WO2003068988A1

WO2003068988A1 - A method of pcr based detection and identification of rice blast fungus magnaporthe grisea

Info

Publication number: WO2003068988A1
Application number: PCT/IN2002/000024
Authority: WO
Inventors: Sonia Chadha; Thirumalai Gopalakrishna
Original assignee: Secretary, Department Of Atomic Energy
Priority date: 2002-02-11
Filing date: 2002-02-11
Publication date: 2003-08-21
Also published as: AU2002232118A1

Abstract

A method for detection and identification of infestation of tissue of rice with a virulent strain of Magnaporthe grisea. The method involves isolating deoxyribonucleic acid (DNA) from infected tissue, subjecting the isolated nucleic acid to amplification by polymerase chain reaction (PCR) using sets of primers complementary in base sequence to mif23 (GeneBank accession number GI 4732021), an infection specific gene of M. grisea specific to virulent strains of the fungus, to form a product containing amplified M. grisea DNA, detecting the presence of the amplified DNA separated from M. grisea DNA after electrophoresis. The invention also relates to a method of deriving DNA of M. grisea from plant tissue for amplification by PCR. The invention further relates to a kit for detection and identification of infestation of tissue of rice with a virulent strain of Magnaporthe grisea.

Description

A METHOD OF PCR BASED DETECTION AND IDENTIFICATION OF RICE BLAST FUNGUS MAGNAPORTHE GRISEA

Field of Invention:

This invention relates to a method of PCR based detection and identification of rice blast fungus M. grisea from plant tissues. Particularly, the present invention relates to the use of specific nucleic acid primers in polymerase chain reaction assays for the detection of the rice blast causing pathogen. This invention also relates to a set of oilgonucleotide primers of certain specific sequence, which bind to the mif23 gene enclosing a region of approximately 390 base pairs. The invention is also directed to providing a kit for PCR based detection and identification of rice blast fungus M. grisea from plant tissues. Background Art: Diseases in crop plants cause considerable loss from year to year resulting both in economic deprivations to farmers and in many parts of the world to shortfalls in the food provision for local populations. Worldwide, fungi cause the greatest amount of crop damage as plant pathogens and require the highest expenditure, in monetary terms, for their control. In addition, there are several well-documented cases of the evolution of fungal strains that are resistant to a particular fungicide. It is therefore becoming critical that a rapid, reliable and sensitive method be developed to provide an accurate diagnosis and information about a particular fungus in the absence of visual disease symptoms.

Some plant disease inciting fungi are carried within the seed. As the seed (which looks absolutely normal) sprouts, the fungus grows inside the developing seedling resulting in disease symptoms in mature plants. Thus these seed borne pathogens may affect the vigor of the seed lot by reducing the emergence and hence the plant population in effect resulting in reduced number of healthy plants in the field, as well as providing fungal inoculum for further spread of the disease to healthy plants in the field or weakening the plant's ability to tolerate both biotic and abiotic stresses in the field. Rice (Oryza sativa) feeds half the world's population but faces a major pathological threat by rice blast disease caused by the fungal pathogen M. giisea. This fungus was earlier called Pyricularia oiγzae, before the discovery of its teliomorphic form. Rice blast disease is present in almost every country and limits rice yield in all major rice growing regions of the world, especially in the irrigated lands and dry upland environments. Annually enough rice is lost due to this disease to feed 60 million people per year. Strains of this fungus attack other cereals including wheat and barley. The disease is also a serious problem of turf grass. Rice blast rapidly changes from a minor to a major importance with the potential of causing drastic yield losses. This cyclic change usually occurs with a newly developed and released rice variety as a result of infrequently observed blast races pathogenic to the new variety becoming widely established in commercial fields. As an example, the Newbonnett rice variety released in 1982 was observed to be damaged by blast in 1985. A blast epidemic occurred in 1986 with at least 60,000 acres being severely damaged. In 1987, the disease developed early in all rice producing areas. Thus frequent regional disease outbreaks have resulted in severe hardship for many millions of people in Asia, Africa and parts of the America.

Blast pathogen identification using conventional pathological procedures is difficult and a time consuming process. The method basically involves isolating the blast fungus from the diseased tissue, culturing the fungus for spores, inoculating several different susceptible and resistant rice lines. Serological test currently used consists of a large number of steps starting from isolation and culturing of fungus, preparation of conidia as antigens, preparation of polyclonal antisera or monoclonal antibody production followed by use of a technique known as enzyme linked immunosorbent assay (ELISA). US Pat. No. 5,789,183 describes a serological method for the detection and identification of rice blast fungus. The sensitivity of the assay using ELISA was reported to be about 3 nanogram of target protein. The polymerase chain reaction is a known technique, which makes it possible to detect the presence of particular DNA sequence in a background of unrelated DNA sequences [US Pat. Nos. 4,683,195 and 4,683,202]. These methods are well reviewed in literature and one such review is by Pearce (1998). US Pat. No. 5,916,744 describes the application of PCR technique for testing of infestation of rapeseed and other cruciferae by the fungus Leptosphaeria maculans (blackleg infestation).

The PCR technique is a method, which can be used to amplify DNA sequences by over a million fold without using methods of genetic manipulations. PCR makes use of two oligonucleotide primers, which bind to, opposite strands, flanking the sequence to be amplified. A typical PCR cycle involves initial denaturation of target DNA (later the newly synthesized DNA fragments also) at high temperature e.g. 90° C or higher, annealing of the oligonucleotide primers to the denatured DNA at lower temperature e.g. 50° C followed by synthesis of new target sequence by a thermostable DNA polymerase enzyme at 72° C. This cycle is repeated about 30 to 40 times, each cycle doubling the amount of target DNA. The quantity of template DNA is less important than quality as the PCR technique is extremely sensitive. To develop a successful PCR test for a species or a strain it is essential to identify DNA sequences that are unique or characteristic for those species or strains. This would aid in synthesizing the oligonucleotide primers that would bind or anneal to the unique regions of the DNA.

Seeds infested with fungi often occur at very low infestation levels and extracts prepared from this seed will contain lower levels of fungal pathogen. Thus there is an increasing need for a relatively sensitive and easy test for detecting infestations of blast fungus in rice seed lots. PCR assays offer specificity, sensitivity, speed and relative economy. PCR technique can detect as little as femtogram quantities of DNA. Object

The main object of the present invention is to develop a PCR based detection and identification method of rice blast fungus from rice seeds and other tissues of plant such as rice, wheat, barley.

Another object of the present invention is to simplify the procedure for the detection and identification of rice blast fungus from rice seeds and other tissues of plant such as rice, wheat, barley.

Another objective of the invention is to develop a method for the detection and identification of rice blast fungus that can be carried out easily and with increased sensitivity compared to the existing methods.

Yet another object of the invention is to develop novel oligonucleotides suitable for binding to specific regions of DNA by complementary base pairing.

Yet further object is directed to a kit for PCR based detection and identification of rice blast fungus from rice seeds and other tissues. Summary of the Invention

Thus according to the basic aspect of this invention there is provided a method of PCR based detection and identification of M. grisea comprising the steps of i. isolating DNA of a virulent strain of M. grisea from any tissue of a plant; ii. subjecting the isolated DNA to amplification by polymerase chain reaction using selective oligonucleotide primers which specifically bind to mifi3 gene (GeneBank Accession no. GI 4732021); iii. subjecting the amplified products to electrophoresing and visualizing the fluorescent bands under UV light.

In the above method of the invention the electrophoresing of the amplified products is preferably carried out on agarose gel and stained with ethidium bromide followed by visualizing the fluorescent bands under UV light.

According to another aspect the invention relates to a set of synthetic oligonucleotide primers for the polymerase chain reaction amplification of DNA of virulent strains ofM grisea consisting of

5'- GGATCCAATAGCATCACTCGAC - 3' (SEQ. IDNO.1) 5'- GGATCCATTGAGCATGCGTT - 3' (SEQ. IDNO.2)

According to yet another aspect of the present invention there is provided a kit for PCR based detection and identification of grisea from rice seeds and other tissues comprising :

(i) a set of synthetic oligonucleotide primers for the polymerase chain reaction amplification of DNA of virulent strains ofM grisea consisting of

5' - GGATCCAATAGCATCACTCGAC - 3' (SEQ. ID NO. 1) 5' - GGATCCATTGAGCATGCGTT - 3' (SEQ. ID NO. 2); and (ii) an instruction manual for carrying out detection and identification of M. grisea using the same. According to yet another aspect of the present invention there is provided a kit for

PCR based detection and identification of grisea from rice seeds and other tissues comprising :

(i) means to isolate DNA of a virulent strains ofM. grisea from any tissue of a plant such as hereindescribed ; (ii) selected oligonucleotide primers which specifically bind to mi 23 gene ; (iii) means to carry out amplification of the isolated DNA ;

(iv) means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light.

According to yet another aspect of the present invention the kit for PCR based detection and identification ofM grisea from rice seeds and other tissues further comprises : a typical fluorescence pattern after electrophoresing of amplified infected rice DNA to favour comparative analysis with samples to be detected. According to yet another aspect of the present invention there is provided a method for manufacture the kit for use in detection and identification of rice blast fungus from rice seeds and other tissues comprising : providing the means to isolate DNA of a virulent strains ofM. grisea from any tissue of a plant ; providing the selected oligonucleotide primers which specifically bind to mi 23 gene ; providing means to carry out amplification of the isolated DNA ;and means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light. Detailed Description of the Invention

In this invention a method has been developed for the detection of seed borne fungal pathogen of rice using PCR based detection method with a minimum of manipulation. Amplification of the target DNA could not be attained when DNA extract was prepared from infested seeds. The major obstacle found was the low level of fungal inoculum (target DNA). Preincubation assay leads to detection of mycelium in infested rice seeds, which is desirable. Several different extraction protocols were compared and it was found that the one described herein was the most reliable. A variety of incubation methods were also tested to facilitate the rapid and consistent growth ofM grisea from infested rice seeds including culture plates, moistened filter paper, petri plates with high humidity conditions. Although some of these methods allowed the growth of the fungus, the DNA recovered from infested seed failed to show consistent amplification. As liquid medium is used to grow the fungus from the infested seeds, plating of individual seed is not required. Thus a larger sample size can be screened. The present PCR based assay can be used for routine testing of rice seed lots for the presence of blast pathogen. At present due to complexity in such testing there are few instances where seed borne pathogen screening is mandatory. The present invention is directed to make such testing simple and more commonplace so that all seeds marketed can possibly be subjected to mandatory laboratory testing and next international standards.

The present invention makes use of the polymerase chain reaction to amplify relatively small amounts of DNA segments ofM grisea that are specific to virulent strains so that presence of this DNA (and hence the blast fungus) can be easily detected by known methods. To make it possible to use the PCR for such a test procedure, the present invention has developed the procedure for effectively isolating rice blast fungal DNA from plant tissue, such as seeds, and to provide oligonucleotide primers complementary to specific DNA of the virulent strains of the fungus.

The isolation of the DNA following the method of the invention comprises : i) placing surface disinfected tissue in liquid potato dextrose broth medium; ii) shaking the cultures for a suitable period at ambient temperature; iii) collecting the fungal mycelia after centrifugation and isolating DNA from the fungal mycelia; iv) lysing centrifuged mycelia, extracting fungal DNA from said lysed mycelia with an organic solvent and precipitating the said extracted DNA. The preferred method of isolating the fungal DNA from seed (or other plant tissue) involves placing surface disinfected seeds in liquid potato dextrose medium, incubating the culture at ambient temperature for suitable period of time (preferably at least 3 days) with continuous shaking and collecting the fungal mycelia from the medium by filtration. Mycelia are then ground in liquid nitrogen followed by lysis by a suitable buffer (high salt and containing sodium dodecyl sulphate). DNA extracted with organic solvents is precipitated with ethanol. This procedure provides sufficient target DNA for PCR amplification and subsequent detection of the target DNA.

The oligonucleotide primers employed in this invention are derived from 1560 base pair miβ.3 gene (GeneBank accession no. GI 4732021), an infection specific gene. Pathogenecity related genes like mi/23 are considered to be an ideal target for detection and identification of particular species or strain as they uniquely define the target organism.

The miβ3 gene provides a large resource for specific primer selection, which can be carried out using only the information, provided by the sequence i.e. there is no need to obtain the element itself for primer selection. The primer selection was carried out using computer software like the Primer Designer™ from Scientific and Educational software that utilize the following principles in designing primer for optimal PCR amplifications. They are that primers should be about 20 to 25 bases including 5' extension, the primers (complementary to target DNA) should be less than 1000 bases apart, should have a G + C content of 45 - 60%, T_m for annealing should be around 55 - 70° C. The primers should be rejected if it has runs of 3 bases or more, secondary structures, 3 or more G or C at 3' end, primer dimmer formation by avoiding internal homologous sequences. Using these criteria, primers were selected corresponding to mifi3 gene sequence. The selected primers can be chemically synthesized by well known techniques for providing short length single stranded DNA e.g. by means of solid phase phosphite-triester oligodeoxyribonucleotide synthesis which can be performed using gene synthesizing machines. The primers synthesized under the present invention had the sequence as given in Seq ID no. 1 and Seq. ID no. 2. The set of primers are respectively 22 and 20 nucleotides in length, have a minimum G + C content of 45%, a minimum T_m of 55° C and amplify a fragment of approximately 390 bases. The starting base pair positions of the primers in miβ.3 gene are shown in Table 1.

Table 1

Primer Sequence base pair position

Seq. ID no.1 5'- GGATCCAATACGATCACTCGAC -3' 141 Seq. ID no.2 5'- GGATCCATTGAGCATGCGTT -3' 495

The properties of the said oligonucleotide primers are given in detail in table 2.

Table 2

The target DNA was amplified by polymerase chain reaction using thermostable DNA polymerase. The reaction mixture in addition to the template DNA and said oligonucleotide primers consisted of a buffer, deoxynucleotide triphosphates and magnesium chloride. The amplification was done in a thermocycler for 35 cycles and each cycle consisted of the denaturation, annealing and extension steps, a procedure well understood by those with skill in the art. The analysis of PCR amplified products was performed after achieving the separation of the amplified fragments in an electrophoretic media like agarose followed by visualization by fluorescence under ultraviolet light after staining with ethidium bromide using "conventional methods" a term that would be understood by those with skill in the art (see, for example, Sambrook et al., (1989)).

While the method of present invention is primarily intended for detection and identification of seed infestation with the blast fungus, it can be further applied to any plant tissue or material containing small amounts of fungal DNA or fungal mycelia or fungal spores. Rice is the primary crop of interest for testing, but other blast pathogen host like wheat, barley, finger millet, turf grass etc. may also be tested for the presence of the virulent strain of the blast fungal pathogen in the same way.

In another embodiment of the invention is described the DNA sequence of oligonucleotide primers (which are useful in this and similar assay), which has been found by inventors for the first time. A set of synthetic oligonucleotide primers that retain the capacity to specifically bind to the target gene prepared by method comprising sequence additions, deletions or mismatches, wherein certain nucleotide residues of the oligonucleotide sequence are not optimally complementary i.e. A - C or G - T or are non- complementary e.g. A - G or T - C, to the corresponding sequence of the specific primers. These possible modifications to the oligonucleotide primers of Seq. ID no. 1 and Seq. ID no. 2 would be understood by those with skill in the art.

The kit for the detection and identification of seed infested with blast fungus can include an instruction manual having detailed instruction for operating the kit to carry out the detection and identification of seed infested with blast fungus. EXAMPLES

The invention is further illustrated by the following examples. Examples are by way of illustration only and in no way restrict the scope of the invention.

Example I : Synthesizing primers suitable for PCR based detection & identification of M. grisea This Example I is split in three parts. In part IA the method of selection of primers suitable for PCR based detection & identification of grisea, has been described. In part B method of synthesis of selected primers is described and in part C the sequence of these primers and their properties are given. This Example I A, B and C defines the primers used in the PCR based detection & identification ofM grisea. Example IA : Selection of oligonucleotide primers

The oligonucleotide primers employed in this invention are derived from 1560 base pair mifi.3 gene (GeneBank accession no. GI 4732021), an infection specific gene.

Using computer software the Primer Designer™ (version 1.01) from Scientific and Educational Software we carried out the primer designing and selection.

We set following conditions for choosing the primers. The primers should be about 20 to 25 bases including 5' extension, the primers (complementary to target DNA) should bind to template DNA within a distance of 1000 bases or less, should have a G + C content of 45 - 60%, the T_m for annealing should be around 55 - 70° C. The primers should be rejected if it has repeats of 3 bases or more, secondary structures, 3 or more G or C at 3' end and internal homologous sequences (to avoid primer dimmer formation).

Using these criteria, primers were selected corresponding to mifl3 gene sequence. Example D3: Synthesis of selected oligonucleotide primers

The selected primers can then be chemically synthesized by well known techniques for providing short length single stranded DNA e.g. by means of solid phase phosphite- triester oligodeoxyribonucleotide synthesis which can be performed manually or commercially using gene synthesizing machines. In the present invention, the primers were commercially synthesized using gene-synthesizing machine. Example IC: Sequence of oligonucleotide primers

The primers selected were of a specific sequence as given in Seq ID no. 1 and Seq. ID no. 2. The set of primers are respectively 22 and 20 nucleotides in length, have a minimum G + C content of 45%, a minimum T_m of 55° C and amplify a fragment of approximately 390 bases. The starting base pair positions of the primers in mifi.3 gene are shown in Table 1. Example II: PCR based detection & identification of authentic samples of . grisea

The virulent isolates ofM grisea were obtained from Directorate of Rice Research, Hyderabad, India and Centre for Advance Studies in Botany, Madras University, Chennai, India.

Isolates were cultured on plates of potato dextrose agar medium containing 23 grams of commercially available potato dextrose broth and 20 grams of agar dissolved in distilled water to make a final volume of 1 liter, which was autoclaved at 121° C under 15 pounds of pressure per square inch for 15 minutes.

For DNA extraction, plugs from actively growing culture plates were transferred to liquid medium and grown for 4 days at 25° C with continuous shaking. The medium used in all the described experiments contained 23 grams of potato dextrose broth dissolved in distilled water and final volume made up to 1 liter, which was autoclaved at 121° C under 15 pounds of pressure per square inch for 15 minutes.

Three different seed lots of infested rice seeds were obtained from Directorate of Rice Research, Hyderabad, India and Centre for Advance Studies in Botany, Madras University, Chennai, India.

The mycelium of the fungal isolate was collected by filtration and dried between blotting papers to take out as much as free moisture available and ground in a porcelain pestle and mortar using liquid nitrogen. The powdered mycelia were used to isolate the DNA. Isolating said DNA from the fungal mycelia comprises lysing of centrifuged mycelia, extracting fungal DNA from said lysed mycelia with an organic solvent and precipitating the said extracted DNA.

The primers used in the amplification reactions were derived from the sequence of mi/23 gene (GeneBank accession no. GI 4732021), an infection specific gene found in virulent strains ofM grisea. Primers were designed using Primer Designer Software

(version 1.01), from Scientific and Educational Software and were used to select the optimal primers from the sequence. The primers were chosen to amplify a fragment of approximately 390 base pairs. The sequence of the primers and their starting base pair positions in mi/23 gene sequence has already been indicated earlier (Table 1). Example HI: A method of PCR based detection and identification of grisea i. isolating DNA of a virulent strain ofM grisea from any tissue of a plant such as rice.

The DNA from the infested rice seed was isolated in the following manner. Seeds were surface sterilized and then four to six seeds were added to 5 ml of potato dextrose broth liquid medium and cultured for 72 hours at 25° C with continuous shaking. The mycelia growing around the rice seed was collected by filtering through two layers of muslin cloth. Only the mycelial mat was taken for DNA extraction. Mycelial mat was dried between blotting papers as described earlier. Mycelial mat was ground in liquid nitrogen using a porcelain pestle and mortar. Powdered mycelia was suspended in prewarmed lysis buffer that consisted of 100 mM Tris- HC1, pH 8.0, 250 mMNaCl, 50 mM EDTA and 0.5% SDS. The slurry was incubated at 65° C for 30 minutes followed by addition of 1.7 M potassium acetate and kept on ice for 30 minutes. The samples were then extracted with chloroform. The total nucleic acid was precipitated with equal volume of chilled isopropanol.

The precipitate was collected by centrifugation and the pellet was suspended in 10 mM Tris-HCl, pH 8.0 containing 1 mMEDTA (hereafter called TE) and treated with RNase A enzyme (20 μg/ml) at 37° C for 60 minutes. The DNA was extracted once with phenol: chloroform (1:1, v/v) and twice with chloroform and isoamylalcohol (24: 1, v/v). DNA in the aqueous phase was precipitated with two volumes of chilled ethanol and 1/10^th volume of 3 M sodium acetate. The DNA precipitate was collected by centrifugation and dissolved in TE. The concentration of DNA was determined by fluorometer. ii. DNA amplification by PCR

About 10 nanogram of fungal DNA, unless other wise stated was added to each of several amplification reactions, which was carried out in 0.5 ml Eppendorf tubes. The amplification reactions contained 50 μM deoxynucleotide triphosphates, 0.1 μM of each primer*, 0.5 units of Finnzyme and lX Finnzyme buffer. *(The sequence of the primers and their starting base pair positions in mifi.3 gene sequence has already been indicated in Example I).

The amplifications were performed in an Eppendorf thermal cycler using the following program. The samples were initially heated to 94° C for 5 minutes, and then 45 ramped cycles consisting of 92° C for 30 seconds, 57° C for 1 minute and 72° C for 1 minute were performed with a final extension at 72° C for 8 minutes. iii. Electrophoresing the amplified products on agarose gel, staining with ethidium bromide and visualizing the fluorescent bands under ultraviolet light.

After the PCR, the amplified products were electrophoresed on 2% agarose gel and stained with ethidium bromide by "standard procedures" a term that would be understood by those with skill in the art. The DNA bands could be visualized by their fluorescence after ultraviolet light illumination. Results

The designed oligonucleotide primer pair amplified a DNA fragment of 390 base pair. A typical fluorescence pattern after electrophoresing the amplified products is shown in Figure 1. The different lanes (numbered left to right) in figure 1 are as follows: lane (1) no DNA - blank; lane (2) rice DNA - negative control; lanes (3), (4) and (5) infested rice DNA; lanes (6) - (11) DNA from virulent strains ofM Grisea - positive control; Lane M contains the 1 kb DNA ladder. Example TV: Limits of detection

DNA isolated in Example II was used to determine the minimum level of detection, amplification reactions were carried out with varying amounts ofM grisea DNA from 2 femtogram to 20 ng (nanogram). The lowest amount of DNA added to an amplification reaction that led to a visible amplified product of 390 base pair was 20 pg (picogram).

Fig.2 shows the amplification pattern with a serially diluted DNA template sample. The different lanes in figure 2 are as follows. Lane 1: 2 femtogram (fg); lane 2: 20 fg; lane 3:200 fg; lane 4:2 pg; lane 5:20 pg; lane 6:200 pg; lane 7: 2 ng; lane 8:10 ng; lane 9: 20 ng. Lane M contains the lkb DNA ladder. Advantages of the Invention

The PCR based assay developed by way of the present invention for the detection of M grisea is found to be accurate, sensitive and reliable. The lowest concentration of total genomic DNA from which the target fragment was amplified was found to be 20 picogram of target DNA as compared to the serological method where the limit of detection is 3 nanogram of target protein (US Pat. No. 5,789,183). Thus the present method is aboutlOO times more sensitive than the current serological method.

Also, following the present method the plating of individual seed is not required. Thus the technique can be used for a large number of samples. The assay does not rely on visual identification ofM grisea from infested rice seed, which is complicated by the frequent occurrence of morphologically similar saprobes of rice seed.

The method developed does not require visual or microscopic examination of fungal pathogen. The plating of individual seed is not required. Thus the methodology developed can be used for a large number of samples.

The method of present invention has the potential to be used for routine rice seed testing as a measure to determine seed health. The use of these primers enables the detection of virulent isolates of fungal pathogen at the seed level or before the development of visual symptoms of the disease in a growing plant and monitoring the development of the disease in rice plant populations.

Test for the presence of rice blast fungal pathogen, M giisea in infected rice seeds that may affect both the viability and health of rice seed and thus the yield and quality of the crop derived from such infected seeds.

While the present invention has been described to specific embodiments thereof, numerous variations, modifications and further embodiments are possible, and accordingly, all such variations, modifications and embodiments are to be regarded as being within the scope of the present invention.

Claims

1. A method of PCR based detection and identification ofM grisea comprising the steps of a. isolating DNA of a virulent strain ofM grisea from any tissue of a plant; b. subj ecting the isolated DNA to amplification by polymerase chain reaction using oligonucleotide primers which specifically bind to mi 23 gene as herein defined ; c. subjecting the amplified product to electrophoresing and visualizing the fluorescent bands under UV light.

2. A method as claimed in claim 1 wherein said step of electrophoresing comprise electrophoresing the amplified products on agarose gel and stained with ethidium bromide.

3. A method as claimed in claim 1 wherein the virulent strain is isolated from tissue of plant selected from rice, wheat and barley.

4. A method as claimed in claim 1 wherein said isolation of said DNA comprises i) providing surface disinfected tissue in liquid potato dextrose broth medium; ii) shaking the cultures for a desired period preferably at least 3 days at ambient temperature; iii) collecting the fungal mycelia after centrifugation and isolating DNA from the fungal mycelia; iv) lysing centrifuged mycelia, extracting fungal DNA from said lysed mycelia with an organic solvent and precipitating the said extracted DNA.

5. A method as claimed in anyone of claims 1- 4 wherein, sequence of said oligonucleotide of a set of primers for the said polymerase chain reaction are selected from sequence of mi/23 gene ofM grisea such that, a. they being complementary, are able to bind by complementary base pairing, b. the said primers do not have runs of three or more identical base, secondary structures, three or more G or C at the 3' end, c. the said primers also do not show primer - primer annealing because of internal homology.

6. A method as claimed in anyone of claims 1 - 4 wherein, amplification by polymerase chain reaction is carried out with 20 - 200 μM deoxynucleotide triphosphates and 0.01 10 μM of each of the said oligonucleotide primers.

7. A method as claimed in any one of claims 1 - 4 wherein, said synthetic oligonucleotide primers are having the sequence

5'- GGATCCAATAGCATCACTCGAC - 3' (SEQ. IDNO.1) 5'-GGATCCATTGAGCATGCGTT - 3' (SEQ. IDNO.2)

8. A method according to claim 1- 4 wherein set of said primers used for the polymerase chain reaction are said oligonucleotides having the following sequence

5' - GGATCCAATAGCATCACTCGAC - 3' (SEQ. IDNO.1) 5' - GGATCCATTGAGCATGCGTT - 3' (SEQ. IDNO.2)

9. A method as claimed in anyone of claims 1 to 4 wherein the oligonucleotide primers employed are derived from 1560 base pair mi ^"23 gene (Gene Bark accession No. G 14732021).

10. A method as claimed in anyone of claims 1 to 4 wherein the set of primers are respectively 22 and 20 nucleotides in length, have a minimum G + C content of 45%, a minimum T_m of 55° C and adapted to amplify a fragment of approximately 390 bases.

11. A set of oligonucleotide primers for the polymerase chain reaction amplification of DNA of virulent strains ofM grisea consisting of

5' - GGATCCAATAGCATCACTCGAC- 3' (SEQ. IDNO.1) 5' - GGATCCATTGAGCATGCGTT- 3' (SEQ. IDNO.2)

12. A set of oligonucleotide primers according to claim 11 that retain the capacity to specifically bind to the target gene prepared by method comprising sequence additions, deletions or mismatches, wherein certain nucleotide residues of the oligonucleotide sequence are not optimally complementary as A - C or G - T or are non-complementary as A - G or T - C, to the corresponding sequence of the specific primers.

13. A kit for PCR based detection and identification ofM grisea from rice seeds and other tissues comprising :

(i) a set of synthetic oligonucleotide primers for the polymerase chain reaction amplification of DNA of virulent strains ofM gi sea consisting of

5' - GGATCCAATAGCATCACTCGAC - 3' (SEQ. ID NO. 1) 5' - GGATCCATTGAGCATGCGTT - 3' (SEQ. ID NO. 2); and (ii) an instruction manual for carrying out detection and identification of M grisea using the same

14. A kit for PCR based detection and identification ofM grisea from rice seeds and other tissues as claimed in claim 13 comprising : i) means to isolate DNA of a virulent strains ofM. grisea from any tissue of a plant such as hereindescribed ; ii) selected oligonucleotide primers which specifically bind to mi 23 gene ; iii) means to carry out amplification of the isolated DNA ; iv) means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light.

15. A kit for PCR based detection and identification ofM grisea from rice seeds and other tissues as claimed in anyone of claims 13 or 14 further comprising: a typical fluorescence pattern after electrophoresing of amplified infected rice DNA to favour comparative analysis with samples to be detected.

16. A kit as claimed in anyone of claims 13 to 15 wherein the oligonucleotide primers employed are derived from 1560 base pair mi ^* 23 gene (Gene Bark accession No. G 14732021).

17. A kit as claimed in anyone of claims 13 to 15 wherein the set of primers are respectively 22 and 20 nucleotides in length, have a minimum G + C content of 45%, a minimum T_m of 55° C and adapted to amplify a fragment of approximately 390 bases.

18. A kit as claimed in anyone of claims 13 to 15 wherein the set of oligonucleotide primers comprise said primers that retain the capacity to specifically bind to the target gene prepared by method comprising sequence additions, deletions or mismatches, wherein certain nucleotide residues of the oligonucleotide sequence are not optimally complementary as A - C or G - T or are non-complementary as A - G or T - C, to the corresponding sequence of the specific primers.

19. A method for manufacture the kit for use in detection and identification of rice blast fungus from rice seeds and other tissues comprising : providing the means to isolate DNA of a virulent strains ofM. grisea from any tissue of a plant ; providing the selected oligonucleotide primers which specifically bind to mi 23 gene ; providing means to carry out amplification of the isolated DNA ; and means to carry out electrophoresing of amplified product and to visualize fluorescent bands under UV light.

20. A method of PCR based detection and identification ofM grisea ,oligonucleotide sequences and a kit for the same substantially as hereindescribed and illustrated with reference to the accompanying figure.