WO1998004742A1 - Whole cell assay - Google Patents

Whole cell assay Download PDF

Info

Publication number
WO1998004742A1
WO1998004742A1 PCT/US1997/013131 US9713131W WO9804742A1 WO 1998004742 A1 WO1998004742 A1 WO 1998004742A1 US 9713131 W US9713131 W US 9713131W WO 9804742 A1 WO9804742 A1 WO 9804742A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
target cells
mrna
primers
cell
Prior art date
Application number
PCT/US1997/013131
Other languages
French (fr)
Inventor
Dominik Haudenschild
François BINETTE
Original Assignee
Genzyme Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genzyme Corporation filed Critical Genzyme Corporation
Priority to AU38955/97A priority Critical patent/AU3895597A/en
Priority to JP10509018A priority patent/JP2000515761A/en
Priority to CA002262012A priority patent/CA2262012A1/en
Priority to EP97936237A priority patent/EP0956364A1/en
Publication of WO1998004742A1 publication Critical patent/WO1998004742A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6881Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for tissue or cell typing, e.g. human leukocyte antigen [HLA] probes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers

Definitions

  • This invention relates to a rapid and sensitive assay and method, for confirming the presence of specific mRNA species which are present in a cell suspension.
  • the assay and method of this invention utilizes whole cells as a starting material for a reverse transcriptase polymerase chain reaction ("RT-PCR") analysis. Primers are designed and used to amplify specific cDNA sequences conforming to the mRNA. Specific and positive identification of cell types present in a mixed population of cells can thus be confirmed with only minimal time and sample manipulation.
  • RT-PCR reverse transcriptase polymerase chain reaction
  • a second strategy for determining cell type is to look for protein markers known to be expressed only by specific cell types. Examples would be immunohistology or FACS technology. Although this is much more specific than examining morphology, these methods rely heavily on the availability of antibodies raised against the protein marker of interest. However, antibodies are often not readily available. In addition, every antibody-antigen interaction is unique, and requires conditions to be optimized on an individual basis.
  • a third strategy for cell typing is to examine the mRNA that is transcribed by cells. While every cell type has a unique mRNA profile, the methods employed for working with RNA are independent of the specific mRNA being examined. Techniques are applicable to a broad range of cell sources with at most very minor modifications .
  • Northern blotting and ribonuclease protection assays are two methods that can detect and quantify the presence of a specific mRNA. However, both of these methods require substantial amounts (1 to 20 micrograms) of RNA which generally needs to be purified first. In Si tu hybridization and m si tu PCR can be done using much less starting material, but both of these methods are technically difficult and lengthy to perform and difficult to analyze.
  • the RNase protection assay is an improvement over northern blot analysis since it can be quantitative, requires very little starting material, and can be performed directly on whole cells without prior RNA purification (Strauss and Jacobowitz, Brain Res . Mol . Brain Res .. 20, pages 229-239, (1993). However, RNase protection assays still require substantial amounts of time and manipulation.
  • the RT-PCR assay allows for the detection of rare mRNA transcripts from very little RNA, Klebe et al . , BioTechnicrues . 21 (6), pages 1094-1100 (1966).
  • RNA isolation and first strand cDNA synthesis are still required, including RNA isolation and first strand cDNA synthesis, followed by PCR amplification.
  • RNase protection assay or the RT-PCR assay as a rapid assay for screening cells for a specific target mRNA.
  • Figure 1 is an electrophoresis photograph showing the presence of aggrecan and GAPDH in passaged human chondrocytes and human dermal fibroblasts.
  • Figure 2a is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts .
  • Figure 2b is a photograph of a Southern blot showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts.
  • Figure 3 is a schematic diagram of genomic and cDNA templates with primer locations as indicated. Intervening sequences are shown in the genomic DNA but are absent from the cDNA and mRNA.
  • Figure 4 is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts with and without RNase.
  • Figure 5 is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts with and without RNase and DNase .
  • Figure 6 is a photograph of a Southern blot showing the presence of GAPDH in human chondrocytes and fibroblasts from genomic DNA template (250 bp) and mRNA template (146bp) .
  • Figure 7 is a photograph of an agarose gel comparing the presence of RNase A and RNase inhibitor on the detection of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • Figure 8 is a photograph of an agarose gel showing the presence of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • Figure 9 is a photograph of a Southern blot showing the presence of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • Figure 10 is a photograph of an agarose gel comparing the presence of RNase A and RNase inhibitor on the detection of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
  • This invention is directed to a rapid and accurate method for the determination of a specific type of cell, such as a chondrocyte cell, in a mixed population of cells.
  • the method of this invention uses whole cells as starting materials. Markers specific for the target cells are identified, and primers for the markers are constructed. Preferably, the primers are constructed to yield a nucleic acid product from reverse-transcribed RNA template which is smaller than DNA amplified from the corresponding genomic template .
  • the cells are separated from the remaining components of a liquid sample by any convenient means, such as centrifugation.
  • the cells are formed into pellets.
  • a reaction mixture is formed by combining the pellets, RT-PCR medium, a cell lysing agent or detergent, such as Tween-20, and optionally, an RNase inhibitor to minimize degradation of the mRNA.
  • the reaction is maintained at a sufficiently high temperature, i.e. from about 60° C to about 90° C, in order to reduce mRNA degradation by temporarily inactivating Rnases and to reduce false priming.
  • the method of this invention is particularly useful for analyzing samples of human cartilage tissue which are surgically removed from a patient as an adjunct to a cartilage repair procedure. After removal from the patient, the sample is analyzed for the presence of aggrecan mRNA which is specific to chondrocyte cells. If sufficient cells are present in the sample, as determined by the procedure of this invention, the cells may be cultured in order to form a patch to repair a cartilage defect. It will be readily appreciated that a similar approach could be used to replace keratinocytes .
  • the method of this invention utilizes molecular markers that are known to be specific for a certain cell type.
  • a modified single-tube RT-PCR analysis is performed to amplify the signal for these markers.
  • Such techniques are well known in the art, and are available commercially. It will be understood that any amplification technique known in the art may be used as long as it achieves the objectives of the instant method and assay.
  • the method and assay can be used in any procedure where it is necessary to confirm the presence of specific cell types in a mixed population of cells. More generally, it can be used wherever a specific RNA is expected to be transcribed by some or all cells.
  • chondrocytes aggrecan mRNA
  • keratinocytes keratin mRNA
  • viral or bacterial RNA cells expressing an mRNA isoform with a deletion or insertion mutation
  • RNA transcribed only in cancers RNA transcribed only in cancers .
  • the entire procedure can be carried out in a single tube with a single buffer and virtually no manipulation of the samples. In many situations, currently available methods of cell-typing are inadequate because they require too much time or manipulation, or because they are too subjective.
  • Primers with fairly high melting temperatures are chosen to amplify a short section of mRNA where an intron is present in the corresponding genomic sequence .
  • Such primers allow a distinction to be made between signal generated from a genomic DNA template, which is present in all cells, and the reverse-transcribed mRNA, which is cell-type specific.
  • a high primer annealing temperature allows for very specific interactions between primers and the template to occur. It also enables the use of a two- step PCR amplification in which the annealing and extension steps are combined. The short distance between primers, combined with the high processivity of the enzyme and the two-step PCR amplification, greatly reduces the cycling times required to generate a signal from specific mRNAs .
  • thermostable polymerase rTth is a thermostable enzyme with both reverse transcriptase and DNA polymerase activities, and the buffer system, such as the PCR reaction buffer available from Perkin Elmer Cetus, permits both activities.
  • the assay of this invention can be used for determining whether a specific gene is transcribed in a given cell population, by choosing primer pairs that distinguish RNA signal from genomic DNA signal.
  • the method utilized herein is able to generate a signal directly from whole cells, and proves to be a specific, simple, rapid and sensitive assay that requires minimal handling time and manipulation. This method can be used in order to confirm the presence of a specific target mRNA in a mixed population of cells .
  • the method of this invention is highly sensitive in detecting specific, low abundant mRNAs from less than about 1000 cells, and as few as 100 cells. Furthermore, the amplified DNA fragments are generated from transcribed genes, not from genomic DNA. This procedure simplifies qualitative gene expression analysis significantly, as whole cells are used as a template in a single tube, single buffer, one-enzyme RT-PCR reaction. Accurate quantitation of RNA using RT-PCR has been made possible by recent innovations that reduce the introduction of artifacts due to minor variations in conditions between samples during the reverse transcription and amplification steps.
  • An assay that allows high throughput and quantitative screening of cells for specific target mRNAs would have many potential applications. For example, conditions could be assayed that promote transcription of specific mRNAs by cells in vi tro, heterogenous cell populations could be tested for the abundance of a specific cell type, or transcription levels from plasmid transfection could be measured and optimized.
  • Primers were designed to amplify a 280bp region of the G3 domain of aggrecan mRNA, which is a chondrocyte specific marker. The primers were chosen so that they would not amplify sequence from genomic DNA template, since the region between the primers is predicted to span an intron too large to be amplified under the reaction conditions. Primers were also chosen as a positive controls for amplification. The primers were designed to co-amplify a 146bp region of GAPDH, which is a housekeeping gene transcribed in all cell types.
  • chondrocytes grown in monolayer on tissue culture treated plastic are released from the plastic with trypsin, which is inactivated by the addition of five volumes of cell media that contains 10% Fetal Bovine Serum (FBS) .
  • FBS Fetal Bovine Serum
  • a small aliquot of the cell suspension is removed for counting on a hemocytometer while the cells are pelleted in a clinical centrifuge.
  • the cell pellet is resuspended in 10ml of phosphate buffered saline (PBS), and 10,000 cells are pipetted into a 0.2ml thin-walled PCR tube. Cells are pelleted in the PCR tube by centrifugation, and the PBS supernatant is removed.
  • RT-PCR reaction is performed using techniques optimized to reduce mRNA degradation as described below.
  • RT-PCR reaction mix briefly preheated to 90° C in a thermocycler, is added directly to the cell pellet. This mixture consists of:
  • the specificity of the assay was established using human fibroblast cells as a template for RT-PCR.
  • the 280bp band corresponding to aggrecan was amplified only from chondrocytes or purified chondrocyte RNA, and not from fibroblasts or purified fibroblast RNA.
  • a similar assay run using purified RNA showed that there is no difference in the size of the amplified fragments from whole cell template versus isolated RNA template.
  • the amplified products are analyzed by agarose gel electrophore ⁇ is, and the results are shown in Figure 1.
  • Passaged human articular chondrocytes and dermal fibroblasts were grown in monolayer on tissue culture plastic and fed DMEM with 10% fetal bovine serum. Cells were released from the tissue culture treated plastic with trypsin/EDTA, which was then inactivated by addition of five volumes of media that contains 10% FBS . A small aliquot of the cell suspension was removed for counting on a hemacytometer while the cells were pelleted in a clinical centrifuge. The cell pellet was resuspended in PBS, and 10,000 cells were pipetted into a 0.2 ml thin- walled PCR tube. Cells were pelleted in the PCR tube by centrifugation at 3000 rpm in a table-top microcentrifuge, and then the PBS supernatant was removed .
  • Primers were designed using the Oligo 5.0 program (National Biosciences Inc . , Plymouth MN) . Primers have a predicted melting temperature of greater than 85° C, and a predicted optimal annealing temperature between 63° C and 64° C. Each primer was chosen to anneal completely within a single exon of mRNA sequence, and the region between the forward and reverse primer was predicted to span an intron. With this primer design, the sequence amplified from reverse transcribed RNA template yields a smaller product compared to the sequence amplified from genomic DNA template. The amplified product, including primers, was between 100 and 500 base pairs, which allowed for short cycle times . Primer sequences , 5 ' to 3 ' , are :
  • Aggrecan sense : CCAGGAGGTATGTGAGGAGGGCTGGAACAAG
  • GAPDH sense GCACCAGGTGGTCTCCTCTGACTTCAACAGCGA
  • RT-PCR reaction was performed using rTth enzyme and buffer conditions optimized by Perkin Elmer Cetus Corporation (EZ rTth RNA PCR Kit, Roche Molecular Systems Inc., Branchburg NJ) to allow both reverse transcriptase and DNA polymerase activity.
  • Reaction volume was 25 ⁇ l, consisting of 0.5% (v/v) Tween 20, 11.25 pmol each primer, 300 ⁇ M each dNTP, lx reaction buffer, 2.5 mM Manganese Acetate, and water.
  • Indicated samples had either 500 U/ml Placental RNase Inhibitor (Gibco, Grand Island NY) or RNase A/T.
  • the cDNA was then amplified by 35 cycles of 10 second 92° C denaturation steps and 20 second annealing/extension steps at 63.5° C. A final extension step of 3 minutes at 72° C completed the thermocycler program, and the reactions are held at 4°C until ready for agarose gel electrophoresis .
  • the program above was preceded by incubations for RNase or DNase digestion.
  • One fifth to one third of each reaction was run on a 3% NuSieve 3:1 agarose gel (FMC, Rockland ME) in TBE buffer with ethidium bromide, and bands were visualized by UV illumination. Southern blotting was done using the PosiBlot apparatus (Stratagene, La Jolla CA) according to manufacturer's instructions.
  • Random primed probes were made using Stratagene 's Random Primelt II procedure. Hybridization of the labeled probe to the membrane was done using Amersham Rapid-Hyb solution, followed by high stringency washes at 65° C in 0.1% SSC and 0.1% SDS.
  • the template used to generate the aggrecan probe was a plasmid that has sequence coding for the G3 domain of human aggrecan.
  • the template used to generate the GAPDH probe is a plasmid that has sequence coding for human GAPDH.
  • RNA from chondrocytes and fibroblasts was digested in lx RT-PCR buffer without rTth or primers for 50 minutes at 37° C with no enzyme (lanes 1 and 2), RNase A/T. (20U/800U per ml) (lanes 3 and 4), DNase I (80U/ml) (lanes 5 and 6) , or both (lanes 7 and 8) . After digestion, the reactions were heated to 90° C of two minutes, aggrecan and GAPDH primers and rTth enzyme were added, and the thermocycler program was started.
  • RNA from chondrocytes and fibroblasts was digested in lx RT-PCR buffer without rTth or primers for 60 minutes at 37° C with RNase A/T. (20U/800U per ml) . After digestion, aggrecan and GAPDH primers were added, the reaction was heated to 90° C, rTth enzyme was added, and the thermocycler program was started. A sample of the reaction was run on an agarose gel, blotted to a charged nylon membrane, and hybridized with a human GAPDH probe. Bands corresponding to amplified genomic DNA (250 bp) and cDNA (146 bp) are visible in Figure 6.

Abstract

This invention provides a method for determining the presence of specific cell types in a mixed population of cells. This method involves the identification and detection of markers for the target cell types, the preparation of primers specific for the markers, and the use of reverse transcriptase reaction technology to amplify and detect these markers. The method of this invention is sensitive enough to detect the presence of as few as 100 target cells in a cell population. Specific examples of target cells include human chondrocyte cells and human keratinocyte cells.

Description

WHOLE CELL ASSAY
CROSS-REFERENCE TO RELATED APPLICATIONS
This application is related to and claims the benefit of provisional application serial number 60/022,636, filed July 26, 1996, and provisional application serial number 60/035,415, filed January 23, 1997.
BACKGROUND OF THE INVENTION
This invention relates to a rapid and sensitive assay and method, for confirming the presence of specific mRNA species which are present in a cell suspension. The assay and method of this invention utilizes whole cells as a starting material for a reverse transcriptase polymerase chain reaction ("RT-PCR") analysis. Primers are designed and used to amplify specific cDNA sequences conforming to the mRNA. Specific and positive identification of cell types present in a mixed population of cells can thus be confirmed with only minimal time and sample manipulation.
To determine cell type with currently available technologies, it is possible to use a variety of strategies . One such strategy is to determine cell type by examining the cell or tissue morphology. The disadvantage of this method is that it requires an extensive amount of training, and even then it is highly subjective and not consistently reproducible. This can be improved upon by applying histological stains to the cells or tissues. In general, histology is time consuming, and the stains are not very specific, in addition, the staining and fixing of cells or tissues often involves hazardous chemicals and facilities for working with and disposing of these materials. A second strategy for determining cell type is to look for protein markers known to be expressed only by specific cell types. Examples would be immunohistology or FACS technology. Although this is much more specific than examining morphology, these methods rely heavily on the availability of antibodies raised against the protein marker of interest. However, antibodies are often not readily available. In addition, every antibody-antigen interaction is unique, and requires conditions to be optimized on an individual basis.
A third strategy for cell typing is to examine the mRNA that is transcribed by cells. While every cell type has a unique mRNA profile, the methods employed for working with RNA are independent of the specific mRNA being examined. Techniques are applicable to a broad range of cell sources with at most very minor modifications . Northern blotting and ribonuclease protection assays are two methods that can detect and quantify the presence of a specific mRNA. However, both of these methods require substantial amounts (1 to 20 micrograms) of RNA which generally needs to be purified first. In Si tu hybridization and m si tu PCR can be done using much less starting material, but both of these methods are technically difficult and lengthy to perform and difficult to analyze.
In the past few years, the study of gene expression in eukaryotic cells has benefited from several technical improvements in the sensitivity, specficity, and time requirements for the detection of target mRNA. The RNase protection assay is an improvement over northern blot analysis since it can be quantitative, requires very little starting material, and can be performed directly on whole cells without prior RNA purification (Strauss and Jacobowitz, Brain Res . Mol . Brain Res .. 20, pages 229-239, (1993). However, RNase protection assays still require substantial amounts of time and manipulation. The RT-PCR assay allows for the detection of rare mRNA transcripts from very little RNA, Klebe et al . , BioTechnicrues . 21 (6), pages 1094-1100 (1966). However, several steps are still required, including RNA isolation and first strand cDNA synthesis, followed by PCR amplification. These limitations make it difficult to use either the RNase protection assay or the RT-PCR assay as a rapid assay for screening cells for a specific target mRNA.
Accordingly, it is an objective of this invention to provide a simplified procedure for overcoming the shortcomings of the prior art by allowing specific and positive identification of a target mRNA within a cell culture in a rapid fashion and with minimal sample manipulation.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 is an electrophoresis photograph showing the presence of aggrecan and GAPDH in passaged human chondrocytes and human dermal fibroblasts.
Figure 2a is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts .
Figure 2b is a photograph of a Southern blot showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts.
Figure 3 is a schematic diagram of genomic and cDNA templates with primer locations as indicated. Intervening sequences are shown in the genomic DNA but are absent from the cDNA and mRNA.
Figure 4 is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts with and without RNase.
Figure 5 is a photograph of an agarose gel showing the results of an assay performed on total RNA isolated from chondrocytes and fibroblasts with and without RNase and DNase .
Figure 6 is a photograph of a Southern blot showing the presence of GAPDH in human chondrocytes and fibroblasts from genomic DNA template (250 bp) and mRNA template (146bp) . Figure 7 is a photograph of an agarose gel comparing the presence of RNase A and RNase inhibitor on the detection of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
Figure 8 is a photograph of an agarose gel showing the presence of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
Figure 9 is a photograph of a Southern blot showing the presence of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
Figure 10 is a photograph of an agarose gel comparing the presence of RNase A and RNase inhibitor on the detection of aggrecan and GAPDH from intact human chondrocytes and fibroblasts.
SUMMARY OF THE INVENTION
This invention is directed to a rapid and accurate method for the determination of a specific type of cell, such as a chondrocyte cell, in a mixed population of cells. The method of this invention uses whole cells as starting materials. Markers specific for the target cells are identified, and primers for the markers are constructed. Preferably, the primers are constructed to yield a nucleic acid product from reverse-transcribed RNA template which is smaller than DNA amplified from the corresponding genomic template .
In carrying out the method of this invention, the cells are separated from the remaining components of a liquid sample by any convenient means, such as centrifugation. Preferably, the cells are formed into pellets. A reaction mixture is formed by combining the pellets, RT-PCR medium, a cell lysing agent or detergent, such as Tween-20, and optionally, an RNase inhibitor to minimize degradation of the mRNA. The reaction is maintained at a sufficiently high temperature, i.e. from about 60° C to about 90° C, in order to reduce mRNA degradation by temporarily inactivating Rnases and to reduce false priming.
The method of this invention is particularly useful for analyzing samples of human cartilage tissue which are surgically removed from a patient as an adjunct to a cartilage repair procedure. After removal from the patient, the sample is analyzed for the presence of aggrecan mRNA which is specific to chondrocyte cells. If sufficient cells are present in the sample, as determined by the procedure of this invention, the cells may be cultured in order to form a patch to repair a cartilage defect. It will be readily appreciated that a similar approach could be used to replace keratinocytes .
DETAILED DESCRIPTION OF THE INVENTION
The method of this invention utilizes molecular markers that are known to be specific for a certain cell type. Preferably, a modified single-tube RT-PCR analysis is performed to amplify the signal for these markers. Such techniques are well known in the art, and are available commercially. It will be understood that any amplification technique known in the art may be used as long as it achieves the objectives of the instant method and assay.
The method and assay can be used in any procedure where it is necessary to confirm the presence of specific cell types in a mixed population of cells. More generally, it can be used wherever a specific RNA is expected to be transcribed by some or all cells. A few examples are chondrocytes (aggrecan mRNA) , keratinocytes (keratin mRNA) , viral or bacterial RNA, cells expressing an mRNA isoform with a deletion or insertion mutation, and RNA transcribed only in cancers .
The ability to use whole cells as a starting material, without first having to purify mRNA or total RNA from the cells, greatly reduces the amount of time and sample handling required for analysis of gene expression. The entire procedure can be carried out in a single tube with a single buffer and virtually no manipulation of the samples. In many situations, currently available methods of cell-typing are inadequate because they require too much time or manipulation, or because they are too subjective.
Primers with fairly high melting temperatures are chosen to amplify a short section of mRNA where an intron is present in the corresponding genomic sequence . Such primers allow a distinction to be made between signal generated from a genomic DNA template, which is present in all cells, and the reverse-transcribed mRNA, which is cell-type specific. A high primer annealing temperature allows for very specific interactions between primers and the template to occur. It also enables the use of a two- step PCR amplification in which the annealing and extension steps are combined. The short distance between primers, combined with the high processivity of the enzyme and the two-step PCR amplification, greatly reduces the cycling times required to generate a signal from specific mRNAs .
The quickness and simplicity of this assay is optimized by having an enzyme, or a mix of enzymes, with thermostable reverse transcriptase activity as well as DNA polymerase activity in a single buffer. This dual activity/single buffer capacity enables the assay to be completed in a single tube that requires no manipulation during the assay. The thermostable polymerase rTth is a thermostable enzyme with both reverse transcriptase and DNA polymerase activities, and the buffer system, such as the PCR reaction buffer available from Perkin Elmer Cetus, permits both activities.
The assay of this invention can be used for determining whether a specific gene is transcribed in a given cell population, by choosing primer pairs that distinguish RNA signal from genomic DNA signal. The method utilized herein is able to generate a signal directly from whole cells, and proves to be a specific, simple, rapid and sensitive assay that requires minimal handling time and manipulation. This method can be used in order to confirm the presence of a specific target mRNA in a mixed population of cells .
The method of this invention is highly sensitive in detecting specific, low abundant mRNAs from less than about 1000 cells, and as few as 100 cells. Furthermore, the amplified DNA fragments are generated from transcribed genes, not from genomic DNA. This procedure simplifies qualitative gene expression analysis significantly, as whole cells are used as a template in a single tube, single buffer, one-enzyme RT-PCR reaction. Accurate quantitation of RNA using RT-PCR has been made possible by recent innovations that reduce the introduction of artifacts due to minor variations in conditions between samples during the reverse transcription and amplification steps.
An assay that allows high throughput and quantitative screening of cells for specific target mRNAs would have many potential applications. For example, conditions could be assayed that promote transcription of specific mRNAs by cells in vi tro, heterogenous cell populations could be tested for the abundance of a specific cell type, or transcription levels from plasmid transfection could be measured and optimized.
The various features and aspects of this invention are illustrated in the following examples, which should not be considered as limitations the scope of the invention as defined in the appended claims.
EXAMPLE 1
Primers were designed to amplify a 280bp region of the G3 domain of aggrecan mRNA, which is a chondrocyte specific marker. The primers were chosen so that they would not amplify sequence from genomic DNA template, since the region between the primers is predicted to span an intron too large to be amplified under the reaction conditions. Primers were also chosen as a positive controls for amplification. The primers were designed to co-amplify a 146bp region of GAPDH, which is a housekeeping gene transcribed in all cell types.
Passaged human chondrocytes grown in monolayer on tissue culture treated plastic are released from the plastic with trypsin, which is inactivated by the addition of five volumes of cell media that contains 10% Fetal Bovine Serum (FBS) . A small aliquot of the cell suspension is removed for counting on a hemocytometer while the cells are pelleted in a clinical centrifuge. The cell pellet is resuspended in 10ml of phosphate buffered saline (PBS), and 10,000 cells are pipetted into a 0.2ml thin-walled PCR tube. Cells are pelleted in the PCR tube by centrifugation, and the PBS supernatant is removed. RT-PCR reaction is performed using techniques optimized to reduce mRNA degradation as described below.
An RT-PCR reaction mix, briefly preheated to 90° C in a thermocycler, is added directly to the cell pellet. This mixture consists of:
Tween-20 0.125μl 0.5% (V/V)
Placental RNase Inhibitor 1.25μl
500U/ml
Primers 4μl 11.25 pmol each dNTPδs 3μl 300μM each
5x buffer 5μl 1/5 volume
Mn(OAc)2 2.5μl 2.5mM
Water to 24μl
The reaction mix is placed into the thermocycler set to 90° C. Enzyme rTth (lμl = 2.5U) is added to the reaction, which is then quickly vortexed and immediately placed back into the thermocycler. The program then continues as follows:
63.5° C (reverse primer's optimal annealing temperature) for 15 minutes 92° C for one minute 35° cycles of:
92° C for 10 seconds
63.5° C (reverse primer's optimal annealing temperature) for 20 seconds 72° for three minutes Hold at 4° C until ready to analyze.
The specificity of the assay was established using human fibroblast cells as a template for RT-PCR. The 280bp band corresponding to aggrecan was amplified only from chondrocytes or purified chondrocyte RNA, and not from fibroblasts or purified fibroblast RNA. A similar assay run using purified RNA showed that there is no difference in the size of the amplified fragments from whole cell template versus isolated RNA template.
The amplified products are analyzed by agarose gel electrophoreεis, and the results are shown in Figure 1.
EXAMPLES 2-9
The following general procedure applies to Examples 2-9.
Passaged human articular chondrocytes and dermal fibroblasts were grown in monolayer on tissue culture plastic and fed DMEM with 10% fetal bovine serum. Cells were released from the tissue culture treated plastic with trypsin/EDTA, which was then inactivated by addition of five volumes of media that contains 10% FBS . A small aliquot of the cell suspension was removed for counting on a hemacytometer while the cells were pelleted in a clinical centrifuge. The cell pellet was resuspended in PBS, and 10,000 cells were pipetted into a 0.2 ml thin- walled PCR tube. Cells were pelleted in the PCR tube by centrifugation at 3000 rpm in a table-top microcentrifuge, and then the PBS supernatant was removed .
Primers were designed using the Oligo 5.0 program (National Biosciences Inc . , Plymouth MN) . Primers have a predicted melting temperature of greater than 85° C, and a predicted optimal annealing temperature between 63° C and 64° C. Each primer was chosen to anneal completely within a single exon of mRNA sequence, and the region between the forward and reverse primer was predicted to span an intron. With this primer design, the sequence amplified from reverse transcribed RNA template yields a smaller product compared to the sequence amplified from genomic DNA template. The amplified product, including primers, was between 100 and 500 base pairs, which allowed for short cycle times . Primer sequences , 5 ' to 3 ' , are :
Aggrecan sense : CCAGGAGGTATGTGAGGAGGGCTGGAACAAG
(SEQ ID N0:1) Aggrecan antisense: AGTTGTCAGGCTGGTTGGGGCGCCAGTTCT
(SEQ ID NO: 2) GAPDH sense : GCACCAGGTGGTCTCCTCTGACTTCAACAGCGA
(SEQ ID NO: 3) GAPDH antisense: TCCACCACCCTGTTGCTGTAGCCAAATTCGTT
(SEQ ID NO: 4)
Primers were made and purified by reverse phase cartridge by Genosys Biotechnologies (Woodlands, TX) .
An RT-PCR reaction was performed using rTth enzyme and buffer conditions optimized by Perkin Elmer Cetus Corporation (EZ rTth RNA PCR Kit, Roche Molecular Systems Inc., Branchburg NJ) to allow both reverse transcriptase and DNA polymerase activity. Reaction volume was 25μl, consisting of 0.5% (v/v) Tween 20, 11.25 pmol each primer, 300μM each dNTP, lx reaction buffer, 2.5 mM Manganese Acetate, and water. Indicated samples had either 500 U/ml Placental RNase Inhibitor (Gibco, Grand Island NY) or RNase A/T. (20U/ml RNase A and 800U/ml RNase T , or 80U/ml DNase I (Ambion, Austin TX) . A master mix was prepared and heated to 90° C in a heat block, then 24μl was dispensed into PCR tubes that contain 10,000 cells. The reactions were placed into an MJ-Research PTC- 100 thermocycler set to 90° C. One microliter (2.5 units) of enzyme rTth was added to the reactions, which were then quickly vortexed and immediately placed back into the thermocycler. A 5 minute reverse- ranscription step was performed at 63.5° C followed by a 60 second denaturation step at 92° C. The cDNA was then amplified by 35 cycles of 10 second 92° C denaturation steps and 20 second annealing/extension steps at 63.5° C. A final extension step of 3 minutes at 72° C completed the thermocycler program, and the reactions are held at 4°C until ready for agarose gel electrophoresis . For some samples, the program above was preceded by incubations for RNase or DNase digestion. One fifth to one third of each reaction was run on a 3% NuSieve 3:1 agarose gel (FMC, Rockland ME) in TBE buffer with ethidium bromide, and bands were visualized by UV illumination. Southern blotting was done using the PosiBlot apparatus (Stratagene, La Jolla CA) according to manufacturer's instructions. Random primed probes were made using Stratagene 's Random Primelt II procedure. Hybridization of the labeled probe to the membrane was done using Amersham Rapid-Hyb solution, followed by high stringency washes at 65° C in 0.1% SSC and 0.1% SDS. The template used to generate the aggrecan probe was a plasmid that has sequence coding for the G3 domain of human aggrecan. The template used to generate the GAPDH probe is a plasmid that has sequence coding for human GAPDH.
EXAMPLE 2
Following the general procedure, set forth above, an assay was performed on amounts of purified total RNA as indicated in Figures 2a and 2b from chondrocytes (top) and fibroblasts (bottom) . The aggrecan band is 280 bp, and the GAPDH band is 146 bp. The bottom band is approximately 70 bp and is a result of primer-primer interactions. Figure 2a shows an ethidium bromide stained agarose gel, and Figure 2b shows a Southern blot of the gels hybridized with human aggrecan and GAPDH probes. EXAMPLE 3
20 ng of purified total RNA from chondrocytes and fibroblasts was digested for 135 minutes at 45° C with or without RNase A ^ (20U/800U per ml) in lx RT-PCR buffer without rTth or primers. After RNase digestion, aggrecan and GAPDH primers and rTth enzyme were added, and RT-PCR thermocycler program was started. Bands corresponding to amplified aggrecan (280 bp) , GAPDH (146 bp) , and primer- primer interactions (approx. 70 bp) are visible on an ethidium bromide stained agarose gel shown in Figure 4.
EXAMPLE 4
100 ng purified total RNA from chondrocytes and fibroblasts was digested in lx RT-PCR buffer without rTth or primers for 50 minutes at 37° C with no enzyme (lanes 1 and 2), RNase A/T. (20U/800U per ml) (lanes 3 and 4), DNase I (80U/ml) (lanes 5 and 6) , or both (lanes 7 and 8) . After digestion, the reactions were heated to 90° C of two minutes, aggrecan and GAPDH primers and rTth enzyme were added, and the thermocycler program was started. Bands corresponding to amplified aggrecan (280 bp) , GAPDH (146 bp) , and primer-primer interactions (approx. 70 bp) are visible on an ethidium bromide stained agarose gel as shown in Figure 5.
EXAMPLE 5
400 ng purified total RNA from chondrocytes and fibroblasts was digested in lx RT-PCR buffer without rTth or primers for 60 minutes at 37° C with RNase A/T. (20U/800U per ml) . After digestion, aggrecan and GAPDH primers were added, the reaction was heated to 90° C, rTth enzyme was added, and the thermocycler program was started. A sample of the reaction was run on an agarose gel, blotted to a charged nylon membrane, and hybridized with a human GAPDH probe. Bands corresponding to amplified genomic DNA (250 bp) and cDNA (146 bp) are visible in Figure 6.
EXAMPLE 6
20,000 intact chondrocytes and fibroblasts that had been pelleted in a PCR tube and resuspended in lx RT-PCR buffer without rTth or primers were digested for 5 minutes at 37° C with RNase A/Tx (20U/800U per ml), or were given 40U/ml RNase inhibitor. Separate reactions were performed containing only aggrecan primers or only GAPDH primers. The reaction was heated to 90° C, rTth enzyme was added, and the thermocycler program was started. Bands corresponding to aggrecan (280 bp) , GAPDH (146 bp) , and primer-primer interactions (approx. 70 bp) are visible on the ethidium bromide stained agarose gel as shown in Figure 7.
EXAMPLE 7
Serial dilutions of intact chondrocytes and fibroblasts in PBS were pelleted to the bottom of a PCR tube, and the PBS supernatant was removed. The reaction mixture including aggrecan and GAPDH primers and rTth enzyme, preheated to 90° C, was added to the cell pellet and the thermocycler program was started. Bands corresponding to aggrecan (280 bp) , GAPDH (146 bp) , and primer-primer interactions (approx. 70 bp) are visible on the ethidium bromide stained agarose gel in Figure 8.
EXAMPLE 8
An assay was performed on serial dilutions of intact chondrocytes and fibroblasts as in Example 7. A sample of the reaction was run on an agarose gel, blotted to charged nylon membrane, and hybridized with human aggrecan and GAPDH probes . Bands corresponding to aggrecan (280 bp) , GAPDH (146 bp) and primer-primer interactions (approx. 70 bp) are visible in Figure 9.
EXAMPLE 9
10,000 intact chondrocytes were pelleted in a PCR tube and resuspended in lx RT-PCR buffer (including aggrecan and GAPDH primers) with RNase A/T. (20U/800U per ml) , or 40U/ml RNase inhibitor. Samples were either immediately put at 90° C, or were subjected to a 5 minute digestion at 37° C before being heated to 90° C. Enzyme rTth was added, and the thermocycler program was started. Bands corresponding to aggrecan (280 bp) and GAPDH (146 bp) are visible on the ethidium bromide stained agarose gel in Figure 10.

Claims

WHAT IS CLAIMED IS;
1. A method for determining whether target cells are present in a population of cells comprising: a) identifying a marker for the target cells and generating primers specific for the mRNA encoding said marker, b) forming a reaction mixture comprising RT-PCR reaction medium, a cell lysing agent, the primers generated in step (a) , and the target cells, and maintaining the reaction mixture at a sufficient temperature to prevent degradation of the mRNA, c) amplifying said mRNA with said primers using the RT-PCR procedure to generate specific amplified DNA, and d) detecting the presence or absence of said specific amplified DNA as an indication of the presence or absence of the target cells in the cell population.
2. The method of Claim 1 wherein the cell population contains more than one type of cell.
3. The method of Claim 1 wherein the temperature in step (b) is maintained in the range from about 60° C to about 90° C.
4. The method of Claim 1 wherein the target cells are selected from the group consisting of chondrocyte cells, keratinocyte cells, cells containing viral RNA, cells containing bacterial RNA, cells expressing an mRNA isoform with a deletion or insertion mutation, and RNA transcribed in cancer .
5. The method of Claim 4 wherein the target cells are chondrocyte cells or keratinocyte cells.
6. The method of Claim 5 wherein the target cells are chondrocyte cells .
7. The method of Claim 1 wherein the marker is aggrecan or keratin.
8. The method of Claim 7 wherein the marker is aggrecan.
9. The method of Claim 8 wherein the primer is SEQ ID NO: 1 or SEQ ID NO: 2.
10. The method of Claim 1 wherein the target cells are obtained from a biopsy performed on a human patient.
11. The method of Claim 10 wherein the biopsy contains human cartilage tissue.
12. The method of Claim 11 wherein the target cells are human chondrocyte cells .
13. The method of Claim 1 wherein there are fewer than about 1,000 target cells in the cell population.
14. The method of Claim 13 wherein there are fewer than about 100 target cells in the cell population.
15. The method of Claim 1 wherein the reaction mixture also includes an RNase inhibitor.
PCT/US1997/013131 1996-07-26 1997-07-25 Whole cell assay WO1998004742A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
AU38955/97A AU3895597A (en) 1996-07-26 1997-07-25 Whole cell assay
JP10509018A JP2000515761A (en) 1996-07-26 1997-07-25 Whole cell analysis system
CA002262012A CA2262012A1 (en) 1996-07-26 1997-07-25 Whole cell assay
EP97936237A EP0956364A1 (en) 1996-07-26 1997-07-25 Whole cell assay

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US2263696P 1996-07-26 1996-07-26
US3541597P 1997-01-23 1997-01-23
US60/022,636 1997-01-23
US60/035,415 1997-01-23

Publications (1)

Publication Number Publication Date
WO1998004742A1 true WO1998004742A1 (en) 1998-02-05

Family

ID=26696163

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US1997/013131 WO1998004742A1 (en) 1996-07-26 1997-07-25 Whole cell assay

Country Status (5)

Country Link
EP (1) EP0956364A1 (en)
JP (1) JP2000515761A (en)
AU (1) AU3895597A (en)
CA (1) CA2262012A1 (en)
WO (1) WO1998004742A1 (en)

Cited By (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001075171A2 (en) * 2000-04-03 2001-10-11 Corixa Corporation Methods, compositions and kits for the detection and monitoring of breast cancer
US7598226B2 (en) 1998-12-28 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
US7815868B1 (en) 2006-02-28 2010-10-19 Fluidigm Corporation Microfluidic reaction apparatus for high throughput screening
US7820427B2 (en) 2001-11-30 2010-10-26 Fluidigm Corporation Microfluidic device and methods of using same
US7833708B2 (en) 2001-04-06 2010-11-16 California Institute Of Technology Nucleic acid amplification using microfluidic devices
US7855271B2 (en) 1998-12-28 2010-12-21 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
US7887753B2 (en) 2000-11-16 2011-02-15 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US8658418B2 (en) 2002-04-01 2014-02-25 Fluidigm Corporation Microfluidic particle-analysis systems
US8871446B2 (en) 2002-10-02 2014-10-28 California Institute Of Technology Microfluidic nucleic acid analysis
US9714443B2 (en) 2002-09-25 2017-07-25 California Institute Of Technology Microfabricated structure having parallel and orthogonal flow channels controlled by row and column multiplexors
US10131934B2 (en) 2003-04-03 2018-11-20 Fluidigm Corporation Thermal reaction device and method for using the same

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20090127153A (en) * 2007-04-06 2009-12-09 겐자임 코포레이션 Methods of evaluating cells and cell cultures

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
US5643730A (en) * 1991-09-23 1997-07-01 Pfizer Inc. Process for detecting specific mRNA and DNA in cells
US5656462A (en) * 1992-01-29 1997-08-12 Hitachi Chemical Co., Ltd. Method for synthesizing cDNA using a polynucleotide immobilized support

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5213961A (en) * 1989-08-31 1993-05-25 Brigham And Women's Hospital Accurate quantitation of RNA and DNA by competetitive polymerase chain reaction
US5643730A (en) * 1991-09-23 1997-07-01 Pfizer Inc. Process for detecting specific mRNA and DNA in cells
US5656462A (en) * 1992-01-29 1997-08-12 Hitachi Chemical Co., Ltd. Method for synthesizing cDNA using a polynucleotide immobilized support

Cited By (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7855271B2 (en) 1998-12-28 2010-12-21 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
US7598226B2 (en) 1998-12-28 2009-10-06 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
US8182823B2 (en) 1998-12-28 2012-05-22 Corixa Corporation Compositions and methods for the therapy and diagnosis of breast cancer
WO2001075171A3 (en) * 2000-04-03 2002-08-08 Corixa Corp Methods, compositions and kits for the detection and monitoring of breast cancer
WO2001075171A2 (en) * 2000-04-03 2001-10-11 Corixa Corporation Methods, compositions and kits for the detection and monitoring of breast cancer
US9926521B2 (en) 2000-06-27 2018-03-27 Fluidigm Corporation Microfluidic particle-analysis systems
US8455258B2 (en) 2000-11-16 2013-06-04 California Insitute Of Technology Apparatus and methods for conducting assays and high throughput screening
US8673645B2 (en) 2000-11-16 2014-03-18 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US10509018B2 (en) 2000-11-16 2019-12-17 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US8273574B2 (en) 2000-11-16 2012-09-25 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US9176137B2 (en) 2000-11-16 2015-11-03 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US7887753B2 (en) 2000-11-16 2011-02-15 California Institute Of Technology Apparatus and methods for conducting assays and high throughput screening
US7833708B2 (en) 2001-04-06 2010-11-16 California Institute Of Technology Nucleic acid amplification using microfluidic devices
US8486636B2 (en) 2001-04-06 2013-07-16 California Institute Of Technology Nucleic acid amplification using microfluidic devices
US8936764B2 (en) 2001-04-06 2015-01-20 California Institute Of Technology Nucleic acid amplification using microfluidic devices
US7820427B2 (en) 2001-11-30 2010-10-26 Fluidigm Corporation Microfluidic device and methods of using same
US9643178B2 (en) 2001-11-30 2017-05-09 Fluidigm Corporation Microfluidic device with reaction sites configured for blind filling
US8163492B2 (en) 2001-11-30 2012-04-24 Fluidign Corporation Microfluidic device and methods of using same
US8658418B2 (en) 2002-04-01 2014-02-25 Fluidigm Corporation Microfluidic particle-analysis systems
US9714443B2 (en) 2002-09-25 2017-07-25 California Institute Of Technology Microfabricated structure having parallel and orthogonal flow channels controlled by row and column multiplexors
US8871446B2 (en) 2002-10-02 2014-10-28 California Institute Of Technology Microfluidic nucleic acid analysis
US9579650B2 (en) 2002-10-02 2017-02-28 California Institute Of Technology Microfluidic nucleic acid analysis
US10328428B2 (en) 2002-10-02 2019-06-25 California Institute Of Technology Apparatus for preparing cDNA libraries from single cells
US10940473B2 (en) 2002-10-02 2021-03-09 California Institute Of Technology Microfluidic nucleic acid analysis
US10131934B2 (en) 2003-04-03 2018-11-20 Fluidigm Corporation Thermal reaction device and method for using the same
US8420017B2 (en) 2006-02-28 2013-04-16 Fluidigm Corporation Microfluidic reaction apparatus for high throughput screening
US7815868B1 (en) 2006-02-28 2010-10-19 Fluidigm Corporation Microfluidic reaction apparatus for high throughput screening

Also Published As

Publication number Publication date
CA2262012A1 (en) 1998-02-05
JP2000515761A (en) 2000-11-28
AU3895597A (en) 1998-02-20
EP0956364A1 (en) 1999-11-17

Similar Documents

Publication Publication Date Title
Liu et al. Alu transcripts: cytoplasmic localisation and regulation by DNA methylation
Liang et al. Distribution and cloning of eukaryotic mRNAs by means of differential display: refinements and optimization
Liang et al. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction
US5741677A (en) Methods for measuring telomere length
JP2843675B2 (en) Identification, isolation and cloning of messenger RNA
Fakharzadeh et al. Structure and organization of amplified DNA on double minutes containing the mdm2 oncogene
EP1272668A2 (en) Methods, compositions and kits for the detection and monitoring of breast cancer
WO2000075356A1 (en) Rna polymerase chain reaction
WO1998004742A1 (en) Whole cell assay
Sbisa et al. The complete and symmetric transcription of the main non coding region of rat mitochondrial genome: in vivo mapping of heavy and light transcripts
Hanson et al. RNA profiling for the identification of the tissue origin of dried stains in forensic biology
US20180142295A1 (en) Regulator targeting fatty acid synthase and method of using the same for improving meat quality
Okubo et al. Monitoring cell physiology by expression profiles and discovering cell type-specific genes by compiled expression profiles
Gazziola et al. Malignant fibrous histiocytoma: a proposed cellular origin and identification of its characterizing gene transcripts
CN111378742A (en) MicroRNA biomarker and application thereof in preparation of autoimmune disease detection kit
WO1999001581A1 (en) P53 influenced gene expression
Kuromitsu et al. A unique downregulation of h2-calponin gene expression in Down syndrome: a possible attenuation mechanism for fetal survival by methylation at the CpG island in the trisomic chromosome 21
US20030165931A1 (en) Qualitative differential screening
US9644208B2 (en) MiRNA for regulating FABP6 gene and method of using the same
WO1998014619A1 (en) Methods for generating and analyzing transcript markers
US8637654B1 (en) Messenger RNA profiling: body fluid identification using multiplex real time-polymerase chain reaction (q-PCR)
CN110819715A (en) Immune gene marker and kit for colorectal cancer detection
US20170226561A1 (en) Mapping the spatial localization of cellular nucleic acids by proximity-dependent enzymatic tagging
Zhao et al. 3′-end cDNA pool suitable for differential display from a small number of cells
CN110241219B (en) Application of MYOM3 in melanoma metastasis

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AU CA JP US US

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): AT BE CH DE DK ES FI FR GB GR IE IT LU MC NL PT SE

DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 1997936237

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2262012

Country of ref document: CA

Ref country code: CA

Ref document number: 2262012

Kind code of ref document: A

Format of ref document f/p: F

WWP Wipo information: published in national office

Ref document number: 1997936237

Country of ref document: EP

WWW Wipo information: withdrawn in national office

Ref document number: 1997936237

Country of ref document: EP