WO1993025677A1

WO1993025677A1 - DNA SEQUENCES ENCODING THE HUMAN A1, A2a and A2b ADENOSINE RECEPTORS

Info

Publication number: WO1993025677A1
Application number: PCT/AU1993/000277
Authority: WO
Inventors: Kerrie Diane Pierce; Constance Andrea Townsend-Nicholson; John Shine; Timothy Furlong; Lisa Selbie
Original assignee: Garvan Institute Of Medical Research
Priority date: 1992-06-12
Filing date: 1993-06-11
Publication date: 1993-12-23
Also published as: JPH08500967A; EP0644935A1

Abstract

The present invention relates to DNA sequences encoding the human A1, A2a and A2b adenosine receptors. In addition, the present invention relates to the use of these DNA sequences in the production of human A1, A2a and A2b adenosine receptors using recombinant DNA technology.

Description

DNA Sequences Encoding the Human Al, A2a and A2b Adenosine Receptors Field-of the Invention

The present invention relates to DNA sequences encoding the human Al, A2a and A2b adenosine receptors. In addition, the present invention relates to the use of these DNA sequences in the production of the human Al, A2a and A2b adenosine receptors using recombinant DNA technology. Background of the Invention

Adenosine influences cardiovascular function (by- slowing heart rate and decreasing blood pressure) and also influences nervous system function (through sedative and anti-epileptic effects). In addition, adenosine can induce bronchoconstriction. Adenosine binds specifically to at least three receptors, Al and A2a and A2b. Adenosine receptors have been shown to couple to a number of second messenger systems. Additional adenosine receptor subtypes may exist. As adenosine receptor agonists and antagonists may have commercial value as anti-hypertensive agents, hypnotics, anti-psychotics c d bronchodilators, the ability to produce adenosine receptors by recombinant DNA technology is advantageous. The present inventors have isolated three related cDNA fragments encoding the human Al, A2a and A2b adenosine receptors from human hippocampal cDNA by using either the. polymerase chain reaction and unique degenerate oligonucleotides to generate specific probes or by using specific consensus oligonucleotide probes for cDNA library screening. Full-length cDNA clones for each of the three receptors were isolated from a human hippocampal cDNA library. The receptor sequences were identified as the human Al, A2a and A2b adenosine receptors by expression in mammalian cells and both measurement of the affinity of the encoded receptors for various adenosine analogues and

SUBSTITUTE SHEET the effect of receptor activation on cAMP synthesis. The receptors have homology to cDNA's encoding the dog Al and A2a adenosine receptors (MAENHAUT, C, VAN SANDE, J., LIBERT, F., ADRAMO IC, . , PARMENTIER, M., VANDERHAEGEN, J. , DUMONT, D. , VASSART, G. AND

SCHIFFMANN, S. (1990); LIBERT, F., SCHUFFMANN, S.M., LEFORT, A., PARMENTIER, M. , GERARD, C, DUMONT, J.E., VANDERHAEGHEN J.J., VASSART, G. (1991)) and the rat A2b adenosine receptor (STEHLE, J.H., RIVKEES, S.A., LEE, J.J., WEAVER, D.R., DEEDS, J.D. AND REPPERT, S.M.

(1992)). These hippocampal cDNA sequences represent novel human receptors which may be of clinical and commercial importance. Summary of the Invention Accordingly, in a first aspect the present invention consists in a DNA molecule encoding the human Al adenosine receptor, the DNA molecule having a sequence substantially as shown in Figure 1 or a functionally equivalent sequence. In a second aspect the present invention consists in a DNA molecule encoding the human A2a receptor subtype, the DNA molecule having a sequence substantially as shown in Figure 2 or a functionally equivalent sequence.

In a third aspect the present invention consists in a DNA molecule encoding the human A2b adenosine receptor subtype, the DNA molecule having a sequence substantially as shown in Figure 3 or a functionally equivalent sequence.

As used herein the term "functionally equivalent sequence" is intended to cover variations in the DNA sequence which, due to degeneracy of the DNA code, do not result in the sequence encoding a different polypeptide. Further, this term is intended to cover alterations in the DNA code which lead to changes in the encoded polypeptide, but in which such changes do not affect the biological activity of the polypeptide. As used herein the term "DNA molecule" is intended to

SUBSTITUTE SHEET cover both genomic DNA and cDNA.

In a fourth aspect the present invention consists in a method of producing the human Al adenosine receptor comprising culturing a cell transformed with the DNA molecule of the first aspect of the present invention under conditions which allow expression of the DNA sequence such that the human Al adenosine receptor is expressed on the cell surface and optionally recovering the human Al adenosine receptor. In a fifth aspect the present invention consists of a method of producing a human A2a adenosine receptor comprising culturing a cell transformed with the DNA molecule of the second aspect of the present invention under conditions which allow expression of the DNA sequence such that the human A2 adenosine receptor is expressed on the cell surface and optionally recovering the human A2a adenosine receptor.

In a sixth aspect the present invention consists of a method of producing a human A2b adenosine receptor comprising culturing a cell transformed with the DNA molecule of the third aspect of the present invention under conditions which allow expression of the DNA sequence such that the human A2 adenosine receptor is expressed on the cell surface and optionally recovering the human A2b adenosine receptor.

In further aspects the present invention consists of a method of screening a molecule for adenosine agonist or antagonist activity, comprising contacting the molecule with the human Al, A2a or A2b adenosine receptors produced by the method of the fourth, fifth or sixth aspect of the present invention.

In yet a further aspect the present invention consists in oligonucleotides 305, 377 and 376 as hereinafter described. The DNA molecules of the present invention represent

SUBSTITUTE SHEET novel human receptors. These receptors may be of interest both clinically and commercially as they are expressed in many regions of the body and as adenosine affects a wide number of systems. The isolated full-length DNA clones containing the complete coding region for these receptors can be used to establish mammalian cell lines producing the receptors for use in agonist and antagonist screening. The receptor DNA sequence can be used for additional homology screening to identify novel members of this receptor family.

In order that the nature of the present invention may be more clearly understood preferred forms thereof will now be described with reference to the following examples and figures in which:- Figure 1 shows the nucleotide and amino acid sequence of the human Al adenosine receptor cDNA.

Figure 2 shows the nucleotide and amino acid sequence of the human A2a adenosine receptor cDNA.

Figure 3 shows the nucleotide and amino acid sequence of the human A2b adenosine receptor cDNA.

Figure 4A shows saturation isotherms of the total (unfilled triangle), specific (filled circle) and non-specific (unfilled square) binding of the Al adenosine receptor antagonist DPCPX (8-cyclopentyl-l,3 dipropylxanthine) to mammalian CHO.Kl cells expressing the human Al adenosine receptor.

Figure 4B shows competition binding curves showing the displacement of CGS-21680 2-p-(2-Carboxyethyl)phenethylamino-5'-N-ethylcarboxyamido adenosine hydrochloride) by different adenosine agonists and antagonists (NECA = 5'-N-ethylcarboxamido adenosine; CA=2-chloroadenosine; CPA=N -cyclopentyladenosine; XAC=xanthine amine congener; T=8-(p-sulphophenyl)- theophylline) in mammalian HEK 293 cells expressing the human A2a adenosine receptor.

SUBSTITUTE SHEET Figure 5 shows the effects of the different adenosine receptor subtypes, Al, A2a and A2b upon cyclic AMP production. Al adenosine receptor activation leads to inhibition of forskolin stimulated cAMP levels. Activation of both the A2a and A2b adenosine receptors (by CGS-21680 and NECA, respectively) leads to stimulation of cAMP levels. METHODS Oliσonucleotide Design and Synthesis Unique degenerate oligonucleotides corresponding to the transmembrane II (TM II) and IV (TM IV) regions of G protein-coupled receptors and containing either a 5' EcoRI restriction enzyme site (TM II oligonucleotide 377) or a 3' Hind III restriction enzyme site (TM IV oligonucleotides 305 and 376) were synthesized on an Applied Biosystems automated DNA synthesiser. The sequences of the oligonucleotides are as follows:-

305 5' - CCCAATAAGCTTAGICCIATGGCGAAAGACAGGACCCA-3' A A G G C

A A

376 5' - GAGTCCGAAGCTTAGTGGGCAAGAGATGGCGAAIGAIAGIACCA-3'

G TA C A G T A

377 5' - CAGAACGAATTCAATGTTTTTATGTGGTCTTTGTCITCIACTGA-3'

C G G G G G C

A

The DNA sequences included inosine (I) residues. Crude oligonucleotides were then used in the polymerase chain reaction. PCR Amplification Sequences homologous to the G protein-coupled

SUBSTITUTE SHEET receptor oligonucleotides were amplified from human cDNA using PCR and the Hybaid thermocycler. DNA was prepared from a human neuroblastoma (Clontech) cDNA library in lambda gtlO and from a hippocampal (Stratagene) cDNA library in lambda ZapII. DNA was prepared by phenol and o chloroform extraction of approximately 10 library phage and ethanol precipitation to recover the DNA. DNA from the cDNA libraries (l-5μg) was incubated with 200μM of each dNTP, 0.5μM oligonucleotide, 0.5 units Tth enzyme (Toyobo) in 50mM KCl, 50mM Tris-HCl pH9.0, 1.5mM MgCl₂

(1 x PCR buffer) in a 50μL reaction volume. Samples were layered with 50μL light mineral oil (Sigma). Reactions were denatured for 5 minutes at 95 C. The PCR conditions were as follows: Denaturation for 2 minutes at 92°C, annealing for 2 minutes at 55°C, and extension for 2 minutes at 92°C, 2 minutes at 50°C, and 2 minutes at 70°C, repeated five times; then 2 minutes at 95°C, 2 minutes at 45°C, and 2 minutes at 70°C, repeated thirty times. Subcloning and Sequencing of Amplified DNA Fragments

Amplified DNA (20μl) was removed and analysed by gel electropheresis in 1% agarose and 3% NuSieve (SeaKem) . Amplification products 260bp-330bp in length were excised from the gel and purified with Geneclean. DNA fragments were then digested with Hind III for one hour at 37°C and EcoRI for one hour at 37°C, the DNA again purified with Geneclean and eluted into 10μl H₂0. Digested DNA fragments were then subcloned into M13mpl9 and sequenced by the Sanger dideoxy chain-termination method using the Pharmacia or the

Promega DNA sequencing kit. Sequencing reactions were analysed on a 6% acrylamide, 7M urea gel, dried onto Whatman 3M paper, and exposed to X-ray film for sixteen hours (Kodak X-OMAT AR5) at room temperature overnight. Sequence Analysis of Novel DNA Sequences

SUBSTITUTE SHEET Sequence analysis of the DNA fragments generated from the PCR amplification identified two DNA fragments that had sequences common to other known G protein-coupled receptors. PCR amplification of neuroblastoma cDNA with thftidegenerate oligonucleotides 377 and 305 produced a cDNAirfsragment which was designated 3.1. PCR amplification of hums_ft hippocampal cDNA with the degenerate oligonucleotides 377 and 376 produced a cDNA fragment with a sequence that was 76% homologous at the nucleotide level to sequence 3.1 and was designated 3.2 The DNA sequences were searched on the GenBank and EMBL databases for comparison to known sequences and were confirmed to be novel sequences with a high level of homology to dog adenosine Al and A2 receptors. Isolation of Full-Length cDNA Clones

Full-length cDNA clones encoding the Al receptor as well as receptor sequences corresponding to 3.1 and 3.2 were isolated from a human hippocampal cDNA library (Stratagene) . Al adenosine receptor cDNA isolation

Specific consensus oligonucleotides corresponding to the second extracellular loop (679) and to the third intracellular loop (678) were synthesised on an Applied Biosystems automated DNA synthesiser. The sequences of the oligonucleotides are as follows:-

678 5 - CCCGTAGTACTTCTGCGGGTCGCCAGAGGAGGCGACACCTTCTTGCC-3'

679 5'-GAGGCGCAGCGGGCCTGGGCGGCCAACGGCAGCGGCGGCGAGCCCGTG-3' Approximately 5 x 10 plaques were plated on C600

HflA bacterial cells. Plaques were lifted on to

Hybond-N+nylon filters (0.45μM, 137mm, Amersham) . DNA was denatured on the filters with a 3 minute incubation on

0.5 M NaOH, 1.5M NaCl and neutralised with a 5 minute incubation in 0.5M Tris pH72, ImM EDTA and 1.5M NaCl. DNA

SUBSTITUTE SHEET was fixed to the filters with a 15 minute exposure to 0.4M NaOH. Filters were then rinsed in 2 x SSC (3M NaCl, 0.3M sodiuih citrate) and allowed to dry before a 30 minute prehybridisation in 40% formamide, 5 x SSC, 5 x Denhardt's, 50mM NaPO., 0.5% sodium dodecyl sulphate (SDS), O.lmg/ml salmon sperm DNA at room temperature. Oligonucleotides 678 and 679 were pooled and 50 pmoles total were radiolabelled using γ T>-ATP and the DNA 5' end-labelling system (Promega) . The filters were hybridised with this radiolabelled probe overnight at 42°C, after which time they were washed once briefly in 2 x SSC at room temperature then twice for 10 minutes each wash in 2 x SSC, 0.1SDS at room temperature with a final wash in 0.1 x SSC, 0.1%SDS for 15 minutes at 50°C. The filters were then exposed to Kodak X-0MAT AR5 film overnight at -70 C. Over twenty pure phage isolates which hybridised to the radiolabelled 678 and 679 oligonucleotides were obtained. Several of these different cDNAs were sequenced. The sequence of one such cDNA (together with the deduced amino acid sequence) which encodes the human Al adenosine receptor is shown in Figure 1. A2a and A2b adenosine receptor cDNA isolation

Approximately 1 x 10 plaques were plated OJJ C600HflA bacterial cells. Plaques were lifted onto

Hybond-N nylon filters (0.45μM, 137mm, Amersham) . DNA was denatured on the filters with a 3 minute incubation on 0.5M NaOH, 1.5M NaCl and neutralised with a 7 minute incubation in 0.5M Tris pH 7.2, ImM EDTA and 1.5M NaCl. Filters were rinsed in 2 x SSC (20 x SSC is 3M NaCl, 0.3M sodium citrate) and DNA fixed to the filters with a 5 minute exposure to ultraviolet light (312nm). Filters were prehybridied in 5 x SSPE (5 x SSPE=0.5M NaCl, 0.05M NaH₂P0₄, 0.0005M EDTA, pH 7.7), 5 x Denhardt's (0.1% (w/v) bovine serum albumin, 0.1% (w/v) Ficoll, 0.1% (w/v)

SUBSTITUTE SHEET polyvinylpyrollidone) , 0.5% sodium dodecyl sulphate (SDS), 0.2mg/ml salmon sperm DNA at 65°C for 17 hours. The filters were hybridised with a radiolabelled probe corresponding to the PCR amplified DNA fragment encoding the 300 bp of 3.1 (labelled with (o-³²P)-dCTP using the random primers DNA labelling system (Bethesda Research Laboratories)). Following hybridisation of the radiolabelled probe for 20 hours at 65°C, filters were washed with 2 x SSPE, 0.1% SDS at room temperature for 10 minutes, then with 1 x SSPE, 0.1% SDS at room temperature for 10 minutes and exposed to Kodak X-0MAT AR5 film for seven days at -70°C. Two pure phage isolates were hybridised to the radiolabelled 3.1 DNA fragment were obtained. The two DNA inserts were excised form the phage vector using EcoRI digestion and subcloned into M13mpl9 for sequencing. Sequence analysis indicated that one cDNA insert of approximately 2.6 kilobases encoded the full-length clone for the 3.2 receptor. The sequence of the cDNA (together with the putative amino acid sequence) insert encoding the 3.1 receptor (the human A2a adenosine receptor) is shown in Figure 2 (together with the deduced amino acid sequence of the human A2a adenosine receptor) whilst the sequence of the cDNA insert encoding the 3.2 receptor (the human A2b adenosine receptor) is shown in Figure 3 (together with the deduced amino acid sequence) . Expression of the cloned Al_f A2a and A2b adenosine receptors in mammalian cells

Each cloned full-length cDNA was subcloned into a mammalian cell expression vector (pcDNAlneo for A2a and A2b and pRc/CMV for Al (Invitrogen)) in such a way as to direct expression of the encoded receptor portion.

Mammalian cell lines (Chinese Hamster Ovary - CHO Kl or Human Embryonic Kidney - HEK 293) were independently transfeeted with the recombinant expression vectors and cell lines established which had stably integrated the

SUBSTITUTE SHEET cloned receptor DNA. The stably transfected cell lines were examined for their ability to bind a range of adenosine analogues as shown in Figure 4. Furthermore, the effect on cyclic AMP (cAMP) levels of receptor activation by adenosine agonists was examined as shown in Figure 5.

These studies demonstrate that cDNA clone 3.1 encodes an adenosine A2a receptor, cDNA clone 3.2 encodes an adenosine A2b receptor and that the Al cDNA encodes an adenosine Al receptor. Generation of significant amounts of purified receptor protein, made possible by this invention, can be used as a tool to facilitate the design and chemical synthesis of highly specific agonists and antagonists for each receptor subtype. Knowledge of the primary sequence differences between the related receptor subtypes as determined by this invention provides crucial information for the design of receptor subtype specific agonists and antagonists.

It will be appreciated by persons skilled in the art that numerous variations and/or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described. The present embodiments are, therefore, to be considered in all respects as illustrative and not restrictive.

SUBSTITUTE SHEET

Claims

CLAIMS:-

1. A DNA molecule encoding the human Al adenosine receptor, the DNA molecule having a sequence substantially as shown in Figure 1 or a functionally equivalent sequence.

2. A DNA molecule encoding the human A2a receptor subtype, the DNA molecule having a sequence substantially as shown in Figure 2 or a functionally equivalent sequence.

3. A DNA molecule encoding the human A2b adenosine receptor subtype, the DNA molecule having a sequence substantially as shown in Figure 3 or a functionally equivalent sequence.

4. A method of producing the human Al adenosine receptor comprising culturing a cell transformed with the DNA molecule as claimed in Claim 1 under conditions which allow expression of the DNA sequence such that the human Al adenosine receptor is expressed on the cell surface and optionally recovering the human Al adenosine receptor.

5. A method of producing a human A2a adenosine receptor comprising culturing a cell transformed with the DNA molecule as claimed in Claim 2 under conditions which allow expression of the DNA sequence such that the human A2a adenosine receptor is expressed on the cell surface and optionally recovering the human A2a adenosine receptor.

6. A method of producing a human A2b adenosine receptor comprising culturing a cell transformed with the DNA molecule as claimed in Claim 3 under conditions which allow expression of the DNA sequence such that the human A2b adenosine receptor is expressed on the cell surface and optionally recovering the human A2b adenosine receptor.

7. A method of screening a molecule for adenosine agonist or antagonist activity, comprising contacting the molecule with the human Al, A2a and A2b adenosine receptors produced by the method as claimed in any one of Claims 3 to 6.

SUBSTITUTE SHEET