CN103063629A - Method for detecting ratio of sodium ions to potassium ions, kit and system - Google Patents
Method for detecting ratio of sodium ions to potassium ions, kit and system Download PDFInfo
- Publication number
- CN103063629A CN103063629A CN2012105531258A CN201210553125A CN103063629A CN 103063629 A CN103063629 A CN 103063629A CN 2012105531258 A CN2012105531258 A CN 2012105531258A CN 201210553125 A CN201210553125 A CN 201210553125A CN 103063629 A CN103063629 A CN 103063629A
- Authority
- CN
- China
- Prior art keywords
- sodium
- solution
- potassium
- potassium ion
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
- C09B23/02—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups
- C09B23/06—Methine or polymethine dyes, e.g. cyanine dyes the polymethine chain containing an odd number of >CH- or >C[alkyl]- groups three >CH- groups, e.g. carbocyanines
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09B—ORGANIC DYES OR CLOSELY-RELATED COMPOUNDS FOR PRODUCING DYES, e.g. PIGMENTS; MORDANTS; LAKES
- C09B23/00—Methine or polymethine dyes, e.g. cyanine dyes
- C09B23/0008—Methine or polymethine dyes, e.g. cyanine dyes substituted on the polymethine chain
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
- G01N21/62—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light
- G01N21/63—Systems in which the material investigated is excited whereby it emits light or causes a change in wavelength of the incident light optically excited
- G01N21/64—Fluorescence; Phosphorescence
- G01N21/6428—Measuring fluorescence of fluorescent products of reactions or of fluorochrome labelled reactive substances, e.g. measuring quenching effects, using measuring "optrodes"
Abstract
The invention relates to a method for detecting a ratio of sodium ions to potassium ions, a kit and a system. The invention relates to a method for detecting mol ratio of sodium ions to potassium ions in solution, comprising the following steps: (1) preparing a plurality of solution samples according to difference of ratios of sodium ions to potassium ions, wherein each solution sample contains cyanine dye with the same concentration and DNA molecules capable of respectively forming different G-quadruplex structures with the existence of sodium ions and potassium ions; (2) detecting fluorescence intensity level where wavelength is collected; (3) plotting by using the ratio of sodium ions to potassium ions in each solution sample as a horizontal ordinate or a vertical ordinate and using the fluorescence intensity level where wavelength is collected detected in the step (2) as a horizontal ordinate or a vertical ordinate so as to obtain a specification curve of ratios of sodium ions to potassium ions; (4) adding the DNA molecules in a liquid sample to be detected, and adjusting the pH value so as to obtain a test solution; (5) detecting the fluorescence intensity level of the wavelength where the wavelength is collected; and (6) finding out corresponding ratio of sodium ions to potassium ions in the test solution in the specification curve of ratios of sodium ions to potassium ions.
Description
Technical field
The invention belongs to biomedicine field, in particular to a kind of sodium/potassium ion than detection method and kit and system.
Background technology
Sodium, potassium in the human body are the main kations of keeping the cell physiological activity, are normal osmotic pressure and the acid base equilibriums that keeps body, and involved in sugar and protein metabolism guarantee that nervimuscular normal function institute is essential, and its content is human physiological activity's important indicator.The contents level of urine, Sodium in Serum, potassium ion can be used for diagnosing the disease of the aspects such as some kidneys, heart clinically.
Sodium Potassium Level in the human body is in an equilibrium state, and the change of its ratio is to the health important.For healthy, the ratio of monitoring sodium/potassium may be more important than the two independent absolute figure.Clinically, by detecting saliva sodium/potassium ratio, diagnosable aldosteronism.In addition, American scholar studies confirm that recently the predictive value of twenty-four-hour urine sodium/potassium comparison risk of cardiovascular diseases significantly is better than simple urine sodium or urine potassium detects.This shows, the monitoring of sodium/potassium ratio is to angiocardiopathy preventing tool significance.
The method of measuring sodium, potassium concentration in the prior art mainly contains: neutron activation method, isotope dilution mass spectrometry, chemical assay, flame photometry, ion selective electrode method, enzyme kinetics method, atom spectrophotometric method etc.At present, the method for often using clinically is flame photometry and ion selective electrode method.
(1) flame photometry: flame photometry is a kind of emission spectrometry method, utilizes in the flame excited atom to return the spectral intensity of launching when being down to ground state and carries out content analysis, can detect the Na of serum, urine, cerebrospinal fluid and chest ascites
+And K
+, the method belongs to classical canonical reference method, advantage be the result accurately and reliably, widely clinical employing.
Usually the quantivative approach that adopts has outer standard law and internal reference method.Outer standard law general operation error is larger, seldom adopts.Internal standard method is that sample and titer adopt the internal standard element of adding same concentrations to measure, generally be to add mark in the lithium, what measure is the ratio of lithium/sodium or potassium current, rather than the electric current of independent sodium or potassium, like this, can reduce the error that the factors such as combustion gas and flame temperature fluctuation cause, thereby preferably accuracy is arranged.
(2) ion selective electrode method (ISE method): potassium, sodion in the cleer and peaceful urine of the enterprising promoting circulation of blood of instrumentation are measured.To have a sample consumption few because of it, and quick and precisely, the advantage such as easy and simple to handle is present the easiest accurately method in all methods, and the trend that replaces additive method is almost arranged.Its principle is: ion-selective electrode is a kind of electrochemical sensor, a Sensitive membrane electrode that specific ion is had selective response is arranged in its structure, convert ion activity to electric potential signal, within the specific limits, the logarithm of specific ion activity is linear in its current potential and the solution, by trying to achieve the ion activity of unknown solution with the solution comparison of known ion concentration, be divided into again direct measuring method and Indirect Determination by its mensuration process, major part adopts Indirect Determination at present, because Indirect Determination is with the rear mensuration of sample to be tested dilution, institute's measured ion activity is more near ion concentration.
Main type of electrodes has at present: glass-membrane electrode, inductive material are glass-film; The solid phase electrode is by the extrusion forming of insoluble metal material; The liquid film electrode, with epoxy resin or in-built Polyvinylchloride as sense film; The K+ electrode that the valinomycins film is made.These electrodes all have certain life-span, and after asking when using one section, electrode can wear out, and expensive.
(3) chemical assay: present Na
+, K
+Chemical assay mainly utilize multiple ring crown compound such as cave crown ether or spherical crown ether, also be called crown ether, being ionophore measures, owing in the macrocyclic structure hole being arranged, the intramolecule oxygen atom has not share electron pair to be combined with metallic ion, according to the hole size, alternative metallic ion in conjunction with different-diameter, thus can reach the purpose of measuring ion concentration.
(4) enzyme process: the principle of enzymatic assays potassium is to utilize the beta galactosidase catalysis artificial substrates ONPG(ortho-nitrophenol β of sodium dependence-D-galactopyranoside); Decomposition discharges coloured product ortho-nitrophenol, surveys absorbance at wavelength 420nm place and changes.The principle that enzyme process is surveyed potassium is the activation of utilizing pyruvate kinase, and latter's catalysis phosphoenolpyruvic acid becomes lactic acid simultaneously with the consumption of reduced coenzyme Ⅰ, and the absorbance of surveying NADH at wavelength 340nm place descends.The advantage of enzyme process is not need specific apparatus, and shortcoming is that price is more expensive.
(5) the atom spectrophotometric method also can be used for detecting potassium in the serum, sodion, but complicated operation, error is larger, and is easy not as good as flame photometry.
Existing these methods all are to measure respectively sodium, potassium concentration, calculate sodium/potassium ion ratio on the numerical value basis of measuring again.Up to the present, still there is not directly to measure the method for sodium/potassium ion ratio.
Summary of the invention
Purpose of the present invention: a kind of new method of utilizing cyanine dyes supermolecule and G-quadruplex (G-four serobilas) effect system to detect sodium/potassium ion ratio is provided, and uses the formulated sodium/potassium of the method and compare detection kit.Utilize the reagent in this kit, can utilize sodium in the fluorescence spectrum instrument quantitative test liquid/potassium ion ratio, the mensuration process is not subjected to the impact of other elements, and degree of accuracy is high.Simultaneously, because this reagent sensitivity is very high, than the variation that shows on the color, as seen naked eyes can realize visual detection to different sodium/potassium ion.
General technical route of the present invention is: regulate and control formation or the conformation transition of G-four chain body structures by adding sodium/potassium ion, and the thereupon variation of cyanine dyes identification G-four chain body structures, thus reflect sodium/potassium ratio level.Be specially: under the environment of low sodium/potassium ratio, dna sequence dna forms antiparallel structure G-four serobilas, reduce the then occurred conformation transformation of antiparallel G-four serobilas with sodium/potassium ratio, along with G-four serobila conformation transitions, the accumulation shape of cyanine dyes changes, thereby changes in color, reach naked-eye observation, also occur simultaneously significantly to change on fluorescence spectrum, the intensity of variation of fluorescence intensity is directly proportional with sodium/potassium ratio, thereby realizes that quantitative response sodium/potassium compares level.
A first aspect of the present invention provides the method for sodium in a kind of tracer liquid sample/potassium ratio, said method comprising the steps of:
(1) prepare sodium/potassium ion than different a plurality of solution samples with the buffer solution of pH6.2～8.2 with soluble sodium salt and sylvite, what wherein contain same concentrations in each described solution sample can form respectively the dna molecular of different G-four chain body structures and the cyanine dyes of same concentrations in the presence of sodium, potassium ion;
(2) described a plurality of solution samples are placed under the fluorescence spectrophotometer, adopt the excitation wavelength of 540nm to 570nm, detect in the fluorescence intensity that gathers the wavelength place;
(3) sodium/potassium with each described solution sample is compared to horizontal ordinate or ordinate, and what record in the step (2) is ordinate or horizontal ordinate mapping at the fluorescence intensity level that gathers the wavelength place, thereby obtains the typical curve of sodium/potassium ratio;
(4) in the testing liquid sample, add described dna molecular and cyanine dyes, and regulate the pH value, so that the concentration of the concentration of dna molecular, cyanine dyes described in the testing liquid sample and pH value are consistent with the solution sample in the step (1), thereby obtain test solution;
(5) test solution that obtains in the step (4) is placed under the fluorescence spectrophotometer, adopt with step (2) in identical excitation wavelength, the detection wavelength is in the fluorescence intensity at described collection wavelength place;
(6) utilize sodium/potassium that the fluorescence intensity level that records in the step (5) obtains in step (3) to find the sodium of corresponding test solution/potassium ratio in than typical curve;
Wherein said collection wavelength is in 570nm to 700nm scope.
Method of the present invention can be advantageously used in detecting sodium in the various solution examples/potassium ratio, for example, can detect sodium in human or animal's blood, urine, saliva, cell or other body fluid/potassium ratio.
According to the method for first aspect present invention, wherein said damping fluid is selected from trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) damping fluid, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid.
According to the method for first aspect present invention, the wherein said dna molecular that can form respectively different G-four chain body structures in the presence of sodium, potassium ion is the dna molecular that contains the structure of following formula I in the molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: the G among the formula I represents guanine, and Y, Z, M represent respectively one or more any bases, and G represents guanine base.
According to the method for first aspect present invention, wherein said cyanine dyes is the compound of Formula Il:
Formula II
Wherein: R
1Be C
1-C
6The phenyl that replaces of alkyl, phenyl, alkyl; R
2, R
3, R
4And R
5Be independently selected from H or C
1-C
6Alkyl, perhaps R
2And R
3The carbon atom that connects with them forms 5 yuan to 7 yuan ring structure, perhaps R
4And R
5The carbon atom that connects with them forms 5 yuan to 7 yuan ring structure; R
6And R
7Be C
1-C
6The C that alkyl or sulfonic group replace
1-C
6Alkyl; Y is gegenion, according to R
6And R
7If institute charged difference and difference are R
6And R
7Be alkyl, then Y is halide anion; If R
6And R
7Only have one with sulfonate radical, then need not Y as gegenion; If R
6And R
7All with sulfonate radical, then Y is the triethylamine kation; X
1, X
2Be independently selected from carbon (C), oxygen (O), sulphur (S), selenium (Se) or tellurium (Te).
According to the method for first aspect present invention, wherein C
1-C
6Alkyl be that carbon number is the alkyl of the straight or branched of 1-6, include but not limited to methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl etc.
According to the method for first aspect present invention, wherein R
1Be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl.
According to the method for first aspect present invention, wherein R
2, R
3, R
4And R
5Be independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
According to the method for first aspect present invention, wherein R
2And R
3The carbon atom that is connected with them can form 5 yuan to 7 yuan saturated rings structure or unsaturated ring structure, and described ring structure can contain or not contain nitrogen (N) or sulphur (S) atom.
According to the method for first aspect present invention, wherein R
4And R
5The carbon atom that is connected with them can form 5 yuan to 7 yuan saturated or unsaturated ring structure, and described ring structure can contain or not contain N or S atom.
According to the method for first aspect present invention, wherein Y is preferably fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
Method according to first aspect present invention, wherein can be by using soluble sodium, sylvite such as potassium chloride, sodium chloride, glazier's salt, sodium sulphate, potassium nitrate, sodium nitrate etc. are prepared described a plurality of solution sample, sodium in each solution sample/potassium ion is than preferably in 0 to 20 scope, further preferably in 0 to 10 scope, further preferably in 1 to 8 scope, most preferably in 2 to 6 scope, wherein said soluble sodium, the non-limiting example of sylvite comprises, potassium chloride, potassium bromide, potassium iodide, glazier's salt, potassium nitrate, sodium chloride, sodium bromide, sodium iodide, sodium sulphate or sodium nitrate etc.
Method according to first aspect present invention, the concentration of wherein said cyanine dyes in the solution sample is in the scope of 1 to 30 μ mol/L, preferably at 2 to 10 μ mol/L, the described concentration of dna molecular in the solution sample of different G-four chain body structures that can form respectively in the presence of sodium, potassium ion is in the scope of 0.5 to 30 μ mol/L, preferably at 1 to 20 μ mol/L, further preferably 2 to 10mol/L.
Method according to first aspect present invention, the wherein said dna molecular that can form respectively different G-four chain body structures in the presence of sodium, potassium ion is the dna molecular that is rich in guanine in the molecular sequences, and the dna molecular that has " GG " structure in the preferred molecular sequences.The non-limiting example of this class dna molecular comprises, such as dna moleculars such as TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG, but the dna sequence dna scope that can form G-four serobilas be not subjected to these enumerate limit.In addition, do not have particular restriction for the employed length that in the presence of sodium, potassium ion, can form respectively the dna molecular of different G-four chain body structures among the present invention, but the length of preferred 6 ~ 300 bases, the more preferably length of 10 ~ 100 bases, the most preferably length of 10 ~ 30 bases.Occurred conformation changes because these dna sequence dnas compare for the sodium in the solution/potassium ion specifically, thereby method of the present invention can directly obtain sodium in the solution/potassium ion ratio.
In addition, in the method for the present invention, when the preparation standard curve, the number of obtain solution sample does not have special restriction, but the number of solution sample can not be less than 2, and the solution sample is more, and the degree of accuracy of typical curve is higher, generally preparing 3 to 20 solution samples gets final product, also can prepare more solution sample, for example more than 50, those skilled in the art can carry out suitable selection as required.
A second aspect of the present invention provides a kind of kit and system that implements the inventive method, and described kit comprises: the damping fluid of pH6.2 ~ 8.2, soluble sodium salt, sylvite, can form respectively dna molecular and the cyanine dyes of different G-four chain body structures in the presence of sodium, potassium ion; Described system comprises described kit and fluorescence spectrophotometer.
According to the described kit of second aspect present invention and system, wherein said damping fluid is selected from trishydroxymethylaminomethane-hydrochloric acid (Tris-HCl) damping fluid, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid.
According to the described kit of second aspect present invention and system, the non-limiting example of wherein said soluble potassium salt comprises potassium chloride, potassium bromide, potassium iodide, glazier's salt and potassium nitrate.The non-limiting example of described soluble sodium salt comprises sodium chloride, sodium bromide, sodium iodide, sodium sulphate and sodium nitrate.
According to the described kit of second aspect present invention and system, the wherein said dna molecular that can form respectively different G-four chain body structures in the presence of sodium, potassium ion is the dna molecular that contains the structure of following formula I in the molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: the G among the formula I represents guanine, and Y, Z, M represent respectively one or more any bases.
According to the described kit of second aspect present invention and system, the non-limiting example of the sequence of the wherein said dna molecular that can form G four serobilas comprises TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG and GGGCGCGGGAGGAATTGGGCGGG etc.But the dna sequence dna scope that can form G-four serobilas be not subjected to these enumerate limit.In addition, do not have particular restriction for the employed length that in the presence of sodium, potassium ion, can form respectively the dna molecular of different G-four chain body structures among the present invention, but the length of preferred 6 ~ 300 bases, the more preferably length of 10 ~ 100 bases, the most preferably length of 10 ~ 30 bases.Occurred conformation changes because these dna sequence dnas compare for the sodium in the solution/potassium ion specifically, thereby uses kit of the present invention and system can directly obtain sodium in the solution/potassium ion ratio.
According to the described kit of second aspect present invention and system, wherein said cyanine dyes is the compound of Formula Il:
Formula II
Wherein: R
1Be C
1-C
6The phenyl that replaces of alkyl, phenyl, alkyl; R
2, R
3, R
4And R
5Be independently selected from H or C
1-C
6Alkyl, perhaps R
2And R
3The carbon atom that connects with them forms 5 yuan to 7 yuan ring structure, perhaps R
4And R
5The carbon atom that connects with them forms 5 yuan to 7 yuan ring structure; R
6And R
7Be C
1-C
6The C that alkyl or sulfonic group replace
1-C
6Alkyl; Y is gegenion, according to R
6And R
7If institute charged difference and difference are R
6And R
7Be alkyl, then Y is halide anion; If R
6And R
7Only have one with sulfonate radical, then need not Y as gegenion; If R
6And R
7All with sulfonate radical, then Y is the triethylamine kation; X
1, X
2Be independently selected from carbon (C), oxygen (O), sulphur (S), selenium (Se) or tellurium (Te).
According to kit and the system of second aspect present invention, wherein C
1-C
6Alkyl be that carbon number is the alkyl of the straight or branched of 1-6, include but not limited to methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl etc.
According to kit and the system of second aspect present invention, wherein R
1Be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl.
According to kit and the system of second aspect present invention, wherein R
2, R
3, R
4And R
5Be independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
According to kit and the system of second aspect present invention, wherein R
2And R
3The carbon atom that is connected with them can form 5 yuan to 7 yuan saturated rings structure or unsaturated ring structure, and described ring structure can contain or not contain nitrogen (N) or sulphur (S) atom.
According to kit and the system of second aspect present invention, wherein R
4And R
5The carbon atom that is connected with them can form 5 yuan to 7 yuan saturated or unsaturated ring structure, and described ring structure can contain or not contain N or S atom.
According to kit and the system of second aspect present invention, wherein Y is preferably fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
Described sodium/potassium ion is than the mol ratio that refers to sodium ion in liquor and potassium ion herein.
The major advantage of method of the present invention and kit and system is:
1) the present invention utilizes the G-four chain body structures of cyanine dyes supramolecular aggregation specific recognition sodium potassium ion regulation and control, can operate under physiological environment and unaffected, and is high to sodium potassium ion specificity;
2) the present invention uses the cyanine dyes supermolecular probe, G-four serobila structural changes to the regulation and control of sodium potassium ion are very responsive, with the change of accumulation shape, show absorption band up to the displacement of nearly hundred nanometers in ultra-violet absorption spectrum simultaneously, thereby the variation on the generation color, can realize visual detection;
3) cyanine dyes supermolecule used in the present invention can both produce marked change at fluorescence spectrum, utilizes common fluorescence spectrophotometer all can realize quantitative detection, does not need special or additional instruments, and testing cost is cheap, is convenient to apply in the industry;
4) agents useful for same composition of the present invention only has 3～4 kinds, only needs to mix in proportion, detects with regard to available instrument, and simple to operate, quick and with low cost, this system operates in buffered environment, does not pollute the environment.
5) agents useful for same composition of the present invention is simple, kind is few, can not exert an influence each other, and good stability, can store for a long time the fine assurance application testing effect of energy;
6) use the reagent that detection method provided by the invention can be made the various ways such as liquid reagent, powdered reagent, dried reagent, can be used to measure the interior sodium/potassium ion of human body and other animal body than level, the sodium/potassium ion that also can be used to detect in other samples such as water quality or soil compares level.
7) use detection method provided by the invention, according to the characteristic of cyanine dyes aggregation change color, can be developed to the form of test paper, make detection more simple, convenient.
Description of drawings
Fig. 1 is that the sodium/potassium ion according to the embodiment of the invention 1 compares typical curve;
Fig. 2 is that the sodium/potassium ion according to the embodiment of the invention 2 compares typical curve;
Fig. 3 is that the sodium/potassium ion according to the embodiment of the invention 3 compares typical curve;
Fig. 4 is that the sodium/potassium ion according to the embodiment of the invention 4 compares typical curve;
Fig. 5 is that the sodium/potassium ion according to the embodiment of the invention 5 compares typical curve;
Fig. 6 is that the sodium/potassium ion according to the embodiment of the invention 6 compares typical curve;
Fig. 7 is that the sodium/potassium ion according to the embodiment of the invention 7 compares typical curve;
Fig. 8 is that the sodium/potassium ion according to the embodiment of the invention 8 compares typical curve.
Embodiment
In the mode of specific embodiment the present invention is described in more detail below with reference to accompanying drawings, but be to be understood that, the present invention can implement in a different manner, it only is in order to make this instructions fully with complete that these embodiment are provided, so that those skilled in the art can implement the present invention, scope of the present invention should not be defined as the listed specific embodiment of this paper.
Embodiment 1
The DNA that can form respectively different G-four chain body structures in the presence of sodium, potassium ion that uses in the present embodiment is AGGGTTAGGGTTAGGGTTAGGG, and employed cyanine dyes is the compound of following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.2, preparation concentration is 100 μ mol/LDNA mother liquors, and is for subsequent use.
Getting concentration is the methanol solution 200 μ L of 200 μ mol/L cyanine dyes, adds 1.5ml Tris-HCl damping fluid, and then adds DNA mother liquor 250 μ L mixings, obtains the mixed solution of DNA and cyanine dyes.
Get each 150 μ L of mixed solution of 13 parts of above-mentioned DNA and cyanine dyes, add respectively the sodium of 350 μ L/potassium ion ratio in 10 parts of dna solutions therein and be respectively 1(40mmol/40mmol), 2(50mmol/25mmol), 3(300mmol/100mmol), 4(40mmol/10mmol), 5(100mmol/20mmol), 6(90mmol/15mmol), 7(140mmol/20mmol), 8(400mmol/50mmol), 9(270mmol/30mmol), solution 10(400mmol/40mmol) obtains 10 standard solution samples, in the mixed solution of other 3 parts of DNA and cyanine dyes, add 350 μ L aqueous liquid sample to be measured, obtain test solution.
Above sample is in shady place placement, for subsequent use.
2) detect analysis
Above-mentioned sample is utilized respectively fluorescence spectrophotometer analysis.Every operation all carries out under room temperature environment, does not need extra condition.Fluorescence spectrophotometer adopts the excitation wavelength of 540nm, collects wavelength in the data at 570 ~ 700nm place.
3) interpretation of result
Take the sodium of standard solution sample/potassium ion ratio as horizontal ordinate, be figure take the fluorescence intensity level at the 598nm place of master sample as ordinate, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 1.Can find the sodium of corresponding test solution/potassium ion ratio to the results are shown in following table 1 with test solution at typical curve at the fluorescence intensity level at 598nm place.
Table 1
The DNA that can form respectively different G-four chain body structures in the presence of sodium, potassium ion that uses in the present embodiment is TGAGGGTGGGGAGGGTGGGGAA, and employed cyanine dyes is the compound of following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the boric acid-borate buffer solution of pH value 8.2, preparation concentration is 200 μ mol/LDNA mother liquors, and is for subsequent use.
Getting concentration is the methanol solution 300 μ L of 600 μ mol/L cyanine dyes, adds 9.1ml boric acid-borate buffer solution, and then adds dna solution 300 μ L mixings.Above-mentioned sample mean is divided into 10 parts, and every this solution of increment is 0.9mL.
Get 6 samples wherein, add respectively the sodium of 0.1mL/potassium ion ratio and be respectively 1(100mmol/100mmol), 2(40mmol/20mmol), 4(160mmol/40mmol), 6(300mmol/50mmol), 8(80mmol/10mmol), 10(150mmol/15mmol) the solution sample, obtain 6 standard solution samples.
Add saliva sample 0.1mL to be measured in other 4 samples, obtain 4 test solutions.
2) detect analysis
Above-mentioned sample is utilized respectively fluorescence spectrophotometer analysis.Every operation all carries out under room temperature environment, does not need extra condition.Excitation wavelength is 570nm, and the wavelength that fluorescence spectrum is collected is in the data at 580～700nm place.
3) interpretation of result
Take master sample sodium/potassium ion ratio as horizontal ordinate, be figure take the fluorescence intensity level at the 600nm place of master sample as ordinate, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 2.Can find the sodium of corresponding test solution/potassium ion ratio with test solution at typical curve at the fluorescence intensity level at 600nm place.The results are shown in following table 2.
Table 2
Embodiment 3
The DNA that can form respectively different G-four chain body structures in the presence of sodium, potassium ion that uses in the present embodiment is GGGCCAGGGAGCGGGGCGGAGGGGG, and employed cyanine dyes is the compound of following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.2, preparation concentration is 600 μ mol/LDNA mother liquors, and is for subsequent use.
Getting concentration is the methanol solution 300 μ L of 1.2mmol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds dna solution 300 μ L mixings.Above-mentioned sample mean is divided into 10 parts, and every this solution of increment is 1.98mL.
Get 6 samples wherein, add respectively the sodium of 1mL/potassium ion ratio and be respectively 1(50mmol/50mmol), 2(40mmol/20mmol), 4(40mmol/10mmol), 6(240mmol/40mmol), 8(400mmol/50mmol), 10(100mmol/10mmol) the solution sample.
Add urine specimen 20 μ L to be measured in other 4 samples, obtain 4 test solutions.
Above sample is in shady place placement, for subsequent use.
2) detect analysis
Above-mentioned sample is utilized respectively fluorescence spectrophotometer analysis.Every operation all carries out under room temperature environment, does not need extra condition.Excitation wavelength is 560nm, and the wavelength that fluorescence spectrum is collected is in the data at 580～700nm place.
3) interpretation of result
Take master sample sodium/potassium ion ratio as horizontal ordinate, be figure take the fluorescence intensity level at the 598nm place of master sample as ordinate, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 3.With test solution can find the sodium of corresponding test solution/potassium ion ratio at typical curve at the fluorescence intensity level at 598nm place, the results are shown in following table 3.
Table 3
The DNA that can form respectively different G-four chain body structures in the presence of sodium, potassium ion that uses in the present embodiment is AGGGTT, and employed cyanine dyes is the compound of following formula
1) preparation standard solution sample and test solution
A certain amount of DNA is dissolved in the Tris-HCl damping fluid of pH value 7.0, preparation concentration is the 1.2mmol/LDNA mother liquor, and is for subsequent use.
Getting concentration is the methanol solution 300 μ L of 200 μ mol/L cyanine dyes, adds 19.2ml Tris-HCl damping fluid, and then adds dna solution 300 μ L mixings.Above-mentioned sample mean is divided into 10 parts, and every this solution of increment is 1.98mL.
Get 6 samples wherein, add respectively the sodium of 1mL/potassium ion ratio and be respectively 1(40mmol/40mmol), 3(20mmol/10mmol), 5(400mmol/80mmol), 7(210mmol/30mmol), 9(450mmol/50mmol), 11(110mmol/10mmol) the solution sample.
Add test serum sample 20 μ L in other 4 samples, obtain 4 test solutions.
Above sample is in shady place placement, for subsequent use.
2) detect analysis
Above-mentioned fluorescent spectrometer is analyzed.Every operation all carries out under room temperature environment, does not need extra condition.The fluorescence spectrum excitation wavelength is 555nm, and the wavelength capture range is 570～700nm.
3) interpretation of result
Take master sample sodium/potassium ion ratio as horizontal ordinate, be figure take the fluorescence intensity level at the 598nm place of master sample as ordinate, obtain the typical curve of sodium/potassium ion ratio, as shown in Figure 4.With test solution can find the sodium of corresponding test solution/potassium ion ratio at typical curve at the fluorescence intensity level at 598nm place, the results are shown in following table 4.
Table 4
Adopt the step identical with embodiment 1 that four urine samples are detected, distinguish and be that the DNA that uses is TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG, the cyanine dyes that uses is the compound of following formula:
Adopt the excitation wavelength of 570nm, detect solution sample and test solution at wavelength 650nm place fluorescence intensity level, be designated as F.
Result such as following table 5:
Table 5
Adopt the step identical with embodiment 1 that four urine samples are detected, distinguish and be that the DNA that uses is GGTTGGTGTGGTTGG, the cyanine dyes that uses is the compound of following formula:
Adopt the excitation wavelength of 565nm, detect solution sample and test solution at wavelength 585nm place fluorescence intensity level, be designated as F.
Result such as following table 6:
Table 6
Embodiment 7
Adopt the step identical with embodiment 1 that four urine samples are detected, distinguish and be that the DNA that uses is TTGGGTTAGGGTTAGGGTTAGGGA, the cyanine dyes that uses is the compound of following formula:
Adopt the excitation wavelength of 540nm, detect solution sample and test solution at wavelength 575nm place fluorescence intensity level, be designated as F.
Result such as following table 7:
Table 7
Adopt the step identical with embodiment 1 that four urine samples are detected, distinguish and be that the DNA that uses is TTAGGGTTAGGGTTAGGGTTAGGG, the cyanine dyes that uses is the compound of following formula:
Adopt the excitation wavelength of 560nm, detect solution sample and test solution at wavelength 600nm place fluorescence intensity level, be designated as F.
Result such as following table 8:
Table 8
One of striking features of the present invention is: the variation based on sodium potassium ion regulating DNA conformation realizes detecting, the sodium potassium ion causes that the DNA conformation changes, the DNA conformation changes the change cause again the cyanine dyes accumulation shape, thereby so that changes on solution colour or absorption, the fluorescence spectrum.The system composition is simple, reacts also simple, and the sodium potassium ion is whole reaction " initiating agent ", has guaranteed the degree of accuracy that detects.
Two of striking features of the present invention is: directly determine sodium/potassium ratio, do not need to measure respectively the again row calculating of sodium potassium concn.
Two of striking features of the present invention is: use the cyanine dyes supermolecular probe, reaction sensitivity is high, and change color is arranged, and can realize naked-eye observation.
In a word, experimental results show that assay method of the present invention, can pass through fluorescence spectrophotometer fully, determine the ratio size of sodium/potassium ion in the sample, measurement sensitivity is high, and specificity is good, and degree of accuracy is good.Simultaneously, also can by the variation of solution colour, with the naked eye judge the height of sodium/potassium ion ratio.In addition, potassium ion detection kit provided by the invention, good stability, long storage time still can accurately detect the content of potassium ion in all kinds sample afterwards.
Although described the present invention in the mode of specific embodiment, but be apparent that to those skilled in the art, in the situation that does not break away from the spirit and scope of the present invention that appended claims limits, can carry out variations and modifications to the present invention, these variations and modification comprise within the scope of the invention equally.
Claims (10)
1. the method for sodium/potassium ion ratio in the tracer liquid sample said method comprising the steps of:
(1) prepare sodium/potassium ion than different a plurality of solution samples with the buffer solution of pH6.2～8.2 with soluble sodium salt and sylvite, the cyanine dyes that wherein contains same concentrations in each described solution sample reaches the dna molecular that can form respectively different G-four chain body structures in the presence of sodium, potassium ion;
(2) described a plurality of solution samples are placed under the fluorescence spectrophotometer, adopt the excitation wavelength of 540nm to 570nm, detect the fluorescence intensity level that gathers the wavelength place;
(3) sodium/potassium with each described solution sample is compared to horizontal ordinate or ordinate, and the fluorescence intensity level at the collection wavelength place that records in the step (2) is ordinate or horizontal ordinate mapping, thereby obtains the typical curve of sodium potassium ion ratio;
(4) in the testing liquid sample, add described dna molecular, and regulate the pH value, so that the concentration of the cyanine dyes in the testing liquid sample and dna molecular and pH value are consistent with the solution sample in the step (1), thereby obtain test solution;
(5) test solution that obtains in the step (4) is placed under the fluorescence spectrophotometer, adopt with step (2) in identical excitation wavelength, the detection wavelength is at the fluorescence intensity level at described collection wavelength place;
(6) utilize record in the step (5) in sodium/potassium ion of in step (3), obtaining of the fluorescence intensity level that records find the sodium of corresponding test solution/potassium ratio in than typical curve;
Wherein said collection wavelength is in the scope of 570nm to 700nm.
2. the method for claim 1, the wherein said dna molecular that can form respectively different G-four serobilas in the presence of sodium, potassium ion is the dna molecular that contains the structure of following formula I in the molecular sequences:
GGYGGZGGMGG
Formula I
Wherein: Y, Z and M represent one or more any bases independently, and G represents guanine base.
3. method as claimed in claim 1 or 2, the sequence of wherein said G-four serobila DNA is selected from following sequence: TTAGGGTTAGGGTTAGGGTTAGGG, AGGGTTAGGGTTAGGGTTAGGG, TTGGGTTAGGGTTAGGGTTAGGGA, TGAGGGTGGGGAGGGTGGGGAA, AGGGAGGGCGCTGGGAGGAGGG, GGGCGCGGGAGGAATTGGGCGGG, GGTTGGTGTGGTTGG, TTGGGGTTGGGGTTGGGGTTGGGG, GGGCGCGGGAGGAAGGGGGCGGG or GGGCGCGGGAGGAATTGGGCGGG.
4. method as claimed in claim 1 or 2, wherein said cyanine dyes is the compound of formula II,
Formula II
Wherein: R
1Be C
1-C
6The phenyl that replaces of alkyl, phenyl, alkyl; R
2, R
3, R
4And R
5Be independently selected from H or C
1-C
6Alkyl, perhaps R
2And R
3The carbon atom that connects with them forms 5 yuan to 7 yuan ring structure, perhaps R
4And R
5The carbon atom that connects with them forms 5 yuan to 7 yuan ring structure; R
6And R
7Be C
1-C
6The C that alkyl or sulfonic group replace
1-C
6Alkyl; Y is gegenion, according to R
6And R
7If institute charged difference and difference are R
6And R
7Be alkyl, then Y is halide anion; If R
6And R
7Only have one with sulfonate radical, then need not Y as gegenion; If R
6And R
7All with sulfonate radical, then Y is the triethylamine kation; X
1, X
2Be independently selected from C, O, S, Se or Te.
5. method as claimed in claim 4, wherein said C
1-C
6Alkyl be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
6. method as claimed in claim 4, wherein R
1Be selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl, isohesyl, phenyl, aminomethyl phenyl or 3,5-dimethylphenyl; R
2, R
3, R
4And R
5Be independently selected from methyl, ethyl, n-pro-pyl, isopropyl, normal-butyl, isobutyl, the tert-butyl group, amyl group, isopentyl, n-hexyl or isohesyl.
7. method as claimed in claim 4, wherein said 5 yuan is the saturated or unsaturated ring structure that contains or do not contain N or S atom to 7 ring structures.
8. method as claimed in claim 4, wherein Y is selected from fluorine, chlorine, bromine, iodine negative ion or triethylamine kation.
9. method as claimed in claim 1 or 2, wherein said damping fluid is selected from tris-HCI buffer, boric acid-borate buffer solution, triethanolamine damping fluid, imidazoles-hydrochloride buffer, glycylglycine damping fluid, 2-amino-2-methyl-1-propanol damping fluid, sodium phosphate-dibastic sodium phosphate damping fluid, barbital sodium-hydrochloride buffer, citric acid-sodium citrate damping fluid, glycocoll-sodium hydrate buffer solution, borax-sodium hydrate buffer solution or sodium phosphate buffer.
10. the method for claim 1, the scope of sodium in the wherein said solution sample/potassium ion ratio are preferably in 0 to 10 scope; The described concentration of dna molecular in the solution sample of different G-four chain body structures that can form respectively in the presence of sodium, potassium ion is in the scope of 0.5 to 30 μ mol/L; The concentration of described cyanine dyes in the solution sample is in the scope of 1 to 30 μ mol/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210553125.8A CN103063629B (en) | 2012-12-18 | 2012-12-18 | Detect the method for sodium/potassium ion ratio and kit and system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210553125.8A CN103063629B (en) | 2012-12-18 | 2012-12-18 | Detect the method for sodium/potassium ion ratio and kit and system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103063629A true CN103063629A (en) | 2013-04-24 |
| CN103063629B CN103063629B (en) | 2016-03-16 |
Family
ID=48106342
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210553125.8A Active CN103063629B (en) | 2012-12-18 | 2012-12-18 | Detect the method for sodium/potassium ion ratio and kit and system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103063629B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107345906A (en) * | 2017-07-31 | 2017-11-14 | 四川大学 | A kind of construction method of encoder and decoder |
| CN107632158A (en) * | 2016-07-18 | 2018-01-26 | 中国科学院化学研究所 | The method and kit of cysteine in determination sample |
| CN110559445A (en) * | 2018-06-04 | 2019-12-13 | 中国科学院化学研究所 | Novel efficient intelligent targeted drug loading system |
| CN111039897A (en) * | 2019-12-26 | 2020-04-21 | 中国科学院化学研究所 | Fluorescent probes and their use in detection of autophagosomes |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7312082B2 (en) * | 2002-04-02 | 2007-12-25 | Cancer Research Technology Limited | Crystal structure of G-quadruplex containing a potassium ion |
| CN101587066A (en) * | 2008-05-23 | 2009-11-25 | 中国科学院化学研究所 | The new purposes of cyanine dyes in detecting G-four serobila structural DNAs |
| US20090305285A1 (en) * | 2008-06-10 | 2009-12-10 | Shenzhen Mindray Bio-Medical Electronics Co., Ltd. | Asymmetric cyanine compounds, their preparation methods and their uses |
| CN102417925A (en) * | 2011-09-07 | 2012-04-18 | 天津希恩思生化科技有限公司 | Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same |
| CN102735623A (en) * | 2012-06-18 | 2012-10-17 | 中国科学院化学研究所 | Potassium ion concentration detection kit and system thereof |
| CN102735664A (en) * | 2012-06-18 | 2012-10-17 | 中国科学院化学研究所 | Potassium ion concentration detection method |
-
2012
- 2012-12-18 CN CN201210553125.8A patent/CN103063629B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7312082B2 (en) * | 2002-04-02 | 2007-12-25 | Cancer Research Technology Limited | Crystal structure of G-quadruplex containing a potassium ion |
| CN101587066A (en) * | 2008-05-23 | 2009-11-25 | 中国科学院化学研究所 | The new purposes of cyanine dyes in detecting G-four serobila structural DNAs |
| US20090305285A1 (en) * | 2008-06-10 | 2009-12-10 | Shenzhen Mindray Bio-Medical Electronics Co., Ltd. | Asymmetric cyanine compounds, their preparation methods and their uses |
| CN102417925A (en) * | 2011-09-07 | 2012-04-18 | 天津希恩思生化科技有限公司 | Reagent for detecting content of potassium ions in blood and preparation method thereof as well as kit containing same |
| CN102735623A (en) * | 2012-06-18 | 2012-10-17 | 中国科学院化学研究所 | Potassium ion concentration detection kit and system thereof |
| CN102735664A (en) * | 2012-06-18 | 2012-10-17 | 中国科学院化学研究所 | Potassium ion concentration detection method |
Non-Patent Citations (5)
| Title |
|---|
| HAIXIA QIN等: "G-Quadruplex-Modulated Fluorescence Detection of Potassium in the Presence of a 3500-Fold Excess of Sodium Ions", 《ANAL.CHEM.》 * |
| HONGXIA SUN等: "Quantification of the Na+/K+ ratio based on the different response of a newly identified G-quadruplex to Na+ and K+", 《CHEM. COMMUN.》 * |
| KONG D M, ET AL: "Fluorescent sensor for monitoring structural changes of G-quadruplexes and detection of potassium ion", 《ANALYTICAL CHEMISTRY》 * |
| 孔德明等: "G-四链体的构型、热稳定性测试及其在钾离子定量检测中的应用", 《化学通报》 * |
| 盖伟等: "一种环境高敏菁染料与平行结构G-四链体的相互作用研究", 《光谱学与光谱分析》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107632158A (en) * | 2016-07-18 | 2018-01-26 | 中国科学院化学研究所 | The method and kit of cysteine in determination sample |
| CN107345906A (en) * | 2017-07-31 | 2017-11-14 | 四川大学 | A kind of construction method of encoder and decoder |
| CN107345906B (en) * | 2017-07-31 | 2019-07-23 | 四川大学 | A kind of construction method of encoder and decoder |
| CN110559445A (en) * | 2018-06-04 | 2019-12-13 | 中国科学院化学研究所 | Novel efficient intelligent targeted drug loading system |
| CN110559445B (en) * | 2018-06-04 | 2021-04-06 | 中国科学院化学研究所 | Targeted drug loading system |
| CN111039897A (en) * | 2019-12-26 | 2020-04-21 | 中国科学院化学研究所 | Fluorescent probes and their use in detection of autophagosomes |
| CN111039897B (en) * | 2019-12-26 | 2023-04-21 | 中国科学院化学研究所 | Fluorescent probes and their use in detection of autophagy lysosomes |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103063629B (en) | 2016-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102735664B (en) | Potassium ion concentration detection method | |
| Zhou et al. | Design principles of spectroscopic probes for biological applications | |
| CN102735623B (en) | Potassium ion concentration detection kit and system thereof | |
| CN102866148B (en) | Potassium ion concentration detection method | |
| CN103048301B (en) | Sodium/potassium ion is than detection method, system and kit | |
| CN103792229B (en) | A kind of plumbum ion concentration detection method and kit | |
| CN104596959A (en) | Method for detecting potassium ion concentration based on DNA enzymes | |
| CN103063629B (en) | Detect the method for sodium/potassium ion ratio and kit and system | |
| CN105131935A (en) | Rapid high-selectivity fluorine ion colorimetric probe and preparation method therefor | |
| CN103698324A (en) | Air formaldehyde self testing kit | |
| CN106442515A (en) | Simple and low-cost silver ion visual quantitative detection method | |
| CN102866149B (en) | Detection kit for potassium ion concentration | |
| WO2013189265A1 (en) | Method, system, and kit for detecting potassium ion concentration | |
| CN105541754B (en) | The preparation method of atriphos near infrared fluorescent probe | |
| CN104132920A (en) | Method for measuring Ag<+> or F<-> through fluorescence quenching | |
| CN105181686A (en) | Method for detecting fluoride ions in environment | |
| CN101464299A (en) | Kalium ion diagnosis/measuring reagent kit and kalium ion concentration determination method | |
| CN100554939C (en) | Serum sodium ion by enzymatic method is measured reagent and method | |
| CN105784699A (en) | Potassium ion reagent with better stability and higher sensitivity and detection method | |
| CN112500382B (en) | Ratiometric fluorescent probe for reversible detection of sulfur dioxide/formaldehyde, preparation method and application | |
| CN110698390B (en) | Fluorescent probe for identifying bisulfite and preparation method and detection method thereof | |
| CN106404734B (en) | The method that silver nanoclusters detect potassium concentration infering diing time in vitreous humor | |
| Tang et al. | Ruthenium bipyridine complexes as electrochemiluminescent transducers for ionophore-based ion-selective detection | |
| CN108169196B (en) | Method for rapidly detecting fluorine ions in environment | |
| CN103115904B (en) | Urine microalbumin detection method, system and test kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |