAGGTTGGTTAGGATTGGTGTGTTCCCGCTATGCTTACTCTCATGTAGTTCC

The consensus sequence for DNA SELEX7M Family #2 is as follows:

CTACCTACGATCTGACTAGCGRAACACTAGGTTGGTTAGGRTTGGTGTGTTYCYGYYHGCTTACTCTCATGTAGTTCC

Where Y= C or T, R = A or G and H = A, C or T
DNA SELEAM 1 Family #3 (AMX199.B6) SEQ ID NO 86 CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTTGGTACCTCCGGCTTACTCTCATGTAGTTC
C
(AMX199.D8) SEQ ID NO 87 CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTTGGCATCTTCGGCTTACTCTCATGTAGTTC
C
(AMX199.F8) SEQ ID NO 85 CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTTGGCACCTCTGGCTTACTCTCATGTAGTTC
C
(AMX200.E10) SEQ ID NO 88 CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTCGGCACCTTTGGCTTACTCTCATGTAGTTC
C
(AlVIX202.F6) SEQ ID NO 94 CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTCGGCACCTTCGGCTTACTCTCATGTAGTTC
C
(AMX202.A8) SEQ ID NO 93 CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTCGGCACTTCCGGCTTACTCTCATGTAGTTC
C
DNA SELEYM 1, Family #4 (AMX200.A11) SEQ ID NO 83 CTACCTACGATCTGACTAGCTGAGTAGTTAGTAACTTTTTATTATGGTTTGGTGGGTCTGGCTTACTCTCATGTAGTTC
C
(AMX200.H8) SEQ ID NO 84 CTACCTACGATCTGACTAGCTGAGTAGTCAGTAATTTTTTATTATGGTTTGGTGGGCCTGGCTTACTCTCATGTAGTTC
C

EXAMPLE 1D: Selection #2 of DNA vWF Aptamers [00259] A single set of DNA selections were done using full length human vWF
and rabbit vWF domain Al in a cross selection. While not wishing to be bound by any theory, our hypothesis is that such a selection should require successfully selected aptamers to bind to full length vWF, to bind to the Al domain specifically and to cross react between human and rabbit proteins. The dominant sequence family from this second set of DNA
selections binds to full length human vWF, rabbit vWF domain Al and is functional in both the FACS and BIPA biological assays as described in Example 3 below.

[00260] Selections were performed to identify aptamers that bind to full length human vWF and rabbit vWF Al domain, using a full length human vWF/rabbit vWF Al domain alternating selection. This selection used a nucleotide pool consisting of deoxy-nucleotides (DNA). The selection strategy yielded high affinity aptamers specific for full length human vWF and rabbit vWF Al domain which had been immobilized on a hydrophobic plate.
Pool Preparation [00261] A DNA template with the sequence 5'-CTACCTACGATCTGACTAGC
NNNNNNNNNNGCTTACTCTCATGTAGTTCC -3' (SEQ ID NO 51) (ARC 493) was synthesized using an ABI EXPEDITETM DNA synthesizer, and deprotected by standard methods. The series of N's in the DNA template (SEQ ID NO 51) can be any combination of nucleotides and gives rise to the unique sequence region of the resulting aptamers. The template was PCR amplified with the primers (5'- CTACCTACGATCTGACTAGC -3') (SEQ ID NO 52) and (5'- AGGAACTACATGAGAGTAAGC(OH) -3') (SEQ ID NO 53 ) under standard conditions. The PCR product was subjected to alkaline hydrolysis (333 mM
NaOH, 90 C, 15 min) followed by precipitation. The strands were separated on a 10%
denaturing polyacrylamide gel and the single stranded DNA pool, which migrated with a lower mobility, was excised from the gel, passively eluted, and precipitated with isopropanol.
Selection [00262] For the first three rounds of the full length human vWF/rabbit vWF Al domain alternating selection, 24 pmoles of full length human vWF (SEQ ID NO 7) and 24 moles of rabbit vWF Al domain (SEQ ID NO 6) were immobilized. In the subsequent rounds, the protein target was alternated each round between full length human vWF and rabbit vWF Al domain. In all cases, after one hour of protein immobilization, the supernatant was removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. The protein-immobilized well was then blocked with 100 uL blocking buffer (1X Dulbecco's PBS with 1% BSA) for 1 hour at room temperature. In Round one, 333 pmoles of pool DNA
(2 x 1014 unique molecules) were incubated in 100 L 1X Dulbecco's PBS in the wells containing BSA-blocked immobilized protein target for 1 hour. The supernatant was then removed and the wells were washed 4 times with 120 L 1X Dulbecco's PBS. In later rounds, additional washes were added to increase the stringency of the positive selection step (see Table 15). At Round 8, the selection was split to include a high salt wash condition as a possible means to increase the stringency of the SELEXTM (using 1X Dulbecco's PBS + 400 mM NaC1) (see Table 15). Starting at Round 2 and in all subsequent rounds, two negative selection steps were included before the positive selection step. First, the pool DNA was incubated for 1 hour at room temperature in an unblocked well to remove any plastic binding sequences from the pool. In the second negative selection step, the DNA was transferred to a BSA
blocked well (not containing the protein target) for 1 hour at room temperature to remove any BSA binding sequences from the pool prior to the positive selection. Starting at Round 2 and in all subsequent rounds, 0.1 mg/mL tRNA and 0.1 mg/mL salmon sperm DNA were spiked into the positive selection reaction as non-specific competitors.

[00263] In all cases, the pool DNA bound to the immobilized protein target was eluted with 2 x 100 L washes with elution buffer (preheated to 90 C, 7 M Urea, 100 mM
NaOAc pH
5.3, 3 mM EDTA) for five minutes. Both elutions were pooled and precipitated by the addition of ethanol, then amplified in an initial PCR reaction (100 L
reactions including the 5'-primer according to SEQ ID NO 52, the 3'-primer according to SEQ ID NO 53, and Taq polymerase, (New England BioLabs, Cat.# M0267L, Beverly, MA). PCR reactions were done under the following conditions: a) denaturation step: 94 C for 2 minutes;
b) cycling steps: 94 C for 30 seconds, 52 C for 30 seconds, 72 C for 1 minute; c) final extension step:
72 C for 3 minutes. The cycles were repeated until sufficient PCR product was generated.
The minimum number of cycles required to generate sufficient PCR product is reported in Table 15 as the "PCR Threshold". 10 L of the PCR product was added to another 300 L of PCR mix for a prep-scale PCR reaction. The prep-scale PCR product was ethanol precipitated and was subjected to alkaline hydrolysis (333 mM NaOH, 90 C, 15 min). The strands were separated on a 10 % denaturing polyacrylamide gel and the single stranded DNA
pool, which migrated with a lower mobility, was excised from the gel, passively eluted, and precipitated with isopropanol. In all cases, an equivalent of half of the total single stranded DNA product was carried forward as the starting pool for the subsequent round of selection.

Table 15 Full length human vWF/rabbit vWF Al domain alternating selection conditions using a DNA pool Round Target Washes PCR Threshold Purification 1 24 pmol full length 4 x 120uL 15 Gel purify human /
24pmol rAl 2 24 pmol full length 4 x 120uL 13 Gel purify human /
24 pmol rAl 3 24 pmol full length 4 x 120uL 10 Gel purify human /
24 pmol rAl 4 24 pmol full length 4 x 120uL 10 Gel purify human vWF
24 pmol rAl 4 x 120uL 10 Gel purify 6 24 pmol full length 8 x 120uL 10 Gel purify human vWF
7 24 pmol rAl 8 x 120uL 10 Gel purify Normal High Salt Normal High Salt Wash Wash Wash Wash 8 24 pmol full length 8 x 120uL 8 x 120uL 10 10 Gel purify human vWF
9 24 pmol rAl 8 x 120uL 8 x 120uL 10 13 Gel purify 24 pmol full length 8 x 120uL 8 x 120uL 10 10 Gel purify human vWF
11 24 pmol rAl 8 x 120uL 8 x 120uL 10 10 Gel purify vWF Binding Analysis [00264] The selection progress was monitored using a sandwich filter binding assay. The 5' 32P-labeled pool DNA (trace concentration) was incubated with either a no target protein control, 100 nM full length human vWF (Calbiochem Cat.# 681300, La Jolla, CA), or 100 nM
rabbit vWF Al domain, in 1X Dulbecco's PBS containing 0.1 mg/mL tRNA, and 0.1 mg/mL
salmon sperm DNA, and 0.1 mg/mL BSA in a (final volume of 50 uL) for 30 minutes at room temperature and then applied to a nitrocellulose and nylon filter sandwich in a dot blot apparatus (Schleicher and Schuell, Keene, NH). The percentage of pool DNA
bound to the nitrocellulose was calculated after Rounds 7 and 9 by screening with a no protein target control, 30 nM /100 nM full length human vWF (Calbiochem Cat.# 681300, La Jolla, CA), and 30 nM/100 nM rabbit vWF Al domain (SEQ ID NO 6). Pool binding was compared to that of the naive pool DNA (Round 0). The results of the DNA pool binding analyses are found in Table 16 below.

Table 16 full length human vWF/ rabbit vWF Al domain DNA selection pool binding assays.

Selection Pool full length human vWF rabbit vWF Al domain No Protein Round 30nM lOOnM 30nM l00nM
NaYve Pool Round 0 40.3% 39.8% 41.6% 45.5% 35.2%
Human Round 7 59.4% 66.9% 58.9% 68.3% 39.9%
vWF/rAl Naive Pool Round 0 53.0% 55.1% 53.9% 56.9% 52.6%
Human Round 9 70.9% 65.0% 71.7% 81.6% 54.5%
vWF/rAl Human Round 9 72.1% 73.8% 74.5% 82.3% 59.7%
vWF/rAl High Salt Wash [00265] When a significant positive ratio of binding of DNA in the presence of human or rabbit vWF Al domain versus in the absence of protein was seen, the pools were cloned using the TOPO TA cloning kit (Invitrogen Cat.# 45-0641, Carlsbad, CA) according to the manufacturer's instructions. Round 7 and 11 pool templates were cloned and sequenced (218 total sequences), producing 146 unique clones within 12 sequence families of which sequences from six families show vWF target binding activity. All unique clones were assayed twice in a 3-point dot blot screen (no protein target control, 20 nM
full length human vWF (Calbiochem Cat.# 681300, La Jolla, CA), or 20 nM rabbit vWF Al domain.
The data is presented in the third and fourth columns of Table 17 below as the ratio of the fraction of the aptamer bound to the nitrocellulose in the presence of the target protein to the fraction of aptamer bound in the absence of the target protein.

[00266] Based on this initial screen, KDs were determined for 3 of the vWF
dependent binding sequences using the dot blot assay. For KD determination, aptamers were 5'end labeled with y-32P ATP and were tested for direct binding to full length human vWF and rabbit vWF Al domain. A 12 point protein titration was used in the dot blot assay (300 nM, 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 300 pM, 100 pM, 30 pM, 10 pM, 3 pM, 0 pM) in DPBS plus 0.1 mg/mL BSA at room temperature for 30 minutes. KD values were calculated by fitting the equation y= (max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v.
3.51, Synergy Software). Results of protein binding characterization are tabulated in Table 17 below.

Tablel7 Full length human vWF and rabbit vWF Al domain DNA aptamer binding activity*

# Aptamer Screen- Screen full length rabbit vWF Al Human/ No Rabbit/ No human vWF KD domain KD
Protein Protein (nl\4) (nI\4) 1 AMX237.A11 2.66 2.38 ND ND
(SEQ ID NO
98) 2 AMX237.A2 2.60 2.34 ND ND
(SEQ ID NO
99) 3 AMX238.D12 2.40 2.19 ND ND
(SEQ ID NO
100) 4 AMX237.H5 1.63 1.61 ND ND
(SEQ ID NO
101) AMX237.E2 1.61 1.61 ND ND
(SEQ ID NO
102) 6 AMX237.B4 1.42 1.38 ND ND
(SEQ ID NO
103) 7 AMX237.E9 2.13 2.06 ND ND

(SEQ ID NO
104) 8 AMX237.D11 1.16 1.17 ND ND
(SEQ ID NO
105) 9 AMX238.G5 3.06 2.68 ND ND
(SEQ ID NO
106) AMX237.C7 1.15 1.16 ND ND
(SEQ ID NO
107) 11 AMX238.D5 1.46 1.40 ND ND
(SEQ ID NO
108) 12 AMX237.B11 2.87 2.57 ND ND
(SEQ ID NO
109) 13 AMX237.F6 1.20 1.21 ND ND
(SEQ ID NO
110) 14 AMX238.D8 2.02 1.97 ND ND
(SEQ ID NO
111) A1V1X238.G6 1.25 1.22 ND ND
(SEQ ID NO
112) 16 AMX236.F8 1.14 1.13 ND ND
(SEQ ID NO
113) 17 AMX237.G6 3.80 3.63 0.20 47 (SEQ ID NO
114) 18 AMX238.E9 3.44 3.36 0.39 5.3 (SEQ ID NO
115) 19 AMX238.E7 3.02 2.83 ND ND
(SEQ ID NO
116) AMX238.F3 2.83 2.72 ND ND
(SEQ ID NO
117) 21 AMX238.H5 3.75 3.46 0.33 6.0 (SEQ ID NO
118) 22 AlVIX237.C11 2.04 1.95 ND ND
(SEQ ID NO
119) 23 AMX238.F2 2.84 2.76 ND ND
(SEQ ID NO
120) 24 AMX237.F9 2.21 2.31 ND ND
(SEQ ID NO
121) 25 A1VIX237.F12 1.95 2.08 ND ND
(SEQ ID NO
122) 26 AMX237.C9 2.05 2.19 ND ND
(SEQ ID NO
123) 27 AMX237.F 10 2.90 2.90 ND ND
(SEQ ID NO
124) 28 AMX236.H2 2.12 2.06 ND ND
(SEQ ID NO
125) 29 AMX237.C5 2.55 2.36 ND ND
(SEQ ID NO
126) 30 AMX236.A12 2.64 2.41 ND ND
(SEQ ID NO
127) 31 AMX236.B8 1.66 1.88 ND ND
(SEQ ID NO
'128) 32 AMX236.A11 2.02 2.02 ND ND
(SEQ ID NO
129) 33 AMX237.D5 1.41 1.48 ND ND
(SEQ ID NO
130) 34 AMX236.E6 1.31 1.49 ND ND
(SEQ ID NO

131) 35 AMX236.C12 1.99 2.24 ND ND
(SEQ ID NO
132) 36 AlVIX237.H10 1.71 1.94 ND ND
(SEQ ID NO
133) 37 AMX237.G7 2.68 2.54 ND ND
(SEQ ID NO
134) 38 AMX237.H8 1.21 1.41 ND ND
(SEQ ID NO
135) 39 AMX236.G4 1.70 1.72 ND ND
(SEQ ID NO
136) 40 AMX236.C1 1.03 3.28 ND ND
(SEQ ID NO
137) 41 AlVIX237.E10 1.12 6.04 ND ND
(SEQ ID NO
138) 42 AMX238.F5 1.05 4.40 ND ND
(SEQ ID NO
139) 43 A1VIX237.C1 0.76 3.47 ND ND
(SEQ ID NO
140) 44 AMX237.B12 1.13 4.67 ND ND
(SEQ ID NO
141) 45 AMX238.A6 0.92 3.47 ND ND
(SEQ ID NO
142) 46 AMX238.A11 0.85 4.54 ND ND
(SEQ ID NO
143) 47 AMX236.C6 1.06 5.77 ND ND
(SEQ ID NO
144) 48 AMX238.F6 1.18 5.36 ND ND
(SEQ ID NO
145) 49 AMX236.E2 0.93 3.59 ND ND
(SEQ ID NO
146) 50 AMX238.G4 1.09 1.39 ND ND
(SEQ ID NO
147) 51 AMX23 8.H9 1.11 1.32 ND ND
(SEQ ID NO
148) 52 AMX237.B 1 2.00 2.10 ND ND
(SEQ ID NO
149) 53 AMX238.A3 1.36 1.03 ND ND
(SEQ ID NO
150) 54 AMX237.C4 0.97 1.31 ND ND
(SEQ ID NO
151) 55 AMX237.E5 0.97 1.15 ND ND
(SEQ ID NO
152) 56 AMX237.F1 0.98 1.22 ND ND
(SEQ ID NO
153) 57 AMX237.F5 0.99 1.22 ND ND
(SEQ ID NO
154) 58 ANIX238.H11 0.98 1.14 ND ND
(SEQ ID NO
155) 59 AMX237.G2 1.02 1.16 ND ND
(SEQ ID NO
156) 60 AMX238.A12 1.23 0.99 ND ND
(SEQ ID NO
157) 61 AMX236.C9 1.24 1.00 ND ND

(SEQ ID NO
158) 62 AMX236.H1 1.10 1.14 ND ND
(SEQ ID NO
159) 63 AMX236.F7 1.18 1.20 ND ND
(SEQ ID NO
160) 64 AMX236.B3 1.54 1.41 ND ND
(SEQ ID NO
161) 65 AMX238.D9 1.22 0.97 ND ND
(SEQ ID NO
162) 66 AMX238.F7 1.20 1.88 ND ND
(SEQ ID NO
163) 67 AIVIX236.G1 1.47 1.51 ND ND
(SEQ ID NO
164) * used full length human vWF (SEQ ID NO 7) and rabbit vWF Al domain (SEQ ID NO
6) for aptamer screen and aptamer KDs ND= not done [00267] The nucleic acid sequences of the DNA aptamers characterized in Table 17 above are described below. The unique sequence of each aptamer below begins at nucleotide 21, immediately following the sequence CTACCTACGATCTGACTAGC (SEQ ID NO 52), and runs until it meets the 3' fixed nucleic acid sequence GCTTACTCTCATGTAGTTCC
(SEQ
ID NO 223).

[00268] Unless noted otherwise, individual sequences listed below are represented in the 5' to 3' orientation and were selected under DNA SELEXTM wherein all of the nucleotides are deoxy.

vWFDNA SELEX" 2, Farnily 1.1 [00269] Families 1.1 and 1.2 yielded the parent of ARC 1029 (SEQ ID NO 214).
The predicted core nucleic acid binding sequences to the target von Willebrand Factor are underlined and shown in bold for aptamers AMX237.E9 (SEQ ID NO 104) and AMX238.H5 (SEQ ID NO 118) below.

AMX237.E9 (SEQ ID NO 104) CTACCTACGATCTGACTAGCTCCAGTGTTTTGTCTAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX237.B11 (SEQ ID NO 109) CTACCTACGATCTGACTAGCTCCAGTGTTTTATCTAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX237.A11 (SEQ ID NO 98) CTACCTACGATCTGACTAGCTCCAGTGTTTTATCCAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX238.G5 (SEQ ID NO 106) CTACCTACGATCTGACTAGCTCCAGTGTTTTATTCAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX238.D8 (SEQ ID NO 111) CTACCTACGATCTGACTAGCTCCAGTGTTTTATCCAACAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX237.E2 (SEQ ID NO 102) CTACCTACGATCTGACTAGCTCCAGTGTTTCATCTAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX237.H5 (SEQ ID NO 101) CTACCTACGATCTGACTAGCTCCAGTGTTTCATTTAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX238.D5 (SEQ ID NO 108) CTACCTACGATCTGACTAGCTCCAGTGTTTTATTCAATAACCGTGCGGTGTCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX237.A2 (SEQ ID NO 99) CTACCTACGATCTGACTAGCTCCAGTGTTTCATCCAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX238.D12 (SEQ ID NO 100) CTACCTACGATCTGACTAGCTCCAGTGTTTCATTCAATAACCGTGCGGTGCCTCCGTGAGCTTACTCTCATGTAGTTCC

AMX237.F6 (SEQ ID NO 110) CTACCTACGATCTGACTAGCTCCAGTGTTTTATCTAATAACCGTGCGGTGCCTCCGTGATGCTTACTCTCATGTAGTTC
C
AMX237.D11 (SEQ ID NO 105) CTACCTACGATCTGACTAGCTCCAGTGTTTTATATAATAACCGTGCGGTGCCTCCGTGATGCTTACTCTCATGTAGTTC
C
AMX237.B4 (SEQ ID NO 103) CTACCTACGATCTGACTAGCTCCAGTGTTTCATCCAATAACCGTGCGGTGCTTCCGTGAGCTTACTCTCATGTAGTTCC

AMX236.F8 (SEQ ID NO 113) CTACCTACGATCTGACTAGCTCCAGTGTTTTATCCAATAACCGTGCGGTGCCTCCGTGATGCTTACTCTCATGTAGTTC
C
AMX237.C7 (SEQ ID NO 107) CTACCTACGATCTGACTAGCTCCAGTGTTTTATTCAATAACCGTGCGGTGCCTCCGTGATGCTTACTCTCATGTAGTTC
C
AMX238.G6 (SEQ ID NO 112) CTACCTACGATCTGACTAGCTCCAGTGTTTTATCCAATAACCGTGCGGGGCCTCCGTGATGCTTACTCTCATGTAGTTC
C
vWF DNA SELEXTM 2, Family # 1.2 AMX238.H5 (SEQ ID NO 118) CTACCTACGATCTGACTAGCGTGCAGTGCCTATTCTAGGCCGTGCGGTGCCTCCGTCACGCTTACTCTCATGTAGTTCC

AMX237.C11 (SEQ ID NO 119) CTACCTACGATCTGACTAGCGTGCAGTGCCTATTCTAGGCCGTGCGGTGCCTCCGTCATGCTTACTCTCATGTAGTTCC

AMX238.E7 (SEQ ID NO 116) CTACCTACGATCTGACTAGCGTGCAGTGCCTATTTTAGGCCGTGCGGTGCCTCCGTCACGCTTACTCTCATGTAGTTCC

AMX237.G6 (SEQ ID NO 114) CTACCTACGATCTGACTAGCGTGCAGTGCCTATTCCAGGCCGTGCGGTGCCTCCGTCACGCTTACTCTCATGTAGTTCC

AMX238.F2 (SEQ ID NO 120) CTACCTACGATCTGACTAGCATGCAGTGCCCATTCTAGGCCGTGCGGTGCCTCCGTCATGCTTACTCTCATGTAGTTCC

AMX238.E9 (SEQ ID NO 115) CTACCTACGATCTGACTAGCGTGCAGTGCCCATCTTAGGCCGTGCGGTGCCTCCGTCACGCTTACTCTCATGTAGTTCC

AMX238.F3 (SEQ ID NO 117) CTACCTACGATCTGACTAGCGTGCAGTGCCTATTTTAGGTCGTGCGGGGCCTCCGTCACGCTTACTCTCATGTAGTTCC

AMX237.F10 (SEQ ID NO 124) CTACCTACGATCTGACTAGCGTGCAGTGCCCATTCCAGGCCGTGCGGTATCCTCCGTCACGCTTACTCTCATGTAGTTC
C
AMX237.C5 (SEQ ID NO 126) CTACCTACGATCTGACTAGCGTGCAGTGCCTATCTCAGGCCGTGCGGTATCCTCCGTCACGCTTACTCTCATGTAGTTC
C
AMX236.H2 (SEQ ID NO 125) CTACCTACGATCTGACTAGCGTGCAGTGCCTATCCCAGGCCGTGCGGTAGCCTCCGTCACGCTTACTCTCATGTAGTTC
C

[00270] The predicted secondary structure and core nucleic acid sequences required for binding to the vWF target of some embodiments of the invention comprised in Family#1 of this aptamer selection is depicted in Figure 15 as SEQ ID NO 220.

vWF DNA SELEYTM 2, Binding Fafnily # 2 AMX237.C9 (SEQ ID NO 123) CTACCTACGATCTGACTAGCTTGGTAGTGACTTTGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX237.F12 (SEQ ID NO 122) CTACCTACGATCTGACTAGCTTGGTAGCGATTTTGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX237.F9 (SEQ ID NO 121) CTACCTACGATCTGACTAGCTTGGTAGCGATTCTGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX237.G7 (SEQ ID NO 134) CTACCTACGATCTGACTAGCTTGGTAGCGACTTTGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX236.A12 (SEQ ID NO 127) CTACCTACGATCTGACTAGCTTGGTAGCGACTCTGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX236.G4 (SEQ ID NO 136) CTACCTACGATCTGACTAGCTTGGTAGCGACTTTGTGGAGATGCGGTTTGGTTGACGTCAGCTTACTCTCATGTAGTTC
C
AMX236.C12 (SEQ ID NO 132) CTACCTACGATCTGACTAGCTTGGTAGCGACTCCGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C

AMX236.A11 (SEQ ID NO 129) CTACCTACGATCTGACTAGCTTGGTAGCGACTCTGTGGAGCTGCGGTCTGGCCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX236.E6 (SEQ ID NO 131) CTACCTACGATCTGACTAGCTTGGTAGCGACCCTGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX236.B8 (SEQ ID NO 128) CTACCTACGATCTGACTAGCTTGGTAGCGACTCTGTGGAGCTGCGGTCTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
ANIX237.H8 (SEQ ID NO 135) CTACCTACGATCTGACTAGCTTGGTAGCGACTTTGTGGAGCTGCGGTTTGGTCGACATCAGCTTACTCTCATGTAGTTC
C
AMX237.D5 (SEQ ID NO 130) CTACCTACGATCTGACTAGCTTGGTAGCGACACTGTGGAGCTGCGGTTTGGTTGACGTCAGCTTACTCTCATGTAGTTC
C
AMX237.H10 (SEQ ID NO 133) CTACCTACGATCTGACTAGCTTGGTAGCGACTCAGAGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C
AMX237.B 1(SEQ ID NO 149) CTACCTACGATCTGACTAGCTTGGTAGCGACACAGTGGAGCTGCGGTTTGGTCGACGTCAGCTTACTCTCATGTAGTTC
C

The consensus sequence for DNA SELEXTM 2 Family #2 is as follows:

CTACCTACGATCTGACTAGCTTGGTAG Y GA Y (Y/A) Y (Y/A) G (T/A) GGAG (C/A) TGCGGT Y
TGG YY GAC R
TCAGCTTACTCTCATGTAGTTCC

Where Y= C or T, R= A or G and (Y/A)=C, T or A, vWF DNA SELEeY'M 2, Binding Farnily # 3 [00271] This family is equivalent to vWF DNA SELEXTM 1, Family # 1 described above in that the sequences in both families are more than 90% identical.

AMX238.A11 (SEQ ID NO 143) CTACCTACGATCTGACTAGCGGAATGAGAGTGTTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX237.C1 (SEQ ID NO 140) CTACCTACGATCTGACTAGCGGAATGAGGATGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX236.C6 (SEQ ID NO 144) CTACCTACGATCTGACTAGCGGAATGAGAGTGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

A1VIX236.C1 (SEQ ID NO 137) CTACCTACGATCTGACTAGCGGAATGAGAATGTTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX237.E10 (SEQ ID NO 138) CTACCTACGATCTGACTAGCGGAATGAGAATGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX238.F6 (SEQ ID NO 145) CTACCTACGATCTGACTAGCGGAATGAGTATGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX236.E2 (SEQ ID NO 146) CTACCTACGATCTGACTAGCGGAATGAGTATGCTGATGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX237.B12 (SEQ ID NO 141) CTACCTACGATCTGACTAGCGGAATGAGAATGCAGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX238.A6 (SEQ ID NO 142) CTACCTACGATCTGACTAGCGGAATGAGAATGCAGATGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC

AMX238.F5 (SEQ ID NO 139) CTACCTACGATCTGACTAGCGGAATGAGAAGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCATGTAGTTCC
vWF DNA SELEfTM 2, Binding Family# 4 AMX237.G2 (SEQ ID NO 156) CTACCTACGATCTGACTAGCTTTCAGTCTTTCATATTTATAGGGTTTGGCATTGGGTCTGGCTTACTCTCATGTAGTTC
C
AMX237.C4 (SEQ ID NO 151) CTACCTACGATCTGACTAGCTTTCAGTCTTCCACATTTATAGGGTTTGGCATTGGGTCTGGCTTACTCTCATGTAGTTC
C
AMX237.F5 (SEQ ID NO 154) CTACCTACGATCTGACTAGCTTTTAGTCTTCCACATTTATAGGGTTTGGCATTGGGTCTGGCTTACTCTCATGTAGTTC
C
AMX238.H11 (SEQ ID NO 155) CTACCTACGATCTGACTAGCTTTCAGTCTTTCACATTTATAGGGTTTGGCATTGGGTCTGGCTTACTCTCATGTAGTTC
C
AMX238.G4 (SEQ ID NO 147) CTACCTACGATCTGACTAGCTTGTCGCACTTTTGGTTGGTCTGGTTGGTTCTAAGTGCGCTTACTCTCATGTAGTTCC
AMX237.E5 (SEQ ID NO 152) CTACCTACGATCTGACTAGCTTTCAGTCTTCTACATTTATAGGGTTTGGCATTGGGTCTGGCTTACTCTCATGTAGTTC
C
AMX238.H9 (SEQ ID NO 148) CTACCTACGATCTGACTAGCTTGTCGCACTTTTGGTTGGTCTGGTTGGTTTTAAGTGCGCTTACTCTCATGTAGTTCC
AMX237.F1 (SEQ ID NO 153) CTACCTACGATCTGACTAGCTTTCAGTCTTCCACGTTTATAGGGTTTGGCATTGGGTCTGGCTTACTCTCATGTAGTTC
C
vWF DNA SELEATM 2, Family #5 AMX236.G1 (SEQ ID NO 164) CTACCTACGATCTGACTAGCCTCAGATTGACTCCGGCTGACTTGTTTTAATCTTCTGAGTGCTTACTCTCATGTAGTTC
C
AMX236.B3 (SEQ ID NO 161) CTACCTACGATCTGACTAGCCTTACCTATTCCCTTCTGCGGAATACGTCGAGTACTATGCTTACTCTCATGTAGTTCC
AMX236.F7 (SEQ ID NO 160) CTACCTACGATCTGACTAGCCCCCACTTATCGTGTACCTTATGATATGTCGAATACTCTTGCTTACTCTCATGTAGTTC
C
AMX236.H1 (SEQ ID NO 159) CTACCTACGATCTGACTAGCCTCAGATTGACTCCGGCCGACTTGTTTTAATCTTCTGAGTGCTTACTCTCATGTAGTTC
C

The consensus sequences for DNA SELEXTM 2 Family #5 are as follows:

Family5.1 = SEQ ID NO 164 and SEQ ID NO 159 CTACCTACGATCTGACTAGCCTCAGATTGACTCCGGCYGACTTGTTTTAATCTTCTGAGTGCTTACTCTCATGTAGTTC
C
Wherein Y = Cor T

Family5.2 = SEQ ID NO 161 & SEQ ID NO 160 CTACCTACGATCTGACTAGCC YY AC Y TAT Y (C/G) Y (C/G) T(T/A) C Y(G/T) Y R (G/T) R
ATA Y GTCGA R TACT (A/C) TGCTTACTCTCATGTAGTTCC

Where Y= C or T, R = A or G
vWFDNASELEYM2. Family #6 AMX238.A3 (SEQ ID NO 150) CTACCTACGATCTGACTAGCTCAAAGTATTACTTATTGGCAATAAGTCGTTTACTCTATAGCTTACTCTCATGTAGTTC
C
AMX238.F7 (SEQ ID NO 163) CTACCTACGATCTGACTAGCAAGGGGATTGGCTCCGGGTCTGGCGTGCTTGGCATCTTTGGCTTACTCTCATGTAGTTC
C
AMX236.C9 (SEQ ID NO 158) CTACCTACGATCTGACTAGCCAGTTCTGGGAAAAATTATTTTTTTATTTCGATCGTATTTGCTTACTCTCATGTAGTTC
C
AMX238.D9 (SEQ ID NO 162) CTACCTACGATCTGACTAGCCAGTTCTGGGAAAAATCATTTTTTATTTCGATCGTATTTGCTTACTCTCATGTAGTTCC

A1VIX238.A12 (SEQ ID NO 157) CTACCTACGATCTGACTAGCCAGTTCTGGGAAAAATTATTTTTTTATTTCGATCGTATATGCTTACTCTCATGTAGTTC
C

EXAMPLE 2: COMPOSITION AND SEQUENCE OPTIMIZATION AND SEQUENCES
EXAMPLE 2A: Truncation of rRfY vWF aptamers [00272] On the basis of the vWF binding analysis described in Example 1 above and the cell based assay data described in Example 3 below, aptamer ARC840 (AMX201.C8) (SEQ
ID NO 23) was chosen from the rRfY selections for further characterization.

[00273] In order to identify the core structural elements required for vWF
binding, the 3'-boundary of ARC840 (AMX201.C8) (SEQ ID NO 23) was determined. The full length RNA transcript was labeled at the 5'-end with y-32P ATP and T4 polynucleotide kinase.
Radiolabeled ligands were subjected to partial alkaline hydrolysis and then selectively bound in solution to human von Willebrand Factor Al domain (SEQ ID NO 5) at 500 nM
before being passed through nitrocellulose filters. Both the retained and the not retained oligonucleotides were resolved separately on 8 % denaturing polyacrylamide gels. The smallest oligonucleotide bound to vWF defined the 3'- boundary. On the basis of the boundary experiments as well as visual inspection of predicted folds, a panel of minimized sequences was designed. Folds of all the nucleic acid sequences of the invention were predicted using RNAstructure, Version 4.1 downloaded from the University of Rochester.
RNAstructure is a Windows implementation of the Zuker algorithm for RNA
secondary structure prediction based on free energy minimization (Mathews, D.H.; Disney, M.D.;
Childs, J.L.; Schroeder, S.J.; Zuker, M.; and Turner, D.H., "Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA
secondary structure," 2004. Proceedings of the National Acadefny of Sciences, US, 101, 7287-7292). RNAstructure 4.1 uses the most current thermodynamic parameters from the Turner lab.

[00274] For the minimized rRfY aptamers, described below, the purines comprise a 2'-OH
and the pyrimidines comprise a 2'-F modification, while, the templates and primers comprise unmodified deoxyribonucleotides.

[00275] For the minimized rRfY aptamer 5'-GGAGCGCACUCAGCCACCCUCGCAAGCAUUUUAAGAAUGACUUGUGCCGCUGG
CUG -3' (SEQ ID NO 165), the 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA
-3' (SEQ ID NO 166) and 3' PCR primer 5'- CAGCCAGCGGCACAAGTC -3' (SEQ ID
NO 167) were used to amplify template 5'-TCGATCTAATACGACTCACTATAGGAGCGCACTCAGCCACCCTCGCAAGCATTTT
AAGAATGACTTGTGCCGCTGGCTG-3' (SEQ ID NO 168).

[00276] For minimized aptamer 5'-GGACCACCCUCGCAAGCAUUUUAAGAAUGACUUGUGCCGCUGGUCC -3'(SEQ ID

NO 169), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO
166) and 3' PCR primer 5'- GGACCAGCGGCACAAGTC -3' (SEQ ID NO 170) were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGACCACCCTCGCAAGCATTTTAAGAATGA
CTTGTGCCGCTGGTCC -3'(SEQ ID N0171).

[00277] For minimized aptamer 5'-GGACCACCCUCGCAAGCAUUGAGAAAUGACUUGUGCCGCUGGUCC -3'(SEQ ID
NO 172), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR primer 5'- GGACCAGCGGCACAAGTC -3' (SEQ ID NO 170) were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGACCACCCTCGCAAGCATTGAGAAATGAC
TTGTGCCGCTGGTCC -3'(SEQ ID NO 173).

[00278] For minimized aptamer 5'-GGACCACCCUCGCAACGAGAGUUGUGCCGCUGGUCC -3' (SEQ ID NO 174), 5' PCR
primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO166) and 3' PCR
primer 5'- GGACCAGCGGCACAACTC -3' (SEQ ID NO 175) were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGACCACCCTCGCAACGAGAGTTGTGCCGC
TGGTCC -3' (SEQ ID NO 176).

[00279] All of the above minimized aptamer sequences were transcribed, gel-purified on 15% denaturing polyacrylamide gels, 5 3aP end-labeled with y3aP ATP, and then desalted using two Centri-Spin 10 columns (Princeton Separations Cat.# CS-101, Adelphia, NJ).
These minimers were primarily characterized in the cellular assays described in Example 3 below.

EXAMPLE 2B: Truncation of rRdY vWF Aptamers [00280] On the basis of the vWF binding analysis described in Example 1 above and cell based assay data described in Example 3 below, aptamers AMX203.G9 (SEQ ID NO
44) and AMX205.F7 (SEQ ID NO 49), respectively, were identified for further characterization.

[00281] In order to identify the core structural elements required for vWF
binding, the 3'-boundaries of aptamers AMX203.G9 (SEQ ID NO 44) and AMX205.F7 (SEQ ID NO 49) were determined. The full length RNA transcripts were labeled at the 5'-end with y-32P ATP
and T4 polynucleotide kinase. Radiolabeled ligands were subjected to partial alkaline hydrolysis and then selectively bound in solution to human vWF Al domain (SEQ
ID NO 5) at 500 nM before being passed through nitrocellulose filters. Retained oligonucleotides were resolved on 8% denaturing polyacrylamide gels. The smallest oligonucleotide bound to vWF
defined the 3'- boundary. On the basis of the boundary experiments as well as visual inspection of predicted folds using RNAstructure, Version 4.1, a panel of minimized sequences was designed.

[00282] For the minimized rRdY aptamers, described below, the purines are 2'-OH purines and the pyrimidines are deoxy-pyrimidines, while the templates and primers comprise unmodified deoxyribonucleotides. The following three minimized aptamer sequences were derived from DL.159.87.70 (SEQ ID NO 44):

[00283] For minimized aptamer sequence 5'-GGAGCGCACTCAGCCACGGGGTGGGTAGACGGCGGGTATGTGGCT -3'(SEQ ID
NO 177), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR primer 5'-AGCCACATACCCGCCGTC -3' (SEQ ID NO 178) were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCGCACTCAGCCACGGGGTGGGTAGA
CGGCGGGTATGTGGCT -3' (SEQ ID NO 179).

[00284] For minimized aptamer sequence 5'-GGAGCCACGGGGTGGGTAGACGGCGGGTATGTGGCTCC -3'(SEQ ID NO 180), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3'(SEQ ID NO 166) and 3' PCR
primer 5'-GGAGCCACATACCCGCCG -3' (SEQ ID NO 181), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCCACGGGGTGGGTAGACGGCGGGTA
TGTGGCTCC -3' (SEQ ID N0182).

[00285] For minimized aptamer sequence [00286] 5'- GGGACGGGGTGGGTAGACGGCGGGTATGTCCC -3'(SEQ ID NO 183), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR primer 5'-GGGACATACCCGCCG -3'(SEQ ID NO 184), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGGACGGGGTGGGTAGACGGCGGGTATGT
CCC -3' (SEQ ID NO 185).

[00287] The following seven minimized aptamer sequences were derived from the aptamer according to SEQ ID NO 49:

[00288] For minimized aptamer sequence 5'-GGAGCGCACTCAGCCACACGACATTGGCGGGTTGTAATTACCACGCATGGCTG -3'(SEQ ID NO 186), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ
ID NO 166) and 3' PCR primer 5'- CAGCCATGCGTGGTAATT-3' (SEQ ID NO 187), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCGCACTCAGCCACACGACATTGGCGG
GTTGTAATTACCACGCATGGCTG -3'(SEQ ID NO188).

[00289] For minimized aptamer sequence 5'-GGAGCCACACGACATTGGCGGGTTGTAATTACCACGCATGGCTCC-3' (SEQ ID NO
189), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR primer 5'- GGAGCCATGCGTGG-3' (SEQ ID N0190), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCCACACGACATTGGCGGGTTGTAATT
ACCACGCATGGCTCC-3' (SEQ ID N0191).

[00290] For minimized aptamer sequence 5'-GGAGCCACACGACATTGGCGGGCGAGAGCCACGCATGGCTCC-3' (SEQ ID
NO 192), 5' PCR primer b 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO
166) and 3' PCR primer 5'- GGAGCCATGCGTGG-3' (SEQ ID N0190) , were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCCACACGACATTGGCGGGCGAGAGC
CACGCATGGCTCC-3'(SEQ ID NO 193).

[00291] For minimized aptamer sequence 5'-GGAGCCACACGACATTGGCGAGAGCCACGCATGGCTCC-3'(SEQ ID NO 194), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR
primer 5'- GGAGCCATGCGTGG-3'(SEQ ID NO 190), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCCACACGACATTGGCGAGAGCCACG
CATGGCTCC-3' (SEQ ID NO 195).

[00292] For minimized aptamer sequence 5'-GGAGCCACACGAGAGTGGCGGGTTGTAATTACCACGCATGGCTCC-3'(SEQ ID NO
196), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3'(SEQ ID NO 166) and 3' PCR primer 5'- GGAGCCATGCGTGG-3' (SEQ ID NO 190), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCCACACGAGAGTGGCGGGTTGTAATT
ACCACGCATGGCTCC-3' (SEQ ID NO 197).

[00293] For minimized aptamer sequence 5'-GGCCACACGACATTGGCGGGCGAGAGCCACGCATGGCC-3' (SEQ ID NO 198), 5' PCR primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR
primer 5'- GGCCATGCGTGGCTCTC -3'(SEQ ID NO 199), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGCCACACGACATTGGCGGGCGAGAGCCA
CGCATGGCC-3'(SEQ ID NO 200).

[00294] For minimized aptamer sequence 5'-GGAGCCACACGACATTGGCGCGAGAGCGCATGGCTCC-3'(SEQ ID NO 201), 5' PCR
primer 5'- GATCGATCTAATACGACTCACTATA -3' (SEQ ID NO 166) and 3' PCR
primer 5'- GGAGCCATGCGCTCTCG -3'(SEQ ID NO 202), were used to amplify template 5'-GATCGATCTAATACGACTCACTATAGGAGCCACACGACATTGGCGCGAGAGCGC
ATGGCTCC-3'(SEQ ID NO 203).

rRdY vWF Minimer Bindin~

[00295] All minimer sequences were transcribed, gel-purified on 15% denaturing polyacrylamide gels, 5 3aP end-labeled with y32P ATP, and then desalted using two Centri-Spin 10 columns (Princeton Separations Cat. # CS-101, Adelphia, NJ). For KD
determination, minimer transcripts were tested for direct binding to full length human vWF
(SEQ ID NO 7), human vWF Al domain (SEQ ID NO 5), and rabbit vWF Al domain (SEQ ID NO 6) using an 8 point protein titration from 0-300 nM (3 fold dilutions) in 1X Dulbecco's PBS containing 0.1 mg/mL BSA (in a final volume of 50 uL) for 30 minutes at room temperature and then applied to a nitrocellulose and nylon filter sandwich in a dot blot apparatus (Schleicher and Schuell, Keene, NH). KD values were calculated by fitting the equation y=
(max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Software).
Results of protein binding characterization are tabulated in Table 18.

Table 18: rRdY aptamer minimer binding data, only aptamers that showed potent activity in cellular assays had their binding affinity measured. (ND = not done) # Minimer Full length human Human vWF Al Rabbit vWF Al vWF KD (nM) domain KD (nM) domain KD (nM) 3 SEQIDNO 10+5 ND 14 7 6 2 0.2 4 1 8 1 9 3 0.6 5 2 11 2 ND ND ND

EXAMPLE 2C: Truncation of DNA SELEXTM #1 vWF Aptamer [00296] On the basis of the vWF binding analysis described in Example 1 above, as well as visual inspection of predicted folds, a panel of minimized sequences was designed for the best class of binders from Family #1. In this case all of the binders from Family #1 are structurally related and fell into one of four mutually exclusive folds (predicted by RNAStructure 4.1) as determined by the base-pairing constraints put on the 5'- and 3'-ends of the molecules. We synthesized and tested each of the four predicted folds. The sequence for each of the synthesized minimized DNA aptamers is as follows:

5'-CCAGCGGAATGAGAATGCTGATGGATTGCTCAGGTCTGCTGG-3' ARC 845 (SEQ ID NO 205) 5'ATGAGAGTGCTGGTGGATTGCTCAGGTCTGCTGGCTGCTTACTCTCAT-3' 5'- CGATCTGACTAGCGGAATGAGAATGCTGGTGGATCG -3' 5'- GATCTGACTAGCGCAATGAGGATGCdTGATGGATTGCTCAGGTC -3' [00297] All minimer DNA sequences were chemically synthesized, 5 32P end-labeled with 7 32P ATP, and then desalted using two Centri-Spin 10 columns (Princeton Separations, Cat.#
CS-101, Adelphia, NJ). For KD determination, minimers were tested for binding to human vWF Al domain (SEQ ID NO 5) using a competition dot blot assay with a constant protein concentration of 10 nM and a 12 point cold competitor DNA titration (3 uM, 1 uM, 333 nM, 100 nM, 33 nM, 10 nM, 3.3 nM, 1 nM, 333 pM, 100 pM, 33.3 pM, 0 pM) in 1X
Dulbecco's PBS containing 0.1 mg/mL BSA (final volume of 50 uL) for 30 minutes at room temperature.
KD values were calculated by fitting the equation y= (max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Software). Results of protein binding characterization are tabulated in Table 19 below. As shown, only ARC845 of the minimized constructs retained the ability to bind to either human or rabbit vWF Al domain Table 19. DNA 1 Minimer Binding Data (ND = Not Done) # Minimer Full length Human vWF Al Rabbit vW]
human vWF domain KD (nM) domain KD
KD (nM) 1 ARC845 = No binding 10 2 SEQ ID NO 204 ND No binding No bi 3 SEQ ID NO 206 ND No binding 4 SEQ ID NO 207 ND No binding [00298] Based on these binding results, ARC 845 (SEQ ID NO 205) represents the core nucleic acid binding sequence of the DNA SELEXTM 1, Family 1 aptamers.

EXAMPLE 2D: DNA vWF Alternating Selection Aptarner Minimization [00299] On the basis of the vWF binding analysis described in Example 1 above and cell based assay data described in Example 3 below as well as visual inspection of predicted folds for aptamers AMX237.Bl 1 (SEQ ID NO 109) and AMX236.A12 (SEQ ID NO 127), a series of minimized sequences were designed. Additionally, based on the observation that aptamers AMX237.G6 (SEQ ID NO 114), AMX238.E9 (SEQ ID NO 115), and AMX238.H5 (SEQ ID
NO 118) appeared to be slightly more potent in cellular assays, a series of minimized sequences ARC 1027-103 1 (SEQ ID NOS 212-216) were synthesized. The minimized sequences according to SEQ ID NO 208 and SEQ ID NO 209 represent two mutually exclusive folds predicted from the full length aptamer AMX237.B11 (SEQ ID NO
109).
[00300] The nucleic acid sequences for above-described minimized DNA aptamers are as follows:

(SEQ ID NO 208) 5'- GGACGATCTGACTAGCTCCAGTGTTTTATCTAATAACCGTCC -3' (SEQ ID NO 209) 5'- GGAGCTCCAGTGTTTTATCTAATAACCGTGCGGTGCCTCCGTGAGCTCC -3' (SEQ ID NO 210) 5'- GGAGCTGCGGTTTGGTCGACGTCAGCTCC -3' (SEQ ID NO 211) 5'- GGTAGCGACTCTGTGGAGCTGCGGTTTGG -3' ARC 1027 (SEQ ID NO 212) 5'-GGCGTGCAGTGCCTATTCTAGGCCGTGCGGTGCCTCCGTCACGCC-3T-3' ARC1028 (SEQ ID NO 213) 5'-dGCGTGCAGTGCCT-[PEG]-AGGCCGTGCGGTGCCTCCGTCACGCC-3T-3' ARC 1029 (SEQ ID NO 214) 5'-GGCGTGCAGTGCC-[PEG]-GGCCGTGCGGTGCCTCCGTCACGCC-3T -3' ARC1030 (SEQ ID NO 215) 5'- GGCGTGCAGTGCCTATTCTAGGCCGTGCGG-[PEG]-CCGTCACGCC-3T -3' ARC 1031 (SEQ ID NO 216) 5'- GGCGTGCAGTGCCT-[PEG]-AGGCCGTGCGG-[PEG]-CCGTCACGCC-3T -3' [00301] All of the above minimized aptamer sequences were chemically synthesized, gel-purified on 15% denaturing polyacrylamide gels and then desalted using two Centri-Spin 10 columns (Princeton Separations Cat.# CS-101, Adelphia, NJ) using standard methods and techniques. The minimized sequences were characterized in cellular assays as described in Example 3 below.

[00302] Of the initial series, SEQ ID NO 208 to SEQ ID NO 211, only SEQ ID NO
208 demonstrated activity in the cellular assays (see Example 3, below).
Comparison of the sequences of aptamers AMX237.B1 1 (SEQ ID NO 109) and AMX237.G6 (SEQ ID NO
114), AMX238.E9 (SEQ ID NO 115), and AMX238.H5 (SEQ ID NO 118) revealed them to be closely related and to support the predicted secondary structure of the minimized aptamer (SEQ ID NO 208) (see Figures 14 and 15). These molecules, ARC1027-1031 (SEQ ID
NOS
212-216) further tested our hypothesis about the folding and secondary structure of aptamers AMX237.G6 (SEQ ID NO 114), AMX238.E9 (SEQ ID NO 115), and AMX238.H5 (SEQ ID
NO 118) (see Figures 5, 14 and 15).

[00303] For KD detennination, the minimized sequences that showed potent activity in the cellular assays as described in Example 3 below were 5 32P end-labeled with 7 32P ATP, and then desalted using two Centri-Spin 10 columns (Princeton Separations Cat.# CS-101, Adelphia, NJ). Minimers were tested for direct binding to full length human vWF (SEQ ID
NO 7), and rabbit vWF A1 domain (SEQ ID NO 6) using a 9 point protein titration (100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 300 pM, 100 pM, 30 pM, 0 pM) (see Figure 6) in 1X
Dulbecco's PBS containing 0.1 mg/mL BSA (final volume of 50 uL) for 30 minutes at room temperature and then applied to a nitrocellulose and nylon filter sandwich in a dot blot apparatus (Schleicher and Schuell, Keene, NH). KD values were calculated by fitting the equation y= (max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Software). Results of protein binding characterization are tabulated in Table 20.

Table 20. DNA 2 aptamer minimer binding data, only aptamer minimers that showed potent activity in cellular assays had their binding affinity measured (see Example 3 below) ('ND' not done) # Minimer Full length human Human vWF Al Rabbit vWF Al vWF KD (nM) domain KD (nM) domain KD (nM) ARC 1027 0.8 ND 4.6 (SEQ ID NO 212) 6 aIZC1028 1.1 ND 3.8 (SEQ ID NO 213) 7 ARC1029 1.4 :L 0.2 ND 6.5 1.5 (SEQ ID NO 214) 8 AxC1030 No binding ND No binding (SEQ ID NO 215) 9 ARC1031 No binding ND No binding (SEQ ID NO 216) EXAMPLE 2E: Optimization of ARC 1029 Through Aptamer Medicinal Chemistry [00304] Highly stable and potent variants of ARC1029 (SEQ ID NO 214) were identified through a systematic synthetic modification approach involving 5 phases of aptamer synthesis, purification and assay for binding activity. To facilitate the ease of chemical synthesis during aptamer modification, the PEG spacer of ARC 1029 (SEQ ID NO
214 was replaced with a short oligonucleotide sequence, dTdTdC, resulting in ARC1115 (SEQ ID NO
221)as seen in Figure 16 and Table 21 below. A highly stabilizing 3'-inverted dT was synthesized on the three prime end of ARC 1115 (SEQ ID NO 221)resulting in ARC

(SEQ ID NO 222) (SEQ ID NO 222) also as seen in Figure 16 and Table 21 below.
Once both ARC 1115 (SEQ ID NO 221)and ARC 1172 (SEQ ID NO 222) (SEQ ID NO 222) had been shown to bind to human vWF, ARC 1172 (SEQ ID NO 222) (SEQ ID NO 222) was used as the basic template for modification as described in the Examples below.

[00305] In phase 1 of the modification process, each individual residue in ARC
1172 (SEQ
ID NO 222) was replaced by the corresponding 2'-O methyl containing residue (with dT
being replaced by mU unless otherwise specified) resulting in ARC1194 (SEQ ID
NO 223) -ARC1234 as shown in Table 21 below and Figure 16. Additionally in phase 1, a set of composite replacements were made in the stem regions of ARC 1172 (SEQ ID NO
222) resulting in ARC1235 to 1243 also as shown in Table 21 and in Figure 16.

[00306] As described herein, see e.g., in Examples 1, 2, and 3, during the processes of clone screening and truncation that led to ARC 1029 (SEQ ID NO 214, there was excellent agreement among the relative potency of aptamers in binding (dot-blot), FACS
and BIPA
assays. Accordingly, affinity for full length human vWF measured as measured in dot-blot assay binding assays was used to characterize relative affinity of the majority of the aptamer test variants synthesized.

[00307] For KD determination, chemically synthesized aptamers were purified using denaturing polyacrylamide gel electrophoresis, 5'end labeled with y-32 P ATP
and were tested for direct binding to full length human vWF (Calbiochem Cat.# 681300, La Jolla, CA). An 8 point protein titration was used in the dot blot binding assay (100n M, 30 nM, 10 nM, 3 nM, 1 nM, 300 pM, 100 pM, 0 pM) ) in 1X Dulbecco's PBS containing 0.1 BSA (final volume of 50 uL) for 30 minutes at room temperature. KD values were calculated by fitting the equation y= (max/(1+K/protein))+yint using KaleidaGraph (KaleidaGraph v. 3.51, Synergy Sofl,ware).
Sequences of the ARC 1029 (SEQ ID NO 214 ) derivatives synthesized, purified and assayed for binding to full length human vWF as well as the results of the protein binding characterization are tabulated Table 21 below, Binding affmity (KD) is presented in the fourth column and extent of aptamer binding at 100 nM vWF is presented in the final column of Table 21.

Table 21: Phase 1 Modification Binding Results Sequence (5' -> 3'), (NH2 = 5'-hexylamine linker SEQ ID phosphoramidite), (3T = inv dT), NO: ARC # (T=dT), (s=phosphorothioate), (mN = 2'-O Methyl containing residue), (PEG = polyethylene % binding 1 col)(dN=deoxY residue) K @ 100nM
g Y ~ n(nM) vWF
221 dGdGdCdGTdGdCdAdGTdGdCd ARC1115 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC 2 36 222 dGdGdCdGTdGdCdAdGTdGdCd ARC1172 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 37 223 mGdGdCdGTdGdCdAdGTdGdCd ARC1194 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 3 46 224 dGmGdCdGTdGdCdAdGTdGdCd ARC1195 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 1 55 225 dGdGmCdGTdGdCdAdGTdGdCd ARC 1196 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 46 226 dGdGdCmGTdGdCdAdGTdGdCd ARC1197 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 46 227 dGdGdCdGmUdGdCdAdGTdGdC
ARC1198 dCTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 0.9 50 228 dGdGdCdGTmGdCdAdGTdGdCd ARC1199 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 19 28 229 dGdGdCdGTdGmCdAdGTdGdCd ARC 1200 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 5 25 230 dGdGdCdGTdGdCmAdGTdGdCd ARC1201 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 0.9 6 231 dGdGdCdGTdGdCdAmGTdGdCd ARC1202 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 0.4 56 232 dGdGdCdGTdGdCdAdGmUdGdC
ARC1203 dCTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 3 40 233 dGdGdCdGTdGdCdAdGTmGdCd ARC1204 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 45 234 dGdGdCdGTdGdCdAdGTdGmCd ARC1205 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 1 50 235 dGdGdCdGTdGdCdAdGTdGdCm ARC1206 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 50 236 dGdGdCdGTdGdCdAdGTdGdCd ARC1207 CmUTdCdGdGdCdCdGTdGdCdG
dGTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 54 237 dGdGdCdGTdGdCdAdGTdGdCd ARC1208 CTmUdCdGdGdCdCdGTdGdCdG
dGTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 45 238 dGdGdCdGTdGdCdAdGTdGdCd ARC1209 CTTmCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 44 239 dGdGdCdGTdGdCdAdGTdGdCd ARC1210 CTTdCmGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 49 240 dGdGdCdGTdGdCdAdGTdGdCd ARC 1211 CTTdCdGmGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 47 241 dGdGdCdGTdGdCdAdGTdGdCd ARC 1212 CTTdCdGdGmCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 49 242 dGdGdCdGTdGdCdAdGTdGdCd ARC 1213 CTTdCdGdGdCmCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 6 43 243 dGdGdCdGTdGdCdAdGTdGdCd ARC1214 CTTdCdGdGdCdCmGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 3 39 244 dGdGdCdGTdGdCdAdGTdGdCd ARC1215 CTTdCdGdGdCdCdGmUdGdCdG
dGTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 3 2 245 dGdGdCdGTdGdCdAdGTdGdCd ARC 1216 CTTdCdGdGdCdCdGTmGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 0.6 40 246 dGdGdCdGTdGdCdAdGTdGdCd ARC1217 CTTdCdGdGdCdCdGTdGmCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 14 18 247 dGdGdCdGTdGdCdAdGTdGdCd ARC 1218 CTTdCdGdGdCdCdGTdGdCmGd GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 32 2 248 dGdGdCdGTdGdCdAdGTdGdCd ARC1219 CTTdCdGdGdCdCdGTdGdCdGm GTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 3 33 249 dGdGdCdGTdGdCdAdGTdGdCd ARC1220 CTTdCdGdGdCdCdGTdGdCdGd GmUdGdCdCTdCdCdGTdCdAdC
dGdCdC-3T 11 17 250 dGdGdCdGTdGdCdAdGTdGdCd ARC1221 CTTdCdGdGdCdCdGTdGdCdGd GTmGdCdCTdCdCdGTdCdAdCd GdCdC-3T 1 43 251 dGdGdCdGTdGdCdAdGTdGdCd ARC1222 CTTdCdGdGdCdCdGTdGdCdGd GTdGmCdCTdCdCdGTdCdAdCd GdCdC-3T 0.9 40 252 dGdGdCdGTdGdCdAdGTdGdCd ARC1223 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCmCTdCdCdGTdCdAdCd GdCdC-3T 36 26 253 dGdGdCdGTdGdCdAdGTdGdCd ARC 1224 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCmUdCdCdGTdCdAdC
dGdCdC-3T 0.5 47 254 dGdGdCdGTdGdCdAdGTdGdCd ARC1225 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTmCdCdGTdCdAdCd GdCdC-3T 11 16 255 dGdGdCdGTdGdCdAdGTdGdCd ARC1226 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCmCdGTdCdAdCd GdCdC-3T 12 25 256 dGdGdCdGTdGdCdAdGTdGdCd ARC1227 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCmGTdCdAdCd GdCdC-3T 3 40 257 dGdGdCdGTdGdCdAdGTdGdCd ARC1228 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGmUdCdAdC
dGdCdC-3T 2 43 258 dGdGdCdGTdGdCdAdGTdGdCd ARC1229 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTmCdAdCd GdCdC-3T 5 37 259 dGdGdCdGTdGdCdAdGTdGdCd ARC1230 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCmAdCd GdCdC-3T 3 46 260 dGdGdCdGTdGdCdAdGTdGdCd ARC1231 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAmCd GdCdC-3T 1 50 261 dGdGdCdGTdGdCdAdGTdGdCd ARC 1232 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCm GdCdC-3T 1 51 262 dGdGdCdGTdGdCdAdGTdGdCd ARC1233 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GmCdC-3T 2 39 263 dGdGdCdGTdGdCdAdGTdGdCd ARC 1234 CTTdCdGdGdCdCdGTdGdCdGd GTdGdCdCTdCdCdGTdCdAdCd GdCmC-3T 2 42 264 mGmGdCmGTmGdCdAdGTdGd ARC1235 CdCTTdCdGdGdCdCdGTdGdCd GdGTdGdCdCTdCdCdGTdCmAd CmGdCdC-3T 13 23 265 dGdGmCdGmUdGdCdAdGTdGd ARC1236 CdCTTdCdGdGdCdCdGTdGdCd GdGTdGdCdCTdCdCdGTmCdA
mCdGmCmC-3T 3 32 266 mGmGmCmGmUmGdCdAdGTd ARC1237 GdCdCTTdCdGdGdCdCdGTdGd CdGdGTdGdCdCTdCdCdGTmCm AmCmGmCmC-3T 41 9 267 dGdGdCdGTdGdCdAdGTmGdCd ARC1238 CTTdCmGmGdCdCdGTdGdCdG
dGTdGdCdCTdCdCdGTdCdAdCd GdCdC-3T 2 43 268 dGdGdCdGTdGdCdAdGTdGmC
ARC1239 mCTTdCdGdGmCdCdGTdGdCd GdGTdGdCdCTdCdCdGTdCdAd CdGdCdC-3T 5 37 269 dGdGdCdGTdGdCdAdGTmGmC
ARC 1240 mCTTdCmGmGmCdCdGTdGdCd GdGTdGdCdCTdCdCdGTdCdAd CdGdCdC-3T 4 40 270 dGdGdCdGTdGdCdAdGTdGdCd ARC 1241 CTTdCdGdGdCdCdGTdGdCmG
mGTdGdCdCTdCdCmGTdCdAdC no no dGdCdC-3T binding binding 271 dGdGdCdGTdGdCdAdGTdGdCd ARC1242 CTTdCdGdGdCdCdGTdGmCdGd GTdGdCdCTmCmCdGTdCdAdCd no no GdCdC-3T binding binding 272 dGdGdCdGTdGdCdAdGTdGdCd ARC 1243 CTTdCdGdGdCdCdGTdGmCmG
mGTdGdCdCTmCmCmGTdCdAd no no CdGdCdC-3T binding binding [00308] As can be seen from the binding data in Table 21, the positions that most readily tolerate substitution of a deoxy residue for a 2'-O methyl residue correlate well with the sequence conservation mapped onto the secondary structure of ARC1029 (SEQ ID

shown in Figure 15 thus providing further, independent support for the proposed structure of the aptamer. The positions of ARC1172 (SEQ ID NO 222) that do not tolerate 2'-O-Me modifications as well as the positions that do are shown in Figure 15B.

[00309] Based upon the structure activity relationship (SAR) results of the individual and composite deoxy to methoxy aptamers described immediately above in the phase 1 modification process, a second series of aptamers was designed, synthesized, purified and tested for binding to vWF. For these and all subsequent aptamers, molecules that retained an affinity (KD) of - 10 nM or better as well as an extent of binding at 100 nM
vWF of at least 35% were the goal. ARC1338 (SEQ ID NO 273)-ARC1348 (SEQ ID NO 283), as shown in Figure 17 and Table 21, were synthesized during phase 2 of the modification process.
ARC 1338 (SEQ ID NO 273) to 1342 were synthesized with block modifications based on the tolerated individual substitutions from phase 1 modification. ARC1343 (SEQ ID
NO 278)-ARC1345 were synthesized each with a different phosphorothioate phosphate backbone modification (see Figure 17 and Table 22 below) Lastly, ARC1346 (SEQ ID NO
281)-ARC1348 (SEQ ID NO 283) were synthesized to test removing a single base pair from stem 1, stem 2 and from both stems of ARC1342 as shown in Figure 17 and Table 22 below.
Table 22: Phase 2 Modification Binding Results Sequence (5' -> 3'), (NH2 = 5'-hexylamine linker SEQ ID phosphoramidite), (3T = inv dT), NO : ARC # (T=dT), (s=phosphorothioate), (mN = 2'-O Methyl containing residue), (PEG = polyethylene % binding @
glycol), (dN=deoxy residue) KD (nM) lOOnM vWF
273 mGmGmCmGmUdGdCdAdGTdGd ARC1338 CdCTTdCdGdGdCdCdGTdGdCdG
dGTdGdCdCTdCdCdGTdCmAmC
mGmCmC-3T 7.4 21 274 dGdGdCdGTdGdCdAinGmUdGdC
ARC1339 dCTTdCdGdGdCdCmGTmGdCdGd GTdGdCdCTdCdCmGmUmCdAdC
dGdCdC-3T 2.4 39 275 dGdGdCdGTdGdCdAdGTdGdCdC
ARC1340 TTdCdGdGdCdCdGTmGdCdGdGT
mGmCdCmUdCdCmGmUmCdAdC
dGdCdC-3T 7.4 43 276 mGmGmCmGmUdGdCdAinGmUm ARC 1341 GmCmCmUmUmCmGmGmCdCd GTdGdCdGdGTdGdCdCTdCdCdG
TdCmAmCmGmCmC-3T 22.5 26 277 mGmGmCmGmUdGdCdAmGmUm ARC 1342 GmCmCmUmUmCmGmGmCdCm GTmGdCdGdGTmGmCdCmUdCd CmGmUmCmAmCmGmCmC-3T 15.6 33 278 mGmGmCmGmUdG-s-dCdAiiiGmUmGmCmCmUmUmC
ARC1343 mGmGmC-s-dCmGTmGdCdG-s-dGTmGmCdCmUdC-s-dCmGmUmCmAmCmGmCmC-3T 23.9 21 279 mGmGmCmGmUdG-s-dC-s-dAmGmUmGmCmCmUmUmCmG
ARC 1344 mGmC-s-dCmGTmGdC-s-dG-s-dGTmGmCdCmUdC-s-dCmGmUmCmAmCmGmCmC-3T 4.8 17 280 mGmGmCmGmU-s-dG-s-dC-s-dAmGmUmGmCmCmUmUmCmG
ARC1345 mGmC-s-dCmG-s-TmG-s-dC-s-dG-s-dG-s-TmGmC-s-dCmU-s-dC-s-dCmGmUmCmAmCmGmCmC-3T 12.1 29 281 mGmCmGmUdGdCdAmGmUmGm ARC 1346 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmUdCdCm GmUmCmAmCmGmC-3T 11 51 282 mGmGmCmGmUdGdCdAmGmUm ARC1347 GmCmUmUmCmGmCdCmGTmGd CdGdGTmGmCdCmUdCdCmGmU no mCmAmCmGmCmC-3T binding no binding 283 mGmCmGmUdGdCdAtnGmUmGm ARC 1348 CmUmUmCmGmCdCmGTmGdCd GdGTmGmCdCmUdCdCmGmUm no CmAmCmGmC-3T binding no binding [00310] As seen in Table 22, the results from phase 2 of aptamer modification revealed ARC1346 (SEQ ID NO 281) to be the most potent of the highly substituted ARC1029 (SEQ
ID NO 214 derivative aptamers generated thus far. Interestingly as shown by the results with ARC1347 (SEQ ID NO 282) and ARC1348 (SEQ ID NO 283), removal of a base pair from stem 2 is not tolerated in this highly modified context.

[00311] ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), shown in Table 23 and Figure 17, were synthesized during phase 3 of the aptamer modification process. As the dG to mG substitution at position 6 was poorly tolerated in test variants in phase 1 aptamer modification and guanosine at position 6 pairs with the cytidine at position 36, ARC 1346 (SEQ ID NO 281) was synthesized with a mC to dC modification at position 36 resulting in ARC1361 (SEQ ID NO 284) as shown in Table 23 below. ARC1361 (SEQ ID NO 284) served as the base sequence for introduction of single phosphorothioate phosphate backbone modifications that resulted in A.RC1362 to ARC1381 (SEQ ID NO 304) also shown in Table 23 below.

Table 23: Phase 3 Modification Binding Results Sequence (5' -> 3'), (NH2 = 5'-hexylamine linker SEQ ID phosphoramidite), (3T = inv dT), NO : ARC # (T=dT), (s=phosphorothioate), %
(mN = 2'-O Methyl containing binding residue), (PEG = polyethylene @ 100nM
glycol), (dN=deoxy residue) KD (nM) vWF
222 dGdGdCdGTdGdCdAdGTdGdCdC
A.RC1172 TTdCdGdGdCdCdGTdGdCdGdGT
dGdCdCTdCdCdGTdCdAdCdGdCd 284 mGmCmGmUdGdCdAinGmUmGm ARC1361 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmUdCdCm GmUdCmAmCmGmC-3T 7.9 38.5 285 mGmCmGmU-s-dGdCdAmGmUmGmCmCmUmUm ARC1362 CmGmGmCdCmGTmGdCdGdGT
mGmCdCmUdCdCmGmUdCmAm CmGmC-3T 9.9 34.3 286 mGmCmGmUdG-s-dCdAmGmUmGmCmCmUmUmC
ARC1363 mGmGmCdCmGTmGdCdGdGTm GmCdCmUdCdCmGmUdCmAmC
mGmC-3T 12.7 32.7 287 mGmCmGmUdGdC-s-dAmGmUmGmCmCmUmUmCmG
ARC1364 mGmCdCmGTmGdCdGdGTmGm CdCmUdCdCmGmUdCmAmCmG
mC-3T 8.2 36.9 288 mGmCmGmUdGdCdA-s-mGmUmGmCmCmUmUmCmGmG
ARC1365 mCdCmGTmGdCdGdGTmGmCdC
mUdCdCmGmUdCmAmCmGmC-3T 10.8 35.4 289 mGmCmGmUdGdCdAmGmUmGm ARC1366 CmCmUmUmCmGmGmC-s-dCmGTmGdCdGdGTmGmCdCmU
dCdCmGmUdCmAmCmGmC-3T 15.5 28.9 290 mGmCmGmUdGdCdAmGmUmGm ARC1367 CmCmUmUmCmGmGmCdC-s-mGTmGdCdGdGTmGmCdCmUdC
dCmGmUdCmAmCmGmC-3T 13.9 30.4 291 mGmCmGmUdGdCdAmGmUmGm ARC1368 CmCmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAmCmGmC-3T 1.8 38.2 292 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT-ARC1369 s-mGdCdGdGTmGmCdCmUdCdCm GmUdCmAmCmGmC-3T 16.3 26.2 293 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC 1370 mG-s-dCdGdGTmGmCdCmUdCdCmGm UdCmAmCmGmC-3T 10.1 22.5 294 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC1371 . mGdC-s-dGdGTmGmCdCmUdCdCmGmUd CmAmCmGmC-3T 8.4 32.1 295 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC1372 mGdCdG-s-dGTmGmCdCmUdCdCmGmUdCm AmCmGmC-3T 23.5 35.2 296 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC 1373 mGdCdGdG-s-TmGmCdCmUdCdCmGmUdCmA
mCmGmC-3T 7.1 33.0 297 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC 1374 mGdCdGdGT-s-mGmCdCmUdCdCmGmUdCmAm CmGmC-3T 9.5 27.2 298 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC 1375 mGdCdGdGTmGmC-s-dCmUdCdCmGmUdCrnAmCmGm C-3T 8.8 25.5 299 mGmCmGmUdGdCdAmGmUmGm CmCmUmUmCmGmGmCdCmGT
ARC 1376 mGdCdGdGTmGmCdC-s-mUdCdCmGmUdCmAmCmGmC-3T 4.4 31.3 300 mGmCmGmUdGdCdAmGmUmGm ARC1377 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmU-s-dCdCmGmUdCmAmCmGmC-3T 7.4 30.9 301 mGmCmGmUdGdCdAmGmUmGm ARC 1378 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmUdC-s-dCmGmUdCmAmCmGmC-3T 9.1 31.1 302 mGmCmGmUdGdCdAmGmUmGm ARC 1379 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmUdCdC-s-mGmUdCmAmCmGmC-3T 10.4 31.3 303 mGmCmGmUdGdCdAmGmUmGm ARC1380 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmUdCdCm GmU-s-dCmAmCmGmC-3T 12.0 32.5 304 mGmCmGmUdGdCdAmGmUmGm ARC1381 CmCmUmUmCmGmGmCdCmGT
mGdCdGdGTmGmCdCmUdCdCm GmUdC-s-mAmCmGmC-3T 8.7 35.8 [00312] As shown in Table 23 above, while the majority of the modifications tested in phase 3 had little or no beneficial effect, ARC1368 (SEQ ID NO 291), which contains a single phosphorothioate modification between mG-20 and dT-21 binds to human vWF with an affinity identical (within experimental error) to that of the parent compound, ARC 1172 (SEQ ID NO 222).

[00313] During phase 4 and phase 5 aptamer modification, ARC 1524 (SEQ ID NO
305) to ARC1535 (SEQ ID NO 316), ARC 1546 (SEQ ID NO 317) and ARC1759 (SEQ ID NO 318), shown in Figure 18, were synthesized. A circular permutation of the sequence that closed stem 1 and opened stem 2 as illustrated in Figure 19 was synthesized.

[00314] As shown in Table 24 below, many of these aptamers bound to vWF, however, none were as potent as ARC1368 (SEQ ID NO 291). Interestingly, though consistent with the SAR generated in Phase 1 of aptamer modification, ARC 1525, containing only a single change from dT to mT at position 27, showed no binding at all to vWF. ARC1525 was used as a negative control in many of the biological assays in which ARC1368 (SEQ
ID NO 291) was subsequently tested. Again, consistent with the SAR data from Phase 3 of aptamer modification, ARC1759 (SEQ ID NO 318) which is identical to ARC1172 (SEQ ID NO
222) except that it has single phosphorothioate substitution between the G at position 21 and the T
at position 22 showed measurable improvement in affinity relative to ARC1172 (SEQ ID NO
222).

Table 24: Phase 4 and 5 Aptamer Modification Binding Results Sequence (5' -> 3'), SEQ ID (NIi2 = 5'-hexylamine linker NO: phosphoramidite), (3T = inv dT), ARC # (T=dT), (s=phosphorothioate), (mN = 2'-O Methyl containing % binding residue), (PEG = polyethylene KD @ 100nM
glycol), (dN=deoxy residue) (nM) vWF
222 dGdGdCdGTdGdCdAdGTdGdCdC
ARC1172 TTdCdGdGdCdCdGTdGdCdGdGT
dGdCdCTdCdCdGTdCdAdCdGdCd 291 mGmCmGmUdGdCdAmGmUmGm ARC1368 CmCmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAmCmGmC-3T 1.8 38.2 305 mGmCmGmUdGdCdAmGmUmGm ARC 1524 CmCmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmGmC-3T 5.7 26.5 306 mGmCmGmUdGdCdAmGmUmGm ARC 1525 CmCmUmUmCmGmGmCdCmGm TmGdCdGdGTmGmCdCmUdCdC No mGmUmCmAmCmGmC-3T binding No binding 307 mGmCmGmUdGdCdAmGmUmGm ARC 1526 CmCmUmUmUmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmGmC-3T 4.7 29.0 308 mGmCmGmUdGdCdAmGmUmGm ARC1527 CmCPEGmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAmCmGmC-3T 3.4 14.1 309 mGmCmGmUdGdCdAmGmUmGm ARC1528 CmCPEGmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmGmC-3T 4.2 10.2 310 mCmGmUdGdCdAmGmUmGmCm ARC1529 CmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmG-3T 12.3 22.6 311 mCmGmUdGdCdAmGmUmGmCm ARC1530 CmUmUmUmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmG-3T 15.0 19.2 312 mCmGmUdGdCdAmGmUmGmCm ARC 1531 CPEGmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAmCmG-3T 1.5 20.0 313 mCmGmUdGdCdAmGmUmGmCm ARC1532 CPEGmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmG-3T 2.6 19.3 mCmGmGmCdCmG-s-ARC1533 TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCPEGmGmUdGdC
dAmGmUmGmCmCmG-3T

4.0 31.7 mCmGmGmCdCmG-s-ARC 1534 TmGdCdGdGTmGmCdCmUdCdC
mGmUmCmAmCmUmUmUmGm UdGdCdAmGmUmGmCmCmG-3T

62.8 25.6 mCmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
ARC1535 mGmUmCmAinCmUmUmUmGm UdGdCdAmGmUmGmCmCmGmG

27.1 48.3 317 mCmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
ARC1546 mGmUdCmAmCmGmUmUmCmC
mGmUdGdCdAinGmUmGmCmCm GmG-3T 24 26 318 dGdGdCdGTdGdCdAdGTdGdCdC
ARC 1759 TTdCdGdGdCdCdG-s-TdGdCdGdGTdGdCdCTdCdCdGT
dCdAdCdGdCdC-3T 0.7 46 EXAMPLE 2F: Conjugation of PEG moieties to modified aptamers [00315] Polyethylene glycol moieties were conjugated to the 5' terminus of ARC

(SEQ ID NO 291) and ARC1172 (SEQ ID NO 222) via amine reactive chemistries.
The oligonucleotides ARC1635 NH2-mGmCmGmUdGdCdAmGmUmGmCmCmUmUmCmGmGmCdCmG-s-dTmGdCdGdGdTmGmCdCmUdCdCmGmUdCinAinCmGmC-3T (ARC1368 (SEQ ID NO
291) with a 5' hexylamine modification) and ARC1884 (SEQ ID NO 322) NH2-dGdGdCdGdTdGdCdAdGdTdGdCdCTdTdCdGdGdCdCdGTdGdCdGdGTdGdCdCTdCdCd GTdCdAdCdGdCdC-3T (ARC 1172 (SEQ ID NO 222) with a 5' hexylamine modification) were chemically synthesized.

[00316] The amine-modified aptamers were conjugated to different PEG moieties, as indicated in Table 25 below, post-synthetically.

[00317] Table 25: Hexylamine modified or PEG conjugated aptamers Sequence (5' -> 3'), (NH2 = 5'-hexylamine linker SEQ ID phosphoramidite), (3T = inv dT), NO: ARC # (T=dT), (s=phosphorothioate), (mN = 2'-O Methyl containing residue), (PEG = polyethylene glycol), (dN= deoxy residue) mGmCmGmUdGdCdAmGmUmGm ARC1635 CmCmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAmCmGmC-3T

mGnCmGmUdGdC dAmGmUmGm ARC 1779 CmCmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAtnCmGmC-3T

mGmCmGmUdGdCdAinGmUmGm ARC1780 CmCmUmUmCmGmGmCdCmG-s-TmGdCdGdGTmGmCdCmUdCdC
mGmUdCmAmCmGmC-3T

dGdGdCdGTdGdCdAdGTdGdCdC
ARC1884 TTdCdGdGdCdCdGTdGdCdGdGT
dGdCdCTdCdCdGTdCdAdCdGdCd dGdGdCdGTdGdCdAdGTdGdCdC
ARC1885 TTdCdGdGdCdCdGTdGdCdGdGT
dGdCdCTdCdCdGTdCdAdCdGdCd EXAMPLE 3: FUNCTIONAL CELL ASSAYS

Biological vWF Dependent Assays [00318] The effectiveness of various aptamers in blocking vWF function in several biological assays is described in this Example.

[00319] In one assay botrocetin is used. Botrocetin, a protein isolated from snake venom, is known to induce von Willebrand Factor binding to the gplb receptor on live and fixed platelets. This reaction causes agglutination of suspensions of fixed platelets via vWF
multimerization. In preparations of platelet rich plasma (hereinafter "PRP"), vWF/botrocetin induction of agglutination is followed by a second phase of platelet aggregation caused by metabolic activation of the platelets. These two reactions: vWF binding to fixed platelets and vWF mediated platelet aggregation, can be used to measure the activity of aptamers of the invention.

[00320] The amount of vWF bound to fixed platelets can be measured with an antibody to vWF. The fluorescence signal from bound antibody incubated with a fluorescein conjugated secondary antibody is then detected and quantified by flow cytometry. The ability of an aptamer of the invention to block vWF binding to platelets is correlated with a reduction in fluorescence signal.

[00321] Botrocetin induces the binding of the Al domain of vWF to platelets, as well as the full length protein. It was determined by the inventors that 6-Histidine-tagged rabbit Al domain vWF purified protein could be induced to bind to human lyophilized platelets with botrocetin. Rabbit Al binding to platelets is measured with an anti-poly-His antibody followed by incubation with a phycoerythrin conjugated secondary antibody. The degree of binding can be quantified by flow cytometric analysis. The ability of aptamers to block the binding of rabbit Al to human fixed platelets was correlated with decreased fluorescence signal.

[00322] In platelet rich plasma isolated from fresh human blood, botrocetin induces platelet aggregation via vWF. Platelet aggregate formation can be measured optically as an increase in % light transmittance on a Chronolog Model 490-4D Aggregometer because aggregation of platelets clarifies the plasma. Aptamers of the invention were analyzed for their ability to inhibit botrocetin induced platelet aggregation ("BIPA") in human blood. An aptamer of the invention was considered to be active if it could prevent aggregate formation for six minutes post botrocetin addition.

[00323] Another assay of this Example, using the PFA-100 instrument, is an agonist independent but vWF dependent assay that uses the PFA-100 instrument (Harrison et al., Clin. Lab. Haem., v24, p225-32 (2002)). The PFA-100 simulates the formation of a hemostatic plug under conditions of high shear force in vivo by recording the time required for a platelets to aggregate and block the flow of citrated whole blood through a microscopic aperture in a membrane coated with collagen and either epinephrine or ADP.
This activity is von Willebrand factor dependent as high MW vWF multimers bind to immobilized collagen on the membrane and then bind to and activate platelets because of the shear force induced by drawing the blood through the microscopic aperture. Thus this assay is complimentary to the BIPA and FACS assays in that it is vWF dependent, however it has some advantages in that it does not require the addition of the vWF agonist botrocetin and uses whole blood instead of platelet rich plasma.

[00324] Another assay of this Example used ADP to induce platelet aggregation.
Aggregation of platelet rich plasma (PRP) can be in induced in multiple ways.
The snake venom protein botrocetin acts on vWF as described above, stabilizing its interaction with the platelet receptor gplb thereby inducing platelet aggregation. Binding of vWF
to gplb is an early step in platelet aggregation, thus there is an expectation that inhibitors that block downstream components of the aggregation process (i.e., the IIbIIIa antagonists IntegrelinTM
and ReoProTM) would also prevent botrocetin induced platelet aggregation.
However, in the case of agonists that act directly on platelets and induce aggregation (ADP
for example), one would expect that antagonists upstream of the agonist would be ineffective (an anti-vWF
aptamer for example), while antagonists that act directly on platelets (IIbIIIa antagonists) would remain potent. The specificity of a vWF antagonist relative to a IIbIIIa antagonist will increase the safety of the anti-vWF antagonist by decreasing the bleeding time associated with treatment. For patients with atherosclerotic plaques in stenosed arteries, platelet aggregation occurs as platelets bind to collagen immobilized vWF on the surface of the plaque. Thus both inhibiting the vWF/gplb interaction as well as blocking the IIbIIIa receptor binding to fibrin will prevent platelet aggregation. The biological specificity conferred by targeting vWF
insures that unlike anti-IIbIIIa treatment, platelets themselves are not targeted directly insuring they can still be activated by other means, thus reducing potential bleeding complications associated with anti-platelet therapy.

[00325] The following materials were used in Examples 3A-3D described below:
human von Willebrand Factor (vWF) (SEQ ID NO 7), and bovine serum albumin were purchased from Calbiochem (Cat# 681300 and #126593, respectively) (La Jolla, CA); domain Al rabbit vWF (SEQ ID NO 6) was expressed and purified using standard methods and conditions.
Lyophilized human platelets (P/N 299-2), cuvettes (P/N 312), stir bars (P/N
311), platelet aggregometer (mode1490-4D), and AGGRO/LINK Software were purchased from Chronolog (Haverton, PA). Botrocetin (12201-100U-B) was manufactured by Pentapharm (Basel, Switzerland). Fresh blood was obtained from apparently healthy, nonsteroidal anti-inflammatory drug ("NSAID") free donors and was drawn into 5 mL 0.105 M Sodium Citrate Vacutainer tubes (Cat# 369714) (Becton Dickinson- Franklin Lakes, NJ).
Physiological saline was manufactured by Aldon (Cat # 9420306) (Avon, NY) and phosphate buffered saline (Cat # 21-040-CV) was purchased from Cellgro (Hemdon, VA). Flow cytometric experiments were performed on a BD Biosciences FACSCAN machine and analyzed with CellQuest Software (San Jose, CA). Anti-von Willebrand Factor mouse monoclonal antibody (Cat# GTI-V1A) was purchased from GTI (Waukesha, WI). Penta-HIS-biotin conjugate monoclonal antibody (Cat # 34440) was purchased from Qiagen (Germany). Anti-mouse IgG2a - FITC conjugate (Cat # 553390) was purchased from BD Biosciences (San Diego, CA). Anti-mouse IgG-PE conjugate antibody (Cat # 715-116-150) was purchased from Jackson ImmunoResearch Laboratories (West Grove, PA).

EXAMPLE 3A: Full Length Human von Willebrand Factor Platelet Binding Assay [00326] Aptamer potency to block human vWF binding to lyophilized platelets was assessed by flow cytometric analysis. Titrations of aptamers (0 nM, 0.1 nM to 1000 nM) were pre-incubated briefly with 5 nM of full length human vWF in FACS buffer (PBS plus 0.5% bovine serum albumin) at room temperature in a volume of 50 uL. Another 50 uL
containing 5 uL of lyophilized platelets plus 1 uL of 0.1 U/uL of botrocetin in FACS buffer was added to aptamer/vWF. This reaction was allowed to proceed for 15 minutes at 37 degrees C after which 200 uL of FACS buffer was added. Platelets were collected by a 6 minute spin at 1470 RCF and the supernatant was discarded. The pellets were resuspended in 100 uL of FACS buffer containing a 1:100 dilution of anti-vWF antibody and were incubated at room temperature for 30 minutes. After dilution with 200 uL of FACS buffer, the platelets were spun at 1470 RCF for 6 minutes and the supernatant was discarded. The pellets were resuspended in a 1:100 solution of anti-IgG2a-FITC antibody and were incubated in the dark for 30 minutes at room temperature. The entire 100 uL was diluted into 200 uL
of FACS
buffer and analyzed immediately by flow cytometric analysis in the FACSCAN.
Artifactual data from contaminating debris was eliminated from the analysis by drawing a gate around the population of single and aggregated platelets. Mean fluorescent intensity ("MFI") readings were quantified for each sample analyzed by flow cytometry.
Background MFI was subtracted from all data points. Percent inhibition was reported by calculating the percent value of binding of full length human vWF to platelets in the presence of aptamer at a given concentration relative to binding in the absence of any aptamer (see Figure 7). IC50 values were determined by fitting the percent inhibition of vWF binding to platelets as a function of aptamer concentration to the equation:

% inhibition = % inhibitionmaX/(1+IC50/aptamer conc.) [00327] Results of botrocetin induced vWF binding characterization are tabulated in Table 26 below.

EXAMPLE 3B: Rabbit von Willebrand Factor Domain Al Platelet Binding Assay [00328] The ability of aptamers of the invention to block rabbit vWF domain Al binding to lyophilized platelets was also assessed by flow cytometric analysis.
Titrations of aptamers (zero, 0.1 nM to 1000 nM) were preincubated briefly with 4 nM of rabbit Al vWF
in FACS
buffer (PBS plus 0.5% bovine serum albumin) at room temperature in a volume of 50 uL.
Another 50 uL containing 5uL of lyophilized platelets plus luL of 0.1 U/uL of botrocetin in FACS buffer was added to aptamer/vWF. This reaction was allowed to proceed for minutes at 37 degrees C after which 200 uL of FACS buffer was added. Platelets were collected by a 6 minute spin at 1470 RCF and the supernatant was discarded.
The pellets were resuspended in 100uL of FACS buffer containing a 1:200 dilution of anti-Penta-HIS-biotin conjugate antibody and were incubated at room temperature for 30 minutes. After the dilution with 200uL of FACS buffer, the platelets were spun at 1470 RCF for 6 minutes, and the supernatant was discarded. The pellets were resuspended in a 1:100 solution of anti-IgG-PE antibody and were incubated in the dark for 30 minutes at room temperature.
The entire 100 uL was diluted into 200 uL of FACS buffer and analyzed immediately by flow cytometric analysis in the FACSCAN. Contaminating debris was eliminated from the analysis by drawing a gate around the population of single and aggregated platelets and collecting data from 10000 events. Median fluorescent intensity ("MedFI") readings (which are generally equivalent to the MFI readings, described in Example 3a above, for comparative purposes) were quantified for each sample analyzed by flow cytometry. Background MedFI
was subtracted from all data points. Percent inhibition was reported by calculating the percent value of binding of full length human VWF to platelets in the presence of aptamer at a given concentration relative to binding in the absence of any aptamer (see Figure 7). IC50 values were determined by fitting the percent inhibition of vWF binding to platelets as a function of aptamer concentration to the equation:

% inhibition = % inhibition,,,a,t/(l+IC50/aptamer conc.) Results of botrocetin induced rabbit Al vWF binding characterization are tabulated below in Table 26.

Table 26: Results of FACS and BIPA Assays ('ND' = not done) <_200 nM
aptamer gives InI-ibition of >90%
Inhibition of full length rabbit VWF Al blocking in hVWF binding in FACS domain binding BIPA at 6 Aptamer ID assay in FACS assay minutes Average IC50 Average IC50 range IC50 range IC50 rRdY aptamer aptamers (AMX203.D6) SEQ ID NO 31 no activity ND ND
(AMX205.H8) SEQ ID NO 32 no activity ND ND
(AMX205.H11) SEQ ID NO 33 no activity ND ND
(AMX205.D11) SEQ ID NO 35 no activity ND ND
(AMX206.F9) SEQ ID NO 36 no activity ND ND
(AMX206.H9) SEQ ID NO 37 no activity ND ND
(AMX206.A10) SEQ ID NO 38 no activity ND ND
(AMX205.F9) SEQ ID NO 39 no activity ND ND
(AMX206.E7) SEQ ID NO 40 no activity ND ND

(AMX206.D7) SEQ ID NO 41 no activity ND ND
(AMX203.A1) SEQ ID NO 43 no activity ND ND
(AMX203.G9) 152pM to SEQ ID NO 44 = ARC 842 1.2nM to 8.5nM 4.7nM 1.6nM 592pM yes (AMX205.H9) SEQ ID NO
45 no activity ND ND
(AMX206.D8) SEQ ID NO
46 no activity no activity ND
(AMX205.F7) SEQ ID NO 1.5nM to 49 = ARC 841 321pM to 1.6nM 818pM 7.1nM 4.7nM yes (AMX205.H10) SEQ ID NO
50 no activity no activity ND
rRdY aptamer minimers SEQ ID NO 177 1.6nM to 5.4nM 3nM ND ND
8.2nM to SEQ ID NO 180 731pM to 3.8nM 2nM 10.5nM 9.3nM yes SEQ ID NO 183 6.6nM to 99nM 26.5nM ND ND
SEQ ID NO 186 971pM to 2.2nM 1.3nM ND ND
SEQ ID NO 189 564pM to 1.6nM 1.1nM ND ND
2nM to SEQ ID NO 192 1.1nM to 5.3nM 2.6nM 2.3nM 2.2nM yes SEQ ID NO 194 no activity ND ND
SEQ ID NO 196 no activity ND ND
8.5nM to SEQ ID NO 198 14nM to 25nM 20.6nM 16.8nM 12.6nM ND
SEQ ID NO 201 1.3nM to 370nM 150nM ND no activity rRfY aptamer aptamers (AMX201.B1) SEQ ID NO 11 no activity ND yes (AMX198.G1) SEQ ID NO 12 no activity ND ND
(AMX201.H3) SEQ ID NO 13 no activity ND yes (AMX201.G1) SEQ ID NO 15 no activity ND ND
(AMX201.C8) 141pM to SEQ ID NO 23 = ARC 840 24pM to 1.8nM 528pM 704pM 682pM yes rRfY aptamer minimers SEQ ID NO 165 562pM to 14.4nM 6.4nM ND ND
SEQ ID NO 169 103pM to 17nM 6.9nM ND ND
SEQ ID NO 172 1.8nM to 7.4nM 4.3nM ND ND
SEQ ID NO 174 1.3nM to 12.7nM 6.6 nM 4.9nM to 6.8nM yes 5nM
DNA SELEX 1, minimer SEQ ID NO 205 no activity no activity no activity no activity no activity DNA SELEX 2 aptamer aptamers AMX237.E10 SEQ ID NO 138 no activity ND ND
AMX237.G7 SEQ ID NO 134 2.3nM to 14nM 6.5nM 12.3nM ND
AMX.236.G1 SEQ ID NO 164 8.6nM to 72nM 46nM ND
AMX237.A11 SEQ ID NO 98 466pM to 5.6nM 2.2nM 4.7nM ND
AMX237.A2 SEQ ID NO 99 815pM to 7.3nM 3.5nM 7nM ND
AMX238.D12 SEQ ID NO 100 684pM to 3.4nM 2nM 7.2nM ND
AMX238.G5 SEQ ID NO 106 273pM to 2.6nM 1.lnM 5.5nM ND
AMX238.E9 SEQ ID NO 115 772pM to 6.5nM 3.4nM ND ND
AMX238.H5 SEQ ID NO 118 514pM to 860pM 658pM ND ND
AMX237.G6 SEQ ID NO 114 1.5nM t o 2.5nM 1.9nM ND yes AMX237.B11 SEQ ID NO 109 151pM to 4.8nM 2.5nM 5.7nM ND
AMX236.A12 SEQ ID NO 127 1.2nM to 17nM 10.7nM 14.5nM ND
DNA SELEX 2 aptamer minimers SEQ ID NO 208 1.6nM to 10.2nM 4.3nM ND ND
SEQ ID NO 209 no activity ND ND
SEQ ID NO 210 no activity ND ND
SEQ ID NO 211 no activity ND ND
ARC1027 462pM to SEQ ID NO 212 208pM to 4.2nM 1.5nM 4.2nM 2nM yes ARC1028 526pM to SEQ ID NO 213 473pM to 2.7nM 1.2nM 2.7nM 1.5nM yes ARC1029 490pM to SEQ ID NO 214 333pM to I.1nM 609pM 979pM 754pM yes SEQ ID NO 215 no activity ND ND
ARC1031 no activity ND ND

EXAMPLE 3C: Inhibition of Botrocetin induced platelet aggregation (BIPA assay) [00329] In order to determine the activity of aptamers on live human platelets, BIPA assays were done using freshly prepared platelet rich plasma. Blood was obtained from healthy human donors who had not taken NSAIDS for at least five days. 21 3/4 gauge butterfly needles (Cat# 367287) from Becton Dickinson were used to draw blood into 0.105 M sodium citrate vacutainer tubes. Collected blood was pooled into 15 mL conical tubes and was spun at 200 g for 20 minutes. The turbid, yellow layer of platelet rich plasma ("PRP") was withdrawn from the tubes, pooled, and set aside at room temperature. The remaining blood was spun at 2500 g for ten minutes. The clarified layer of plasma, known as platelet poor plasma ("PPP"), was withdrawn and set aside at room temperature. PRP was aliquoted into cuvettes containing stir bars at a volume of 470 uL. A sample of 500 uL of PPP
was aliquoted into a cuvette and placed in the PPP reference cell of the platelet aggregometer.
Samples of PRP were prewarmed at 37 degrees C in the platelet aggregometer for 3-5 minutes before being used in BIPA assays. First, the concentration of botrocetin needed to induce platelet aggregation for each individual donor was determined by titration.
This concentration of botrocetin was used for the remainder of the experiment. Next, aptamer was assayed by adding titrations of aptamer (zero, 1 nM to 1000 nM) to prewarmed PRP for one minute, followed by addition of botrocetin. With platelet aggregation, an increase in amplitude of light transmission is seen (Figure 8). The concentration at which platelet aggregation is blocked at 90% or greater after 6 minutes is reported in the final column of Table 26. Using the Aggro/LINK Software, area under the curve ("AUC") can be generated from the aggregometer trace and used to calculate percent inhibition of aptamer at any given concentration on botrocetin induced platelet aggregation as seen in Figure 9 for Aptamer ARC1029 (SEQ ID NO 214).

EXAMPLE 3D: Biological activity of selected modified aptamers in a series of biological assUs:

[00330] ARC1172 (SEQ IDNO 222), ARC1346 (SEQ IDNO 281), ARC1368 (SEQ ID
NO 291), ARC1525 (negative control), ARC1779 (SEQ ID NO 320), ARC1780 (SEQ ID

NO 321), and ARC1885 (SEQ ID NO 323) identified in the medchem modification process described in Example 2 above, were tested in a series of biological assays.
These assays included the FACS (as described in Example 3A and 3B) and BIPA assays ( as described in Example 3C), as well as the platelet PFA-100 assay described below.

Materials:
[00331] The following materials were used in the platelet function analyzer (PFA) assay:
Fresh whole blood was collected from healthy non-steroidal anti-inflammatory drug (NSAID) free donors into 5ml 0.105M sodium citrate tubes (Cat#369714, Becton Dickenson) using 213/a gauge butterfly needles (Cat#367287, Becton Dickenson). Fresh whole blood was collected from healthy non-steroidal anti-inflammatory drug (NSAID) free cynomolgus macaques. Aptamers were diluted with physiological saline from Aldon (Cat#9420306) in no-additive vacutainer tubes (Cat#366434, Becton Dickenson). Samples were loaded onto collagen/epinephrine test cartridges (Cat#B4170-20A, Dade Behring) which were used in the PFA-100 machine (Dade Behring). Trigger solution (Cat#B4170-50, Dade Behring) was used in the self-test and to pre-wet the test cartridges. 0-ring cleaning pads (Cat#B4170-73, Dade Behring) were used in the self-test and in the 0-ring cleaning process.

PFA assay:

[00332] A self-test, which included an 0-ring cleaning process, was always run on the PFA-100 machine before running any samples to ensure proper function of the machine.
[00333] Fresh whole blood was collected from healthy donors or cynomolgus macaques, as indicated in Table 27 below, who/that had not taken NSAIDs for at least three days. Blood from human donors was collected into 5ml 0.105M sodium citrate tubes using a 213/4 gauge butterfly needle, and the tubes were gently inverted three times to ensure mixture of blood with sodium citrate. During the entire experiment, the tubes of whole blood were gently inverted every five minutes to prevent settling.

[00334] In order to assay the titration of aptamer in whole blood, the aptamer was added to no-additive vacutainer tubes and diluted to the desired concentrations (ex:
OnM, 1nM to 1000nM) using physiological saline such that the final volume was 60 1. When the PFA-100 was ready to run the next set of samples, 1940 1 of whole blood was added to the tube containing a concentration of aptamer. This tube was gently inverted three times to thoroughly mix the aptamer and blood. Samples were always run in duplicate on the PFA-100 machine. 800 1 of this blood mixture was loaded into the collagen/epinephrine test cartridges. The test cartridges were loaded onto the PFA-100 machine. The time of occlusion of the aperture was measured by the PFA-100, with a maximal time of 300seconds. We estimate the IC95 in this assay to be the minimum concentration of aptamer that extends the closing time to 300 seconds.

[00335] Figure 20 depicts clotting time in human whole blood as a function of aptamer concentration in the PFA-100 assay for ARC1368 (SEQ ID NO 291) and the negative control ARC1525. Additional results of the FACS, BIPA and PFA-100 assays are tabulated in Table 27 below.

Table 27: FACS, BIPA and PFA-100 results vs FACS BIPA PFA-100 (nM) with human IC50 vs (nM) with (nM) with citrated full rabbit human citrated C.
length Al platelet human macaque vWF domain rich whole whole ARC # (nM) (nM) plasma blood blood (SEQ ID ND
NO 222) 2 2 -200 -100 ARC1346 50 180 > 1000 ND ND
ARC1368 2 4.0 -200 -100 -100 no no ND
ARC1525 ND ND inhibition inhibition [00336] As expected, there was a strong correlation among the observed affinities of aptamers for vWF in the binding assay described in Example 2 above and their relative potency in the biological assays. The non-binding negative control ARC1525 did not display activity in any assay in which it was tested EXAMPLE 3E: ARC1368, IntegrilinTM and ReoProTM in BIPA, PFA-100 and AIPA
assays [00337] The potency of ARC1368 (SEQ ID NO 291), IntegrillinTM and ReoProTM
were evaluated in human whole blood in PFA-100, in human PRP in BIPA (as described above in Examples 3D and 3C respectively) and ADP Induced Platelet Aggregation (AIPA) assays.
AIPA was performed with human PRP exactly as was done for BIPA described above in Example 3C with the exception that instead of adding botrocetin, 10 micromolar ADP
(Chronolog, Haverton, PA) was added to induce platelet aggregation. The PFA-100 results are shown in Figure 21. The BIPA results are shown in Figure 22. The AIPA results are shown in Figure 23. As can be seen in Figures 21 and 22, ARC1368 (SEQ ID NO 291) shows potency comparable to ReoProTM in PFA-100 and BIPA assays. Consistent with the vWF
dependent mechanism described above, the anti-vWF aptamer shows no ability to block AIPA
while the IIbIIIa antagonists remain potent in that assay as shown in Figure 23.

EXAMPLE 4: PHARMACOKINETIC STUDIES

[00338] In Examples 4 and 5, all mass based concentration data refers only to the molecular weight of the oligonucleotide portion of the aptamer, irrespective of the mass conferred by PEG conjugation.

EXAMPLE 4A: Stability of anti-vWF aptamers in human and rat plasma [00339] ARC1172 (SEQ IDNO 222), ARC1346 (SEQ IDNO 281), ARC1368 (SEQ ID
NO 291) and ARC 1533 were assayed for nuclease stability in both human and rat plasma.
Plasma nuclease degradation was measured on denaturing polyacrylamide gel electrophoresis as described below. Briefly, for plasma stability determination, chemically synthesized aptamers were purified using denaturing polyacrylamide gel electrophoresis, 5'end labeled with y-32P ATP and then gel purified again. Trace 32-P labeled aptamer was incubated in the presence of 100 nM unlabeled aptamer in 95% human or rat plasma in a 200 microliter binding reaction. The reaction for the time zero point was made separately with the same components except that the plasma was replaced with PBS. This insured that the amount or radioactivity loaded on gels was consistent across an experiment. Reactions were incubated at 37 C in a thermocycler for the 1, 3, 10, 30 and 100 hours unless otherwise specified. At each time point, 20 microliters of the reaction was removed, combined with 200 microliters of formamide loading dye and flash frozen in liquid nitrogen and stored at -20 C. After the last time point was taken, frozen samples were thawed and 20 microliters was removed from each time point. SDS was then added to the small samples to a final concentration of 0.1%. The samples were then incubated at 90 C for 10 - 15 minutes and loaded directly onto a 15%
denaturing PAGE gel and run at 12 W for 35 minutes. Radioactivity on the gels was quantified using a Storm 860 phosphoroimager system. The percentage of full length aptamer at each time point was determined by quantifying the full length aptamer band and dividing by the total counts in the lane. The fraction of full length aptamer at each time-point was then normalized to the percentage full length aptamer of the 0 hour time-point. The fraction of full length aptamer as a function of time was fit to the equation:

[00340] ml*e~(-m2*m0) where ml is the maximum % full length aptamer (m1=100); and m2 is the rate of degradation. The half-life of the aptamer (T1i2) is equal to the (ln 2) / m2.

[00341] Sample data for human plasma is shown in Figure 24 and the results for the aptamers tested are summarized in Table 28. Consistent with our expectations, aptamers are more stable in human plasma than in rat plasma and increasing the number of 2'-OMe modifications correlates with increasing plasma stability.

Table 28: Aptamer Plasma Stability half-life Tl/2 T1/2 ARC # Human Rat plasma plasma (hrs) (hrs) (SEQ ID 17 3 NO 222) ARC1346 not 19 done ARC1533 93 not done EXAMPLE 4B: PK/PD of PEGylated derivatives of ARC1368 in Cynomolgus Macaques [00342] ARC1368 (SEQ ID NO 291), 1779 (SEQ ID NO 320) and 1780 (SEQ ID NO
321) (as described in Example 2 above) were injected intravenously into cynomolgus macaques ( n= 3/ group) at a dosage of 3 mg/kg which was expected to yield an instantaneous plasma concentration of 3 uM, approximately 30-fold higher than the putative effective dose. Subsequently, citrated blood samples were collected at regular intervals and processed for plasma.

[00343] To demonstrate that the aptamers were pharmacologically active in vivo, Botracetin-induced platelet aggregation (BIPA) was performed 5 minutes post-dosing, at the presumed plasma CIõa,,. All animals had complete inhibition of BIPA at this point demonstrating that the aptamers were functional in vivo.

[00344] Subsequently, plasma aptamer concentrations were determined using the Oligreen assay (Gray et al., Antisense and Nucleic Acid Drug Development 7 (3):133-140 (1997). The data were subsequently analyzed using the program WinNonlin to yield the pharmacokinetic parameters listed in Tables 29 to 31 below.

[00345] Additionally, the primate plasma aptamer concentration plotted as a function of time is depicted in the graph of Figure 25. The mean concentration-times profiles based on the OliGreenTM assay showed that the pharmacokinetic profiles of ARC1368 (SEQ ID
NO 291), ARC1780 (SEQ ID NO 321) and ARC1779 (SEQ ID NO 320) were mainly monophasic.
The unPEGylated aptamer (ARC1368 (SEQ ID NO 291)) displayed a rapid distribution phase compared to ARC1779 (SEQ ID NO 320) and ARC1780 (SEQ ID NO 321). Unlike ARC1368 (SEQ ID NO 291), the 40 kDa PEG conjugate ARC 1780 (SEQ ID NO 321) displayed prolonged distribution phase compared to ARC 1779 (SEQ ID NO 320).

(20 kDa PEG) displayed a distribution phase with a-half-life of -2 hr.

Table 29 - NonCompartmental Pharmacokinetic Parameter Estimates for ARC 1368 After 3 mg/kg IV Administration in Monkeys Based on Oligreen Assay Data PK Parameter Unit 1101 1102 1103 Mean StdDev Tmax hr 0.08 0.08 0.08 0.08 0.00 Cmax ng/mL 26409 19170 23301 22960 3632 AUCO-last hr*ng/mL 23096 31926 20650 25224 5932 MRTlast hr 4.50 5.46 3.48 4.48 0.99 Table 30 - NonCompartmental Pharmacokinetic Parameter Estimates for ARC 1779 After 3 mg/kg IV Administration in Monkeys Based on Oligreen Assay Data PK Parameter Unit 2101 2103 2104 Mean StdDev Tmax hr 0.25 0.50 0.25 0.33 0.14 Cmax ng/mL 69065 65717 70344 68375 2389 AUClast hr*ng/mL 309245 336590 235503 293779 52288 MRTlast hr 5.27 4.66 2.69 4.21 1.35 Table 31 - NonCompartmental Pharmacokinetic Parameter Estimates for ARC 1780 After 3 mg/kg IV Administration in Monkeys Based on Oligreen Assay Data PK Parameter Unit 3101 3102 3103 Mean StdDev Tmax hr 2.00 2.00 0.25 1.42 1.01 Cmax ng/mL 55965 37320 50690 47992 9611 AUClast hr*ng/mL 740559 613180 899455 751065 143426 AUCaII hr*ng/mL 740559 613180 899455 751065 143426 MRTlast hr 8.69 9.54 14.11 10.78 2.91 [00346] Following the Oligreen assay analysis, plasma aptamer concentrations were determined for the animals dosed with ARC 1779 (SEQ ID NO 320) using a validated HPLC-based assay. The HPLC data were analyzed via noncompartmental and 2-compartment analysis using the program WinNonlin. Reanalysis of the monkey samples with a more sensitive HPLC method generated a concentration-times profile of ARC 1779 (SEQ
ID NO
320) to be biphasic showing both distribution and elimination phase Consistent with the results observed using the OliGreen assay, the HPLC-based results indicated the distribution half-life (ty2a,) was 1.4 h and a elimination half-life was 12.9 (tyZR) for ARC 1779 (SEQ ID NO
320).

EXAMPLE 4C: PK/PD of ARC1779 in Cynomolgus Macaques [00347] -PK/PD correlation of ARC1779 was evaluated in three cynomolgus macaques after a single intravenous (IV) bolus dose at 0.5 mg/kg. ARC1779 levels in the plasma were correlated to PD effects of ARC1779 in inhibition of platelet function or prolongation of cutaneous bleeding time (CBT).

[00348] Following IV administration, blood was collected percutaneously at various time points post-dose for PK and PD analysis. PD effect of ARC1779 on platelet function was determined by PFA-100 assays and effect of ARC1779 on bleeding was measured by CBT
time. In addition, plasma samples were analyzed by HPLC for quantitation of levels. PK parameter estimates were determined by 2-compartment analysis. The results are presented in Figure 26.

[00349] The concentration-time profiles generated for individual monkeys showed predominantly the distribution phase of ARC1779 pharmacokinetics The distribution half-life was determined to be approximately 1.0 hour (tli2a). The elimination half-life (tli2p), was not well-determined from the available data.

[00350] The PD effect of ARC 1779 on platelet aggregation measured by the PFA-assay is shown in Figure 26. When the plasma concentrations of ARC1779 were in excess of 300 nM, platelet function was inhibited as assessed by the PFA- 100 instrument. However, when plasma aptamer concentrations decreased to approximately 77 nM, platelet function returned to normal.

[00351] As also seen in Figure 26, the PD effect of ARC 1779 on bleeding time prolongation was found to be minimal in these studies.

[00352] In summary, ARC 1779 inhibited platelet function in vivo at a plasma concentration of approximately 300 nM. This in vivo concentration was approximately 3-fold higher than the observed concentration of aptamer necessary to inhibit platelet function in vitro. In contrast, even at high plasma concentrations (1000 nM), ARC 1779 showed minimal effect on cutaneous bleeding time following single bolus dosing.

EXAMPLE 5: FUNCTIONAL ANIMAL ASSAYS

[00353] In Examples 4 and 5 described herein, all mass based concentration data refers only to the molecular weight of the oligonucleotide portion of the aptamer, irrespective of the mass conferred by PEG conjugation.

EXAMPLE 5A: Pharmacodynamics of ARC1779 in Cynomolgus Macagues [003541 C. macaques were dosed at 0.5 mg/kg IV bolus with ARC 1779 (SEQ ID NO
320).
PFA- 100 closure time, BIPA and cutaneous bleeding time ("CBT") were all measured as a function of time throughout the studies. BIPA and PFA-100 closure times were measured as described in previously in Example 3. Cutaneous bleeding times were measured using standard protocols described as follows.

[00355] A blood pressure cuff was applied to the biceps region of the forearm to be tested and inflated to maintain a constant pressure of 40 mmHg. Using a Surgicutt Automated Incision Device (ITC, Edison, NJ), a longitudinal incision was made over the lateral aspect of the volar surface of the forearm distal to the antecubital crease. A stopwatch was started at the time of incision. At 15-30 seconds post incision, the blood was wicked with Surgicutt Bleeding Time Blotting Paper (ITC, Edison, NJ) while avoiding direct contact with the incision. Every 15-30 seconds the blotting paper was rotated and re-blotted at a fresh site on the paper. The blotting was repeated until blood was no longer wicked onto the paper or for 30 minutes whichever came first. Bleeding time is determined to within 30 seconds of the time when blood is no longer wicked onto the paper.

[00356] The table of Figure 27 shows the cutaneous bleeding time in minutes, in nM and PFA IC95 in nM at various time points, shown in column 1, relative to ARC 1779 (SEQ ID NO 320) dosing for three different animals. Figure 28 shows a graph of the average PFA-100 closure time from the blood of three ARC1779 (SEQ ID NO 320) treated macaques taken at various time points following dosing. Figure 29 shows the cutaneous bleeding time of the three ARC 1779 (SEQ ID NO 320) treated macaques taken at various time points following dosing. Figure 30 correlates the average cutaneous bleeding time in (SEQ ID NO 320) treated C. macaques (left vertical axis) to the PFA-100 closure time (right vertical axis). As shown Figures 27 to 30, at time points up to and including 2 hours, where BIPA and PFA-100 closure time were maximally inhibited, there is very little increase in cutaneous bleeding times. At concentrations of the anti-gpIIbII1a antagonist IntegrilinTM that yield similar inhibition of platelet aggregation ex vivo, template or cutaneous bleeding times are between 20 and 30 minutes. See, e.g. Phillips, D.R. and Scarborough, R.M., Am J Cardiol, 80(4A): 1 1B-20B (1997). While not wishing to be bound by any particular theory, these data are consistent with and supportive of our hypothesis that an anti-vWF Al domain aptamer antagonist will block platelet activity in vivo by blocking platelets from binding to vWF
immobilized at sites of vascular damage without inhibiting platelet function and thus without increasing cutaneous bleeding times.

EXAMPLE 5B: Assessment of ARC1779 in a c n~gus macaque electrolytic thrombosis model [00357] A study was performed to test the efficacy of ARC1779 (SEQ ID NO 320) in inhibiting intra-arterial thrombosis in a well documented non-human primate electrolytic thrombosis model. See, e.g., Rote et al., Stroke, 1994: 25, 1223-1233.
Thirteen cynomolgus monkeys were divided into four groups and assigned to a treatment regimen as indicated in table 30 below.

Table 32: Electrolytic Thrombosis Study Design Group Number Dose Necropsy Number of Test Article (mg/kg) Dose Regime Dose Volume Day Animals IV bolus, -15 minutes prior to 1 3 Vehicle (saline) DVE to initiation of electrical injury Group 3 followed by continuous infusion on Day 0 ReoProTM IV bolus, once on Day 0, -15 2 1 (chimeric 7E3) 0.25 mg/kg minutes prior to initiation of < l OmL Day 0 electrical injury -0.61 mg/kg IV bolus,, -l5 minutes prior bolus + to initiation of electrical 3 5 ARC1779 0.0037 injury, followed by mg/kg/min continuous infusion on Day 0 infusion 0.25 mg/kg IV bolus,, -15 minutes prior 4 4 ReoProTM ~o125 to initiation of electrical (chimeric 7E3) g~g/~n injury, followed by infusion continuous infusion on Day 0 DVE = Dose Volume Equivalent, IV = Intravenous [00358] Each animal was anesthetized prior to surgical preparation, intubated and maintained in anesthesia with isoflurane inhalant anesthetic to effect delivered through a volume-regulated respirator. An intravenous catheter was also placed in a peripheral vein for administration of lactated Ringer's solution during the procedure.

[00359] A catheter was placed in the femoral artery of each animal for continuous monitoring of arterial blood pressure. Similarly a catheter was placed in the femoral vein for blood sample collection. Each carotid artery was instrumented with a Doppler flow probe connected to a flow meter. The flow probes were placed around the artery at a point proximal to the insertion of the intra-arterial electrode and stenosis. The stenosis was placed around each carotid artery so that the blood flow was reduced by approximately 50% to 60% without altering the mean blood flow. Blood flow in the carotid arteries was monitored and recorded continuously throughout the observation periods.

[00360] Electrolytic injury to the intimal surface of each carotid artery was accomplished via placement of an intravascular electrode. Each electrode was connected to the positive pole of a constant current device and cathode connected to a distant subcutaneous site.
Continuous current was delivered to each vessel for a period of 3 hours or for 30 minutes after complete occlusion, whichever was shorter.

[00361] Once the electrodes were placed on the right carotid artery ("RCA") the animal was administered the test article as indicated in Table 32 above.
Approximately 15 minutes after test article administration, the electrical current was applied at 100 A. Blood samples and CBT measurements were collected at the time points specified in Blood Sample Collection Schedule as indicated in Figure 31. The current was terminated -30 minutes after the blood flow signal remained stable at zero flow (which indicates an occlusive thrombus had been formed at the site) or after 180 minutes of electrical stimulation.
Approximately 195 minutes after the test article was administered, the left carotid artery ("LCA") had electrical current administered in a similar fashion as previously described for the RCA.
After termination of all surgical procedures and sample collection each animal was euthanized.
[00362] The ARC 1779 (SEQ ID NO 320) plasma concentration (as measured by HPLC) over time for each animal in treatment group 3 is depicted in Figure 32. The time to occlusion measured via Doppler flow for each treatment group is indicated in Figure 33.
As can be determined from Figure 33, ARC1779 (SEQ ID NO 320) inhibited thrombus formation during sequential 180-minute electrical injuries to the carotid arteries of the cynomolgus monkeys in this animal thrombosis model.

Example 5C: Assessment of ARC1779 at various doses in a cynomolgus macaque electrolytic thrombosis model [00363] The study described in Example 5B above was extended to test the efficacy of ARC 1779 (SEQ ID NO 320) in inhibiting intra-arterial thrombosis in the non-human primate electrolytic thrombosis model at lower aptamer dosage levels..

[00364] An additional 10 cynomolgus monkeys (2.5 to 3.5 kg) were divided into treatment groups 5 to 7 and were treated according the regimen indicated in Table 33 below.

Table 33: Study Design Group No. of Test Article Dosage Level Dose Dosing Regimen Necropsy Number Animals Volume Day Vehicle DVE to IV bolus, -15 minutes prior to 1 3 initiation of electrical injury, followed (Saline) Group 3 by continuous infusion on Day 0 2 1 Abciximab 0.25 mg/kg IV bolus, once on Day 0 -15 minutes (ReoPro) <10 mL prior to initiation of electrical injury Day 0 Abciximab 0.25 mg/kg bolus IV bolus, -15 minutes prior to 4 5 (ReoPro) and 0.125 g/kg/min initiation of electrical injury, followed by continuous infusion on Day 0 0.61 mg/kg bolus IV bolus, -15 minutes prior to 3 5 ARC1779 and <10 mL initiation of electrical injury, followed Day 0 0.0037 mg/kg/min by continuous infusion on Day 0 infusion (1000 nM) 0.123 mg/kg bolus IV bolus, -15 minutes prior to 2 ARC1779 0and . 01 mg/kg/min -10 mL initiation of electrical injury, followed Day 0 infusion (300 nM) by continuous infusion on Day 0 0.2 mg/kg bolus and IV bolus, -15 minutes prior to 6 4 ARC1779 0.00165 mg/kg/min 510 mL initiation of electrical injury, followed Day 0 infusion (500 nM) by continuous infusion on Day 0 0.298 mg/kg bolus IV bolus, -15 minutes prior to 7 4 ARC1779 and <10 mL initiation of electrical injury, followed Day 0 0.00248 mg/kg/min by continuous infusion on Day 0 infusion (750 nM) [00365] The animal procedure for each treatment group in Table 33 was conducted as reported for the animals in Example 5B. The time to occlusion measured via Doppler flow for each treatment group is indicated in Figure 33.

[00366] Without any platelet antagonist therapy (control animals) 100% of carotid arteries develop occlusive thrombi within 60 minutes. In contrast, only 20% or arteries developed occlusive thrombi in animals treated with Reopro. In the ARC 1779 treatment groups at infusion rates targeted to reach constant plasma levels of 1000 nM, 750 nM, 500 nM and 300 nM, 0%, 25%, 63% and 100 % of carotid arteries developed occlusive thrombi. In addition to occlusive thrombus formation, we also assessed the effect of ARC1779 on cutaneous bleeding times which is shown in Figure 34. As can be seen in Figure 34, at some doses and/or time points in this animal model prolonged CBT was observed, while at other doses and time points CBT was not prolonged.

[00367] The invention having now been described by way of written description and example, those of skill in the art will recognize that the invention can be practiced in a variety of embodiments and that the description and examples above are for purposes of illustration and not limitation of the following claims.

DEMANDE OU BREVET VOLUMINEUX

LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

NOTE : Pour les tomes additionels, veuillez contacter le Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS

THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME:

NOTE POUR LE TOME / VOLUME NOTE:

Claims (42)

1) An aptamer comprising a nucleic acid sequence that is 95% identical to a sequence selected from the group consisting of: ARC1029 (SEQ ID NO 214), ARC1115 (SEQ
ID NO
221), ARC1172 (SEQ ID NO 222), ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO
284), ARC1368 (SEQ ID NO 291), SEQ ID NO 1635 (SEQ ID NO 319), ARC1759 (SEQ ID

NO 318), and ARC1884 (SEQ ID NO 322).

2) The aptamer of claim 1, wherein the aptamer comprises a primary nucleic acid sequence that is 95% identical to a primary nucleic acid sequence selected from the group consisting of: ARC1029 (SEQ ID NO 214), ARC1115 (SEQ ID NO 221), ARC1172 (SEQ
ID NO 222), ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284), ARC1368 (SEQ ID
NO 291), SEQ ID NO 1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), and ARC1884 (SEQ ID NO 322).

3) The aptamer of claim 1, wherein the aptamer nucleic acid sequence comprises a chemical modification and is 95% identical to a nucleic acid sequence, including the chemical modification, selected from the group consisting of: ARC1029 (SEQ ID NO 214), (SEQ ID NO 221), ARC1 172 (SEQ ID NO 222), ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284), ARC1368 (SEQ ID NO 291), SEQ ID NO 1635 (SEQ ID NO 319), ARC1759 (SEQ ID NO 318), and ARC1884 (SEQ ID NO 322).

4) The aptamer of claim 1, wherein the aptamer is conjugated to a high molecular weight, non-immunogenic compound, or a lipophilic compound.

5) The aptamer of claim 4, wherein the aptamer is conjugated to a non-immunogenic, high molecular weight compound which is polyalkylene glycol.

6) The aptamer of claim 5, wherein the polyalkylene glycol is polyethylene glycol.

7) The aptamer of claim 6, wherein the polyethylene glycol comprises a molecular weight selected from the group consisting of: 5kDa, 10 kDA, 20kDa and 40 kDa.

8) The aptamer of claim 7, wherein the aptamer is selected from the group consisting of:
ARC1779 (SEQ ID NO 320), ARC1780 (SEQ ID NO 321) and ARC1885 (SEQ ID NO 323).

9) A composition comprising a therapeutically effective amount of an aptamer of claim 1 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

10) A method of treating, preventing or ameliorating a disease mediated by vWF, comprising administering the composition of claim 9 to a mammal.

11) A method of treating a patient comprising administering the composition of claim 9 to a patient in need thereof prior to, during and/or after dialysis, CABG
surgery, percutaneous coronary intervention or heart valve replacement.

12) The method of claim 10, wherein the composition comprises ARC1368 (SEQ ID
NO
291) or a fragment thereof conjugated to a 20 kDA PEG.

13) The method of claim 12, wherein the composition comprises ARC1779 (SEQ ID
NO
320)

14) The method of claim 11, wherein the composition comprises ARC1368 (SEQ ID
NO
291) or a fragment thereof conjugated to a 20 kDA PEG.

15) The method of claim 14, wherein the composition comprises ARC 1779 (SEQ ID
NO
320).

16) A composition comprising therapeutically effective amount of an aptamer of claim 8 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

17) A method of treating, preventing or ameliorating a disease mediated by vWF, comprising administering the composition of claim 16 to a mammal.

18) An aptamer that specifically binds to a von Willebrand Factor target.

19) The aptamer of claim 18, wherein the von Willebrand Factor target is human von Willebrand Factor.

20) The aptamer of claim 18, wherein the aptamer modulates von Willebrand Factor mediated platelet aggregation.

21) An aptamer according to claim 18 that specifically binds to a von Willebrand Factor full length target and a von Willebrand Factor domain A1 target.

22) The aptamer of claim 21, wherein the von Willebrand Factor full length target and the von Willebrand Factor domain A1 target are from different species.

23) A diagnostic method comprising contacting an aptamer of any of claims 18 with a composition suspected of comprising von Willebrand Factor or a variant thereof and detecting the presence or absence of von Willebrand Factor or a variant thereof.

24) A method for identifying an aptamer that modulates a biological function of an aptamer target comprising:

a) preparing a candidate mixture of single-stranded nucleic acids;

b) contacting the candidate mixture with both a full length protein target and a domain of the full length protein target;

c) partitioning the nucleic acids having an increased affinity for the full length protein target or the protein target domain; and d) amplifying the increased affinity nucleic acids, in vitro, to yield a protein target specific enriched aptamer mixture.

25) The method of claim 24, wherein the method further comprises;

e) contacting the target specific enriched aptamer mixture with the full length protein target;

f) partitioning the nucleic acids having an increased affinity for the full length protein target; and g) amplifying the increased affinity nucleic acids, in vitro; to yield a target specific enriched aptamer mixture;

h) contacting the target specific enriched aptamer mixture with the protein target domain;

f) partitioning the nucleic acids having an increased affinity for the protein target domain; and g) amplifying the increased affinity nucleic acids, in vitro, to yield a protein target specific enriched aptamer mixture.

26) The method of claim 25, wherein the method further comprises selecting an aptamer that blocks a biological function of the full length protein target in vivo.

27) The method of claim 25, wherein the full length protein target is from a first species and the protein target domain is from a second species.

28) The method of claim 27, further comprising selecting an aptamer capable of binding to the protein targets of both the first and second species.

29) An aptamer identified by the method of claim 26.

30) An aptamer that specifically binds to von Willebrand Factor comprising a primary nucleic acid sequence at least 95% identical to any one of the primary nucleic acid sequences selected from the group consisting of: SEQ ID NOS 31 to 50, SEQ ID NOS 54 to 94, SEQ ID
NOS 98 to 164, SEQ ID NO 177, SEQ ID NO 180, SEQ ID NO 183, SEQ ID NO 186, SEQ

ID NO 189, SEQ ID NO 192, SEQ ID NO 198, SEQ ID NO 201, SEQ ID NO 205, SEQ ID
NO 208, SEQ ID NOS 212-214, ARC1115 (SEQ ID NO 221), ARC1172 (SEQ ID NO 222), ARC1194 (SEQ ID NO 223) to ARC1240 (SEQ ID NO 269), ARC1338 (SEQ ID NO 273) to ARC1346 (SEQ ID NO 281), ARC1361 (SEQ ID NO 284) to ARC1381 (SEQ ID NO 304), ARC1524 (SEQ ID NO 305), ARC1526 (SEQ ID NO 307) to ARC1535 (SEQ ID NO 316), ARC1546 (SEQ ID NO 317), ARC1759 (SEQ ID NO 318), ARC1635 (SEQ ID NO 319), ,ARC1779 (SEQ ID NO 320) to ARC1780 (SEQ ID NO 321) and ARC1884 (SEQ ID NO
322) to ARC1885 (SEQ ID NO 323).

31) A composition comprising therapeutically effective amount of an aptamer of claim 30 or a salt thereof and a pharmaceutically acceptable carrier or diluent.

32) A method of treating, preventing or ameliorating a disease mediated by vWF, comprising administering the composition of claim 31 to a mammal.

33) A method of treating a patient comprising administering the composition of claim 31 to a patient in need thereof prior to, during and/or after dialysis, CABG
surgery, percutaneous coronary intervention or heart valve replacement.

34) A diagnostic method comprising contacting an aptamer of 30 with a composition suspected of comprising von Willebrand Factor or a variant thereof and detecting the presence or absence of von Willebrand Factor or a variant thereof.

35) An aptamer according to claim 30 for use as an in vitro diagnostic.

36) An aptamer according to claim 30 for use as an in vivo diagnostic.

37) The method of claim 24, wherein the aptamer target is von Willebrand Factor.

38) The method of claim 24, wherein the domain of the full length protein target is von Willebrand Factor domain A1.

39) The method of claim 25, wherein the full length protein target is von Willebrand Factor.

40) The method of claim 39, wherein the protein target domain is von Willebrand Factor domain A1.

41) The method of claim 28, wherein the protein target of both the first and second species is a von Willebrand Factor target.

42) An aptamer identified according to the method of claim 41.