EP2406392A1

EP2406392A1 - Quantification of nucleic acids

Info

Publication number: EP2406392A1
Application number: EP10707901A
Authority: EP
Inventors: Nan Fang; Andreas Missel; Dirk Löffert
Original assignee: Qiagen GmbH
Current assignee: Qiagen GmbH
Priority date: 2009-03-10
Filing date: 2010-03-09
Publication date: 2012-01-18
Also published as: US20120107813A1; US9587267B2; WO2010103010A1; DE102009012039A1

Abstract

The invention relates to a method for the quantification of one or more nucleic acids in a sample. The method comprises the following steps: making a sample available which contains at least one nucleic acid to be quantified, adding an oligonucleotide probe to the sample, the oligonucleotide probe comprising a sequence which can specifically hybridize to the nucleic acid to be quantified or to a common sequence of the nucleic acids to be quantified, incubating the sample under conditions which allow the hybridization of the oligonucleotide probe to the nucleic acid(s) to be quantified, incubating the sample under conditions which allow the extension of hybridized probes, the nucleic acid(s) serving as a template in each case, removing the non-hybridized probes from the sample and quantifying the hybridized oligonucleotide probes to measure the quantity of the nucleic acid(s) to be quantified. The invention also relates to a kit for carrying out said method.

Description

Quantification of nucleic acids

Technical field of the invention

The present invention relates to the field of biology and chemistry, in particular molecular biology. In detail, the invention relates to the quantification of nucleic acids by means of oligonucleotide probes and gene expression analysis, in particular by means of polymerase chain reaction (PCR).

Background of the invention

Quantification of nucleic acids plays an important role in many molecular biology applications, particularly in gene expression analysis. Gene expression analyzes are used primarily in the fields of basic research, drug research and molecular diagnostics.

In nucleic acid quantification methods, the concentrations and / or relative or absolute amounts of particular nucleic acids in samples are usually determined. In the gene expression analysis, especially the amounts of mRNA and / or cDNA in biological samples are relevant. Northern blot, RNase protection assays, competitive reverse transcription PCR, quantitative reverse transcription PCR (qRT-PCR), microarrays, and high-throughput sequencing techniques. Quantitative reverse transcriptase PCR (qRT-PCR) is most commonly used because of its high specificity, sensitivity, reproducibility and speed. However, the results are influenced by various critical factors, such as the starting amount and integrity of the mRNA, as well as the effectiveness of reverse transcriptase and polymerase. To ensure the comparability of gene expression analyzes in different samples, it is necessary to normalize the amounts determined. Common normalization strategies are based on the expression analysis of so-called housekeeping genes. It is assumed that the expression of the housekeeping genes does not differ in different samples. However, this assumption is incorrect. Other normalization methods rely on the determination of total RNA in the sample, sample size (cell count or tissue volume), or incorporated Frander RNA. However, all these approaches have their disadvantages. For example, ribosomal RNA makes up a majority of the total RNA in a cell. Therefore, the total amount of RNA is not always representative of the total amount of mRNA. Normalization methods based on cell number or tissue volume do not consider that different cells may have different transcriptional activities. In addition, these methods do not consider the mRN A quality and the effectiveness of reverse transcriptase and polymerase. Although foreign RNA introduced into the sample takes into account the enzyme efficiency during the reverse transcription PCR, it does not take into account the amount and quality of the initial mRN A in the sample.

Description of the invention

The present invention relates to a quantification method for nucleic acids, which can be used in particular for gene expression analysis. In the quantification method according to the invention, both the amount and quality of the nucleic acids used and the effectiveness of the subsequent enzyme reactions can be taken into account. The method according to the invention can also be used for normalization in the quantification of specific nucleic acids.

In the method according to the invention, an exogenous oligonucleotide probe is added to a sample which contains the nucleic acid (s) to be quantified. This exogenous oligonucleotide probe comprises a nucleic acid sequence which is not present in the sample but can specifically bind to the nucleic acid (s) to be quantified. The hybridized oligonucleotide probe is elongated (extended) by means of a polymerase, wherein the nucleic acid to be quantified, to which the probe is hybridized, acts as a template. After hybridization and extension of the probe, the originally unhybridized and therefore non-elongated probes are removed from the sample so that only those probes which hybridize to the nucleic acid (s) to be quantified and are therefore prolonged remain in the sample. The oligonucleotide probes may also contain further sequences in addition to the sequences used for hybridization to the nucleic acid (s) to be quantified ("hybridization sequence") .Such additional sequences may be, for example, quantification of the elongated probes in a PCR reaction ("Tag Sequence"). The tag sequence is preferably located 5 'to the hybridization sequence.

The present invention therefore relates to a method for quantifying one or more nucleic acids in a sample, comprising the following steps:

Providing a sample containing at least one nucleic acid to be quantified,

Addition of an oligonucleotide probe to the sample, wherein the oligonucleotide probe comprises a sequence which can hybridize specifically to the nucleic acid to be quantified or to a common sequence of the nucleic acids to be quantified,

Incubation under conditions allowing the hybridization of the oligonucleotide probe to the nucleic acid (s) to be quantified,

Incubation of the sample under conditions which allow the extension of hybridized probes, wherein in each case the nucleic acid (s) to be quantified serve as template,

Removal of non-hybridized probes from the sample,

Quantification of the hybridized oligonucleotide probes as a measure of the amount of nucleic acid (s) to be quantified.

Preferably, extension takes place by means of a polymerase, i. the sample is incubated with a polymerase under conditions allowing extension of hybridized probes. Preferably, therefore, the extension of hybridized probes takes place by means of a polymerase.

In the method according to the invention, only the probes which have hybridized to another nucleic acid and have been elongated are quantified. They are therefore a measure of the amount of nucleic acid to be quantified. Depending on the sequence of the probe, only certain nucleic acids or whole groups of nucleic acids containing a sequence substantially complementary to the probe are quantified. Preferably, the sequence of the probe is at least 85%, 90% and most preferably more than 95% complementary to a sequence on the nucleic acid (s) to be quantified.

The unhybridized or non-elongated probes are removed from the sample prior to quantification of the hybridized oligonucleotide probes. This can be achieved, for example, by enzymatic see reactions (eg, nuclease degradation), chemical reactions, heat or physical processes, such as chromatographic or electrophoretic methods take place.

The removal of the unhybridized probes preferably takes place by means of a nuclea se which can specifically degrade single-stranded nucleic acids. The nuclease is preferably an exonuclease. The exonuclease is preferably selected from the group of exonuclease I, Sl nuclease, lambda exonuclease and exonuclease VII.

Oligonucleotides are oligoterries composed of a few nucleotides, ie they are short, preferably single-stranded, nucleic acids. Preferably, the oligonucleotides have a length of 10-200 nucleotides, preferably 30-100 nucleotides, preferably 70-90 nucleotides.

The oligonucleotide probe is a single-stranded oligonucleotide. It is preferably selected from the group of DNA, RNA, PNA and LNA. In any case, the oligonucleotide probe must be a nucleic acid that can be extended to be complementary to the template. Preferably, the oligonucleotide probe is a DNA oligonucleotide.

The oligonucleotide probe may also contain modified nucleobases and / or modified linkers.

In a particular embodiment of the method according to the invention, at least two nucleic acids are quantified and the quantified amounts of at least two nucleic acids are related to one another. This can e.g. by using different oligonucleotide probes containing different hybridization sequences and tag sequences.

The nucleic acid (s) to be quantified are / are preferably RNA (s) or DNA (s). The nucleic acid (s) to be quantified may, for example, be a nucleic acid (1) selected from the group of cDNA (complementary DNA), LNA (locked nucleic acid), mRNA (mRNA), mtRNA (mitochondrial RNA), rRNA (ribosomal RNA), tRNA (transfer RNA), nRNA (nuclear RNA), siRNA (short interfering RNA), snRNA (small nuclear RNA), snoRNA (small nucleolar RNA), scaRNA (Small Cajal Body-specific RNA), microRNA, dsRNA (double-stranded RNA), ribozymes, riboswitches, viral RNA, dsDNA (double-stranded DNA), ssDNA (single-stranded DNA), plasmid DNA, cosmid DNA, chromosomal DNA, viral DNA, mtDNA (mitochondrial DNA), nDNA (nuclear DNA) ₃ snDNA (small nuclear DNA). The nucleic acid (s) to be quantified can also be the entirety of a group of nucleic acids, preferably the entirety of mRNA in the sample ("total mRNA") or the entirety of cDNA in the sample ("total cDNA").

In a preferred embodiment of the method according to the invention, the nucleic acid (s) to be quantified are / are mRNA (s) or cDNA (s).

The common sequence of the nucleic acid (s) to be quantified may be e.g. be a poly-A sequence, e.g. the Poyl A tail of mRNA. In the case of cDNA, the common sequence is preferably poly-dT.

It is particularly preferred that the nucleic acid (s) to be quantified is / are mRNA and the common sequence is a poly A sequence.

It is further preferred that the nucleic acid (s) to be quantified is cDNA and the common sequence is a poly-dT sequence.

In order to be able to hybridize to poly-A or poly-dT sequences, the oligonucleotide probe must contain a poly-T or poly-dT or poly-A or poly-dA sequence.

Therefore, in one embodiment, it is preferred that the oligonucleotide probe contain a poly-T or poly-dT sequence.

In another embodiment, it is preferred that the oligonucleotide probe contain a poly A or poly d A sequence.

The poly-dT, poly-T, poly-dA or poly-A sequences are preferably located at the 3 'end of the oligonucleotide probe. Preferably, the poly-dT, poly-T, poly-dA, or poly-I sequences are between 8 and 10 nucleotides in length, more preferably between 10 and 20.

As described above, in a preferred embodiment, the oligonucleotide probe contains a tag sequence. Particularly preferred tag sequences are sequences that are not Have homology in eukaryotic genomes.

The quantification of the hybridized oligonucleotide probe is preferably carried out by means of quantitative PCR. For this, e.g. the quantification of the tag sequence was carried out by quantitative PCR.

The oligonucleotide probe can serve as a primer for reverse transcription of mRNA to cDNA in an RT-PCR. The resulting cDNA can be quantified by quantitative PCR (qPCR).

If the nucleic acid to be quantified is a DNA, the quantification of the hybridized probe can take place directly via a qPCR.

The DNA polymerase used during the quantitative (real-time) PCR is preferably a polymerase from a thermophilic organism or is a thermostable polymerase or is a polymerase selected from the group of Thermus thermophilus (Tth) DNA polymerase , Thermus acquaticus (Taq) DNA polymerase, Thermotoga marimima (Tma) DNA polymerase, Thermococcus litoralis (TIi) DNA polymerase, Pyrococcus furiosus (Pfu) DNA polymerase, Pyrococcus woesei (Pwo) DNA polymerase, Pyrococcus kodakaraensis KOD DNA polymerase, Thermus filiformis (Tfi) DNA polymerase, Sulfolobus solfataricus Dpo4 DNA polymerase, Thermus pacificus (Tpac) DNA polymerase, Thermus eggertsonii (Teg) DNA polymerase, Thermiis brockianus (Tbr) and Thermus flavus (TfI) DNA polymerase.

In case the RNA, for example mRNA, is to be quantified, the RNA has to be reverse transcribed in DNA. This is done with an enzyme with reverse transcriptase activity. Such enzymes may be, for example, reverse transcriptases from viruses, bacteria, Archae bacteria and eukaryotes, in particular from thermostable organisms. These include, for example, enzymes from introns, retrotransposons or retroviruses. According to the invention, an enzyme with reverse transcriptase activity is an enzyme which is able to incorporate deoxyribonucleotides complementary to ribonucleic acid at the 3 'end of a deoxyoligonucleotide or ribo-oligonucleotide hybridized to the ribonucleic acid hybridase under suitable buffer conditions. This includes, on the one hand, enzymes which naturally have this function, but also enzymes which only have such a function obtained by altering their gene sequence such as mutagenesis or by appropriate buffer conditions.

Preferably, the enzyme having reverse transcriptase activity is an enzyme selected from the group consisting of HIV reverse transcriptase, M-MLV reverse transcriptase, EAIV reverse transcriptase, AMV reverse transcriptase, Thermite thermophilus DNA polymerase I, M-MLV RNAse H, Superscript, Superscript II, Superscript III, Monsterscript (Epicenter), Omniscript, Sensiscript Reverse Transcriptase (Qiagen), TheraioScript and Thermo-X (both Invitrogen). According to the invention, it is also possible to use enzymes which have reverse transcriptase activity as enzyme only after a modification of the gene sequence. It is also possible to use a reverse transcriptase activity which has an increased error accuracy. By way of example, here is e.g. AccuScript reverse transcriptase (Stratagene) mentioned. It will be apparent to those skilled in the art that the use of mixtures of two or more enzymes with reverse transcriptase activity is also possible.

It is known to those skilled in the art that most enzymes with reverse transcriptase activity require a divalent ion. Thus, in a preferred embodiment, a divalent ion is present in those enzymes which require a divalent ion. Preferred are Mg ²⁺ , Mn ²⁺ .

Preferred combinations of enzymes are HIV reverse transcriptase or M-MLV reverse transcriptase or EAIV reverse transcriptase or AMV reverse transcriptase or Thennus thermophilus DNA polymerase I or M-MLV RNAse H, Superscript, Superscript II, Superscript III or Monsterscript (Epicenter) or Omniscript reverse Transcriptase (Qiagen) or Sensiscript reverse transcriptase (Qiagen), ThermoScript, Thermo-X (both Invitrogen) or a mixture of two or more enzymes with reverse transcriptase activity and poly (A) -PoI ymerase from Escherichia coli. Also, HIV reverse transcriptase or M-MLV reverse transcriptase or EAIV reverse transcriptase or AMV reverse transcriptase or Thermite thermophilus DNA polymerase I or M-MLV RNAse H, Superscript, Superscript II, Superscript III or Monsterscript (Epicenter) or Omniscript reverse transcriptase (Qiagen) or Sensiscript reverse transcriptase (Qiagen), ThermoScript, Thermo-X (both Invitrogen) or a mixture of two or more enzymes with reverse transcriptase activity and yeast poly (A) polymerase. Fluorescence-labeled primers and / or probes can be used in the quantitative (real-time) PCR, eg LightCycler probes (Roche), TaqMan probes (Roche), Molecular heacons, Scorpion primers, Sunrise primers, LUX primers or Amplifluor primers. For example, probes and / or primers can be covalently or non-covalently bound fluorescent dyes such as fluorescein isothiocyanates (FITC), 6-carboxyfluorescein (FAM), xanthene, rhodamines,, 6-carboxy-2 ', 4', 7 ', 4,7- hexachlorofluorescein (HEX), 6-carboxy-4 ', 5'-dichloro-2 \ 7'-dimethylyfluorescein (JOE), N, N, N \ N'-tetramethyl-6-carboxy rhodamate (TAMRA), 6-carboxy-X -rhodamine (ROX), 5-carboxyhodamine-6G (R6G5), 6-carboxyrhodamine-6G (RG6), Rhodamine 110; Coumarins such as umbelliferones, benzimides such as Hoechst 33258; Phenanthridines such as Texas Red, ethidium bromides, acridine dyes, carbazole dyes, phenoxazine dyes, polypyridine dyes, polymethine dyes, cyanine dyes such as Cy3, Cy5, Cy7, BODIPY dyes, quinoline dyes, and Alexa dyes.

The skilled worker is aware of the suitable conditions for a quantitative PCR or a quantitative reverse transcription PCR. This concerns e.g. the primer design, the choice of suitable processing temperatures (reverse transcription, denaturation, primer annealing, elongation), the number of PCR cycles, the buffer conditions. Reverse transcription and

In addition to the PCR, other amplification methods may also be used; these may be selected from the group comprising the rolling circle amplification (as described in Liu, et al., Rolling circle DNA synthesis: Small circular oligonucleotides as efficient templates for DNA polymerases, J. Am. Chem. Soc. 118: 1587-1594 (1996)), the "isothermal amplification" (as described in Walker, et al., "Strand displacement amplification ~ at isothermal, in vitro DNA amplification technique, "Nucleic Acids Res. 20 (7): 1691-6 (1992)), the" ligase chain reaction "(as described in Landegren, et al.," A Ligase Mediated Gene Detection Technique, "Science 241: 1077-1080, 1988, or in Wiedmann, et al., "Ligase Chain Reaction (LCR) Review and Applications," PCR Methods and Applications (CoId Spring Harbor Laboratory Press, Colden Spring Harbor Laboratory, NY, 1994) pp S51-S64.). However, the polymerase chain reaction (PCR) is preferred.

The invention also relates to a kit for nucleic acid quantification, comprising: at least one nuclease, preferably exonuclease, optionally dNTPs (preferably as a solution of a mixture of dCTP, dATP, dGTP and dTTP (eg in each case 5 mM, "dNTP Mix"),

optionally a buffer solution or a buffer stock solution,

a DNA polymerase

optionally a reverse transcriptase, an oligonucleotide probe, wherein the oligonucleotide probe comprises a tag sequence and a sequence which can hybridize specifically to the nucleic acid to be quantified or to a common sequence of the nucleic acids to be quantified,

Primer and / or a second oligonucleotide probe capable of hybridizing to the tag sequence.

For the polymerases, reverse transcriptases, oligonucleotide probes and primers of the kit according to the invention, the method described above for the method according to the invention applies.

The kits and methods of the invention can be used to analyze gene expression in a biological sample.

sequences

SEQ ID NO: 1: OligoAmp 5 '-

CACCACGTAAGACATAAAACGGCCACATAACTTGGCTTTAATGGACCTCCAATTTGAGTGT GGTGCCATGTAAGGATGAATGTTTTTTTTTTTTTTTTT-S '

SEQ ID NO: 2: AmpliF, forward primer for the amplification of oligoamp

5'-CACCACGTAAGACATAAAACGG-3 '

SEQ ID NO: 3: AmpliR, reverse primer for amplification of oligoamp

5'-ACATTCATCCTTACATGGCACCA-B '

Description of the figures

FIG. 1a: Quantification of the oligoAmp oligos by qPCR, after reverse transcription and exol digestion. Amplification plot.

FIG. 1b: Quantification of the oligoAmp oligos by qPCR, after reverse transcription and exol digestion. Diagram Ct values against RNA levels in RT.

FIG. 2: Quantification of the oligoAmp oligos by qPCR, after reverse transcription, without exol digestion. Amplification plot.

Fig. 3a: Quantification of the endogenous TBP gene by qPCR, after reverse transcription and exol digestion. Amplification plot.

FIG. 3b: Quantification of the endogenous TBP gene by qPCR, after reverse transcription and exol digestion. Diagram Ct values against RNA levels in RT Examples

example 1

Reverse transcriptase reactions were performed using the omniscript (Qiagen) according to the manufacturer's instructions. The reverse transcriptase reactions contained the following components: total RNA of Ramos human Burkitt's lymphoma cells as template (1 μg, 500 ng, 250ng, 125 ng and 0 ng); Oligonucleotides oligoAmp (0.1 nM final concentration) with the nucleotide sequence SEQ ID NO: 1 as a reverse transcriptase primer; Reverse transcriptase omniscript; dNTPs, RNase inhibitor; Reverse transcriptase buffer and RNase-free water. The sequence of OligoAmp comes from the potato genome and has no homologue in the human genome.

18 μl of each reverse transcription product was then spiked with 2 μl exonuclease I (20 U / μl, Epicenter) or water (control treated as non-exonuclease) and for

Exposed for 60 minutes at 37 ⁰ C digestion. After digestion, exonuclease I was added

95 ⁰ C inactivated for 10 minutes. 2 μl of each exonuclease I reaction mixture or the

Template-free controls were mixed with QuantiFast SYBR Green Mix (Qiagen) and specific Primera to quantify the undigested oligoAmps. The sequences of the primers used in the qPCR, AmpliF and AmpliR, are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

It can be seen from the amplification plot in Fig. Ia and Table 1 that after reverse transcription and exonuclease treatment, different amounts of remaining oligo-Amp were detected and quantified. As expected, larger amounts of oligoAmp were protected from exonuclease degradation in the reactions with higher starting RNA levels and thus remained undigested. This is reflected in lower Ct values in the qPCR. The Ct values and the logarithm of the starting RNA amount show a good linear correlation.

Table 1: Quantification of OligoAmp Oligos by qPCR, after Reversing Tanscription and Exol Digestion. Summary of Ct values.

In contrast to the reverse transcription products treated with exonuclease I, the oligoamp oligonucleotides in the water control samples were all detected with similar Ct values, regardless of the starting RNA level (see Figure 2, Table T).

Table 2: Quantification of OligoAmp Oligos by qPCR, after reverse transcription, without exol digestion. Summary of Ct values.

In the same reverse transcriptase reaction endogenous genes could be reverse transcribed with high confidence and later quantified using qPCR. This is shown in FIGS. 3a and 3b and in table 3.

Table 3: Quantification of the endogenous TBP gene by qPCR, after reverse transcription and exol digestion. Summary of Ct values.

The Exonukϊease I treated reverse transcription products were used as template in the SyBr green-based qPCR (QuantiFast SyBr Green, Qiagen). TBP specific cDNA primers were used for amplification in the qPCR.

The available data show that the quantification method can be used in the normalization strategy by means of mRNA-binding, nuclease-resistant exogenous oligonucleotides in order to check the starting mRNA quantity as well as the efficiency of the reverse transcription and the PCR.

Claims

claims

1. A method for quantifying one or more nucleic acids in a sample, comprising the following steps: providing a sample containing at least one nucleic acid to be quantified,

Incubation under conditions which allow the hybridization of the oligonucleotide probe to the nucleic acid (s) to be quantified,

Incubation of the sample under conditions permitting the extension of hybridized probes, each of the nucleic acids to be quantified serving as template,

Removal of unhybridized probes from the sample,

2. The method of claim 1, wherein the extension of hybridized probes by means of a polymerase takes place.

3. The method of claims 1 and 2, wherein the removal of the non-hybridized probes is done by means of a nuclease, which can specifically degrade single-stranded nucleic acids.

The method of claim 3, wherein the nuclease is an exonuclease.

5. The method of claim 4, wherein the exonuclease is selected from the group of exonuclease I, Sl nuclease, lambda exonuclease and exonuclease VII.

6. The method of claim 1 to 5, wherein the oligonucleotide probe is a single-stranded Oligonucleotide is selected from the group of DNA, RNA, PNA and LNA.

7. The method of claim 6, wherein the oligonucleotide probe contains modified nucleobases and / or modified linkers.

8. The method according to any one of the preceding claims, wherein at least two nucleic acids are quantified and the quantified amounts of at least two nucleic acids are related to each other.

9. The method according to claim 1 to 8, wherein the nucleic acid (s) to be quantified are RNA (s) or DNA (s).

10. The method according to claim 9, wherein the RNA (s) to be quantified are mRNA (s) and the DNA (s) to be quantified are cDNA (s).

11. The process of claim 10, wherein the RNAs to be quantitated are mRNAs and the common sequence is a poly A sequence.

12. The method of claim 10, wherein the DNAs to be quantified are cDNAs and the common sequence is a poly-dT sequence.

13. The method of claim 11, wherein the oligonucleotide probe contains a poly-T or poly-dT sequence.

14. The method of claim 12, wherein the oligonucleotide probe contains a poly A or poly dA sequence.

15. Verfaliren according to claim 1 to 14, wherein the oligonucleotide probe contains a tag sequence.

16. The method according to claim 1 to 15, wherein the quantification of the hybridized oligonucleotide probe is carried out by quantitative PCR.

17. The method of claim 16, wherein the quantification of the tag sequence means quantitative PCR is performed.

18. The method of claim 16, wherein the oligonucleotide probe serves as a primer for the reverse transcription of mRNA to cDNA in an RT-PCR.

19. The method of claim 1 to 18, wherein the oligonucleotide probe contains a fluorescent dye.

20. Kit for nucleic acid quantification comprising: nuclease, preferably exonuclease,

- dNTPs,

- buffers,

Polymerase, e.g. Reverse transcriptase,

An oligonucleotide probe, wherein the oligonucleotide probe comprises a tag sequence and a sequence which can hybridize specifically to the nucleic acid to be quantified or to a common sequence of the nucleic acids to be quantified,

21. Use of the method according to any one of claims 1 to 19 or the kit according to claim 20 for the analysis of gene expression in a biological sample.