WO2005118844A1 - Addressable molecular probe assembly - Google Patents

Abstract

A molecular probe assembly comprising a homing element (19) comprising a recognition motive (14); a hook element (20) comprising a loop like region (1), said loop like region (1) comprising a target (6) specific site, and said loop like region (1) is stabilized by a double stranded polynucleotide stem region (2, 3, 4), wherein one strand (2) of the stem region (2, 3, 4) is prolonged into an element (17) complementary to at least one part of the recognition motive (14) of the homing element (19). Such molecular probe assemblies are useful for in vitro diagnosis, in particular sepsis.

Description

Specification ADDRESSABLE MOLECULAR PROBE ASSEMBLY

The present invention is directed to a novel type of molecular probe assembly, in particular an addressable molecular probe assembly, such as hairpin probes or addressable bipartite molecular hooks (ABMHs) according to claim 1 , a method for the detection of a target using said ABMHs according to claim 24 and 25, a use of said ABMHs according to claim 35, and a kit comprising the said ABMHs in accordance with claim 43.

More specifically, the invention relates to addressable bipartite molecular hooks (ABMHs) and their application on a solid support.

For the purpose of the present invention, the abbreviations used throughout the specification are defined as following:

μM = micromolar

1F1L1Q = 1 part FDNA, 1 part Loop, 1 part QDNA

1F2L3Q = 1 part FDNA, 2 parts Loop, 3 parts QDNA

ABMH = addressable bipartite molecular beacon ABMHs = addressable bipartite molecular beacons

AC = address complement

AS = address sequence

AS1 = address sequence 1

ASn = address sequence n BHQ = black hole quencher

BODIPY = 4,4-difluoro-5,7-dimethyl-4-bora-3, 4- diaza-s-indacenepropioπic acid cDNA = complementary DNA

DABCYL = 4-(4'-dimethylaminophenylazo)-benzoic acid

DNA = deoxyribonucleic acid

F = fluorescence reporter F1 = fluorophore 1

F2 = fluorophore 2

FAM = 6-carboxy-fluorescein

FDNA = Fluorophore bearing oligonucleotide sequence

FRET = fluorescence resonance energy transfer L = loop

LDNA = Loop oligonucleotide sequence

M = luminescence reporter

MB = molecular beacon

MBs = molecular beacons MCS = multi cloning site

Me = metal mM = millimolar

NASBA = nucleic acid sequence based amplification nm = nanometre P = protein

PCR = polymerase chain reaction

Q = quencher

QDNA = Quencher bearing oligonucleotide sequence qPCR = quantitative PCR qRT-PCR = quantitative reverse-transcription-PCR

R = radioactive reporter

RNA = ribonucleic acid

S/N = signal/noise

SIRS = systemic inflammatory response syndrome TAMRA = tetramethylrhodamine

TMB = tripartite molecular beacon TMBs = tripartite molecular beacons

Dual-labelled DNA hairpin probes were developed to make use of two advantages:

1) Hairpin structures are more discriminative than their linear counterparts with regards to differential hybridization thermodynamics to closely related sequences.

2) To eliminate the labelling step of samples under investigation and separation step between reacted and unreacted counterparts.

To date, two major types of dual-labelled hairpin probes were described in the literature, i.e. molecular beacons (MBs) and tripartite molecular beacons (TMBs).

The molecular beacon (MB) technology (which is shown schematically in Fig. 1) has been developed to palliate some of the problems encountered when using linear DNA hybridization probes. Molecular beacons were first described in 1996 [1]. Classic MBs (Figure 1A) are composed of a target specific sequence (~15-20 bases)(1) flanked by shorter (~5-7 bases) self- complementary sequences (2 and 3) which are completely unrelated to the former one (1); in addition, this structure contains a fluorophore (5) (e.g. FAM, TAMRA) at its 5' end and a fluorescent quencher (e.g. DABCYL, BHQ) at its 3' end 5. In the absence of a target (6), the above self-complementary sequences (2 and 3) anneal (4); in the formed hairpin loop-stem conformation (Figure 1A: "closed state") the fluorophore (5) is brought into the close proximity with the quencher (5). This leads to quenching of a fluorescence signal upon exposure to light with appropriate wavelength. In the presence of a target nucleic acid (6), a thermodynamically much favourable conformational change via its hybridization (7) with the complementary loop sequence (1) occurs. It results in the stem (2 and 3) dissociation and separation of the fluorophore (5) from the quencher(5), thus allowing emission of fluorescence (Figure 1A: "open state"). With regard to MB immobilisation on solid surfaces, e.g. DNA microarray format, the features of this class of probes eliminate the need to label the analysed nucleic acid samples prior to hybridisation to the immobilized polynucleotides, therefore reducing the systematic errors related to the incorporation efficiency, purification yield and hybridization impact upon fluorophore labelling. Moreover, since free MB probe is internally quenched, no special removal step of the probe is required and, thus, represents an ideal "gain in signal" assay with low final background. This allows, in additional application format (e.g. quantitative real-time-PCR), not only to perform assays homogeneously but also to monitor a nucleic acid reaction progress in real time. Another significant advantage of MBs is that they recognize target sequences with a greater degree of specificity than linear probes [2-4]. MBs are readily capable of discriminating between targets that differ by only a single nucleotide due to a competition of the unimolecular hairpin forming reaction with bimolecular probe-target hybridization. For properly designed beacons, the former one occurs at higher temperature than the latter and this difference in the case of match/mismatch beacon pair is bigger than the difference in melting temperatures of corresponding linear oligonucleotide probes pair [5].

Several modifications of the classic MB form have been described such as two fiuorophores bound to each other on the 5'end and a quencher on the 3' end (wavelength-shifting: [6]); one fluorophore on each 5' and 3' end (no quencher) (Resonance Energy Transfer [7] in particular FRET: [8]); one metal ion on each 5' and 3' end (luminescent probes: [7, 9]).

Attachment of classic MB (= triple modified oligonucleotide) to diverse solid surfaces (e.g. fiber optic: [10]; glass beads: [11]; solid silica surface: [12]; agarose film: [13]) have been realised by modifying a classic MB with a linker attached to its stem [12], to the quencher [11] or to the fluorophore [10]. MB bound on its 5' to a solid support sprayed with gold and a fluorophore on the 3' end and the quencher [14] has also been reported.

However, there are important drawbacks associated with this technology. Triple modifications (i.e. fluorophore, quencher, linker) are needed for classic MBs to be immobilised resulting in a complex synthesis, increased purification and quality control steps leading to exorbitant costs. One new MB must be synthesized for every additional target under investigation.

Furthermore, solid support assays with MBs modified by the introduction of an appropriate linker/spacer and spotted directly as folded molecules or molecules to be refolded after the immobilization processes have proven to be difficult, primarily with regards to initial background level upon immobilization and, thus, low dynamic range of resultant data. The reasons, obviously, relate to the strong conformational requirements for MB molecules and correspondingly, to the sensitivity of folding process to sterical and/or electrostatic hindrances from the solid support [15, 16]. High ionic strength/salt content of spotting buffers can partially alleviate the latter type of hindrances [13]. However, under these conditions the possibility of beacon dimer formation [17] greatly increases, especially during spot maturation given drastically increased local concentration due to microscopic spot volume and its fast drying. This leads to MB assemblage problems, increased background and decreased immobilization efficiency. In particular, the attachment of MB to a solid support by chemical reactions partially affords bound structures, which are unable to hybridise with target sequences. These problems, thus, require a search for optimized compositions of spotting buffers and corresponding post-spotting surface proceedings as well as further modifications of the linker/spacer part of MBs [12, 18,19]. Finally, spotted MBs have a reduced sensitivity and specificity compared to their solution counterparts [12]. Frutos and colleague have introduced in 2001 [20] a bimolecular linear probe system to try solve the immobilisation problems inherent to MB. However, this system was exclusively designed for SNP analysis and the author relied on linear probes to which a single mismatch was inserted. Several problems linked to this technology were mentioned [20]. First, each duplex (artificial mismatch/match and artificial mismatch/mismatch) form on the array has to be optimised with regards to their stability. Secondly, the system is dependant upon the identity of the mismatch base and the nearest neighbours and will greatly affect the results. Finally, linear probes are less sensitive and therefore discriminative than hairpin probes [5].

Nutiu and Li [18,19] introduced an other class of MB called tripartite molecular beacons (TMBs) (Figure 1 B) to resolve some of the above mentioned issues, in particular with regards to the modification of MBs to suit new targets and their immobilisation procedures. TMBs (Figure 1 B) are composed of three oligonucleotide sequences forming a classic "stem and loop" structure (1 , 2 and 3) flanked by two extra double stranded structures (9, 11 and 10, 12). The latter are formed by different oligonucleotides which have the same length, respectively termed FDNA (8) and QDNA (9) each being complementary to a corresponding extended stem arm of former hairpin structure (Figure 1 B). The FDNA structure carries the fluorophore (5) and the QDNA the quencher (5). The complementary parts of these three different oligonucleotides form the whole TMB structure via base pairing. The mode of action of the TMB is identical to the one of classic MBs i.e. upon target binding, a conformational change occur bringing the beacon's stem to dissociate and separate the fluorophore from the quencher, leading to fluorescence.

Compared to the classic MBs, TMBs are easily modified to fit new targets (i.e. a change into any new target(s) would only require redesigning and synthesizing the central part(s). Due to the separate strands to which either the fluorophore or the quencher are coupled, these remain the same and stock solution can be manufactured. Therefore the production will be more cost effective. Moreover, to date, TMBs are the more flexible approach to changing the fluorophore, therefore facilitating multiplex experiments, however due to the orientation of and position of quencher on QDNA, restriction in the choice of possible fluorophore or quencher occur (e.g. BODIPY630/650 chemistry does not allow its coupling to QDNA).

However, these TMB structure still display major disadvantages.

Solution experiments showed TMBs to have a lesser specificity when compared to classical MBs due to obvious structural features [18,19].

Exceeding the Foerster radius [21] of the fluorophore/quencher pairs (usually 1-10 nm) is necessary for the FRET to occur, given that theoretically this pair is separated by three DNA double helices compared to one in the MB, the radius of each being 2.3 nm;

Along with the above problem, there are difficulties with the forming of a base pair at the outside edge (towards F- and QDNA) of the beacon's stem due to the overcrowding effect and base-stacking forces at the location where all three DNA duplexes forming the TMB meet and convert into each other [18,19]. This extends the distance between the fluorophore and the quencher even further and poses the problem of optimizing the conditions for the proper TMB folding; additionally, the problem of optimized TMB design becomes of great importance.

The possibility of binding TMBs onto solid surfaces via the central part have been mentioned [19]. However, the immobilization of TMBs onto solid surfaces has not yet been demonstrated. There are several reasons why immobilization of TMBs on solid surfaces is problematic. The loop has to perform both functions, being an attachment site and a target hybridization site. This will lead to folding problems of the TMB's central part (false positives) as well as loop accessibility for the target molecules due to sterical hindrance from the stem and sequences complementary to F- and QDNA elements.

Attempts in changing TMB immobilization procedure via coupling through aminolink-modified FDNA, QDNA or both (i.e. FDNA + QDNA), performed by our group led to complications of pre-spotting procedure (performing a folding reaction for the TMB to form prior to spotting), complications of spotting procedure(a composition of spotting buffers have to be carefully designed) and complications of the post-spotting procedure (harsh conditions with regards to ionic strength, detergent presence and temperature have to be avoided) due to the need to form and preserve the TMB structure.

In particular for preformed TMBs, upon their immobilization via FDNA, QDNA or FDNA + QDNA as opposed to the process described by Nutiu et al. [18,19], the bulky structures will pose a crowding effect problem, namely a problem of accessibility to the surface active groups for efficient immobilization reactions.

Furthermore, the presence of universal complementary strands can lead to intermolecular recombination (exchange of F- and QDNAs) during immobilization and, thus, to unordered/random assemblage. This unordered/random assemblage occurs due to an excess of surface-active groups compared to the maximal density of preformed TMB. Moreover, leakage of TMBs could not be excluded, i.e. a possibility that the central part of the structure dissociates at any stage of the experiment and binds at other location due to the universality of FDNA and QDNA sequences. Regarding the problems of the prior art of the molecular beacons technology described above, there is a need for novel probe formats that provide a higher specificity and sensitivity.

Furthermore, there is a need for an increased specificity of the immobilization process affording a high yield of probes ready for target hybridization.

These needs can be met by novel assembly-probes allowing addressable immobilization of these probes onto solid surfaces, in accordance with claim 1 , by a method of detecting a target in accordance with claims 24 or 25, a use of the assemblys in accordance with the present invention according to claim 35, and a kit in accordance with claim 43.

The dependant claims contain preferred embodiments of the present invention.

Further features and advantages of the present invention will be apparent from the description of examples and by means of the accompagnying drawings:

It is shown in:

Figure 1 : The prior art of molecular beacons;

Figure 2A: Individual components of ABMH;

Figure 2B: Individual components of ABMH (closed and assembled form);

Figure 3A: Individual components of a preferred embodiment of ABMH;

Figure 3B: A preferred embodiment of ABMH (closed and opened state); Figure 4: an illustration of a use for the investigations of gene expression with ABMH; Figure 5A: the homing elements as schematically arranged on a solid support; Figure 5B: the homing elements and the hook elements as schematically arranged on a solid support; Figure 6: an MB (Traf2) melting curve; Figure 7: a TMB (Traf2) 1 F 1 L 1 Q melt cuπ/e; Figure 8: a TMB (Traf2) 1 F 2L 3Q melt curve; Figure 9: an ABMH (Traf2-Bodipy) melt curve;

Figure 10A an ABMH (Traf2-bodipy) array Bodipy vs. TAMRA ratio table; Figure 10B an ABMH (Traf2-bodipy) array Bodipy vs. TAMRA ratio graph; Figure 11A an ABMH (Traf2-bodipy) array hook vs. target ratio table; and Figure 11 B an ABMH (Traf2-bodipy) array hook vs. target ratio graph.

List of used Reference Numerals

1 = Loop like region

2 = Complementary sequence 1 (CS 1)

3 = Complementary sequence 2 (CS 2)

4 = Hybridised CS 1 + CS 2 = stem 5 = Modification

6 = Target

7 = Hybridized Loop/target

8 = FDNA

9 = QDNA 10 = LDNA complementary sequence to FDNA

11 = LDNA complementary sequence to QDNA

12 = Hybridised FDNA/ LDNA complementary sequence to FDNA

13 = Hybridised QDNA/ LDNA complementary sequence to QDNA

14 = recognition motive 15 = Spacer

16 = Linker 17 = Address complement

18 = Hybridised address sequence/ address complement

19 = Homing element

20 = Hook element 21 = Target specific site

The present invention describes a novel type of hairpin probes (Figure 2 A and B) called addressable bipartite molecular hooks (ABMHs) which solves most of the unanswered problems that one faces when using MB and TMB technologies. Unlike the problems associated with prior art, the present invention utilizes a novel structural approach to allow specific, leakage free localisations of the structure with greatly improved immobilisation, structure formation and hybridization procedures.

DESCRIPTION OF THE ASSEMBLY

The ABMH (Figure 2 A, B) as molecular probe assembly according to the present invention is comprised of: a homing element (19) comprising a recognition motive (14); a hook element (20) comprising a loop like region (1), said loop like region (1) comprising a target (6) specific site, and said loop like region (1) is stabilized by a double stranded polynucleotide stem region (2,3,4), wherein one strand (2) of the stem region (2,3,4) is prolonged into an element (17) complementary to at least one part of the recognition motive (14) of the homing element (19) .

In preferred embodiment, ABMH (Figure 3 A and B) is composed of 1) the the homing element (19) in form of a homing sequence (19), particularly a polynucleotide, DNA or RNA, or amino acid sequence, comprises a unique address sequence (14), flanked by spacer sequence (15), a surface-reactive linker (16) and a modification (5) 2) the hook element (20) is composed of a classic loop (1) stabilized by the stem (2,3,4), one strand (2) of which is prolonged into a sequence (17) complementary to the address sequence (14), the other(3) bears a modification (5).

The loop (1) encompasses the binding segment. In a preferred embodiment the binding segment span across the entire loop sequence.

The target specific site (21) may comprise of several partial sequences or a sequence complementary to or being recognized in general by a specific target sequence or a multi-cloning site (MCS) for insertion of any desired probe sequence. In a preferred embodiment, the homing element (19) is composed of four distinct parts being a linker (16), a spacer (15), an address sequence (14), a modification (5) and the hook element (20) of five distinct parts being a sequence (17) called address complement complementary to the address sequence (14), target specific site (21), a second complementary sequence (3) adjacent to (1) and complementary to the said first complementary sequence (2), a modification (5).

The ABMH may be composed of any chemical structures and/or subunits able to recognize and/or bind target molecules applying any mechanism for subsequent detection of this event.

The modifications (5) on the homing element (19) and hook elements (20) can be identical or different.

The modification (5) or the means for distinguishing between an open and a closed state of the assembly of the present invention can be any moiety that allows observing the various changes in states of the probe assembly. The modifications are know by those skilled in the art and could be for example at least a fluorescent reporter (F), a luminescent reporter (M) a metal (Me), a protein (P), a radioactive reporter (R), a quencher (Q) or a molecule which can bind additional reporter molecules. The use of fluorescent reporters as described in the present invention are for example purposes only and are not intended to restrict the scope of this invention. In a preferred embodiment, a fluorophore (F1) is covalently linked to the homing sequence oligonucleotide as a homing element and a fluorophore (F2) to the hook element oligonucleotide

In another preferred embodiment, a quencher is covalently linked to the homing element and a fluorophore to the hook element. ln a further preferred embodiment, a fluorophore is covalently linked to the homing element and a quencher to the hook element.

Without presence of a target sequence (6), the hook element (20) will hybridize (18) to its corresponding homing element (19) via the corresponding address sequence (14) and address complement (17). ABMH will therefore assume its hairpin structure by complementation of a first complementary sequence (2) to second complementary sequence (3), therefore bringing the structure into a "closed" conformation(Figure 3B "closed and assembled form") whereby a fluorophore (5) is quenched by a quencher (5) (no fluorescence) or transferred to a fluorophore (5) (FRET). The melting point of the probe-target duplex (7) is approximately equal (plus- minus a few degrees Centigrade) to the melting point of the stem (4) formed between first complementary sequence (2) and second complementary sequence (3).

ABMH is such that address sequence (14)/ address complement (17) hybrids do not dissociate upon formation of the target specific site (1)/target /(6) duplex (7) due to their increased length and sequence content.

ABMH is such that the first complementary sequence (2)/second complementary sequence (3) hybrids (4) dissociate upon formation of the target specific site (1)/target /(6) duplex (7).

DESCRIPTION OF THE METHODS

The present invention also provides methods for using ABMHs.

The method of the present invention includes a method for the detection of a target (6) using the assembly in accordance with the present invention, comprising the following steps: a. reacting at least one hook element (20) with its corresponding target (6); b. addressing a formed hook element-target (δ)-complex to the, homing element; and c. detecting a signal generated by means (5) for distinguisihing between a closed and open state of the assembly.

In another embodiment, the subsequent steps involve: a. reacting at least one hook element (20) with its corresponding homing element (19); b. reacting at least one target (6) with its corresponding addressed assembly according to anyone of claims 1 to 23; and c. detecting a signal generated by means (5) for distinguisihing between a closed and open state of the assembly.

The order of steps thus is interchangeable.

In a preferred embodiment, the homing element is first immobilized on a solid support via putting into contact the reactive group contained in the spacer with a reactive group contained on the modified surface of a solid support.

The solid support can be any support enabling the immobilization of the said homing element. Examples of the solid support can be a slide, a bead, a column, a microtitre plate, a tube, a membrane, an optic fibre or a nanoparticle. The use of slides as described in the present invention are for example purposes only and are not intended to restrict the scope this invention. In the above-mentioned methods, it has to be understood that one or several hook element/ABMBH can be reacted with one or several targets, individually, in combination or in a complex mixture.

Targets has to be understood as being of any biological origin such as Human, animals, plants, invertebrates, lower eukaryotes, prokaryotes or viruses. Examples of biological samples could be tissue, body fluids and cells. Targets can also be nucleic acids, peptides and proteins, or of synthetic origin such as nucleic sequences, peptide-nucleic-acids, protein, peptides, peptidomimetic or aptamers.

DESCRIPTION OF THE USE

The present invention also describes uses of ABMH.

Possible uses of ABMH are the investigation of nucleotides and/or proteins, such as detection/separation/analysis of specific nucleotides, proteins or low molecular weight molecules.

Examples for these uses are gene expression analyses, genotyping analyses, real-time monitoring of nucleic acid amplifications, analyses of protein-DNA interaction and/or protein-RNA interactions either in solution or onto a solid support (e.g. qRT-PCR, qPCR, real-time NASBA, etc.), sequencing or high-throughput screening etc.

The design of ABMH is particularly advantageous as component of a microarray, of integrated analytical systems (lab-on-a-chip systems) or as part of an in vitro/ex vivo diagnostic kit in connection with a electronic evaluation system or a patient data management system. The specific design of ABMH combines the advantages of simple nucleotide immobilization with the high specifity and sensitivity displayed by hairpin probes in solution.

The following description of a use of ABMH according to the invention for gene expression investigations by means of their addressable characteristics herein described is for example purposes only and is not intended to restrict the scope this invention (Figure 4).

1) Homing sequences as homing elements will be designed to contain one address sequence (AS) among ASi to AS_π (Figure 5 A: Numbers 1 , 2, 3, ...., n represent address sequences being all different from each other and used for spatial localisation on a solid support). These homing sequences will be individually ordered on a solid support such as a microscope slide.

2) After proper immobilization, the various hook elements will be applied on the pre-spotted homing sequence array, resulting in the proper addressing of each individual hook element. Resulting array will be washed and checked for their "closed state" (Figure 5 B).

3) RNA will be extracted from a patient blood sample as well as a reference sample (e.g. healthy volunteer). Optionally, both RNA samples can be reverse transcribed to obtain cDNA.

4) Nucleic acids (RNA or cDNA) obtained from the patient and reference samples will be hybridized in parallel to separate slides under the same conditions.

5) Fluorescent signals will be recorded and the data collected will display side by side the fluorescence patterns of the sample under investigation and the reference. The data can then be normalised according to known techniques for those skilled in the art, leading to the evaluation of the differential gene expression between the sample under investigation and the reference.

It is possible to extend such a system to a multiplicity of fluorophores and hook element sets, which will allow displaying several fluorescent patterns onto 1 slide. By this, it is possible to design several different areas representing different severities or grads of a disease. This would be paramount for the in vitro diagnostic field such as in oncology, inflammation, genetic diseases, etc. Such a design applied to the Sepsis field, for example, can represent the various stages namely: SIRS, sepsis, severe sepsis, septic shock, multiple organ failures.

In a preferred embodiment the use of ABMH for in vitro diagnosis and therapy monitoring for sepsis by means of their addressable characteristics herein described is for example purposes only and is not intended to restrict the scope this invention.

1) Homing sequence will be designed to contain one address sequence (AS) among ASi to AS_π (Figure 5 A: Numbers 1 , 2, 3 n represent address sequences being all different from each other and used for spatial localisation on a solid support). These homing sequences will be individually ordered on a solid support usable within a lab-on-chip system.

2) Hook elements will be designed for the various marker target sequences. These target sequences are representative of gene clusters corresponding to the various stages of the disease, i.e. SIRS, sepsis, severe sepsis, septic shock, multiple organ failures (defined according to [22]). These hook elements will all bear the same fluorophore per cluster (e.g F1 = SIRS, F2 = sepsis, F3 = severe sepsis, etc.) but will each have one different address complement (AC) from 1 to n. 3) The various hook elements will be applied on the pre-spotted homing sequence array, resulting in the proper addressing of each individual hook element. Resulting array will be washed and checked for their "closed form" (Figure 5 B).

4) RNA will be extracted from a patient blood sample. Optionally this RNA sample can be reverse transcribed to obtained cDNA.

5) Nucleic acids (RNA or cDNA) obtained from the patient sample will then be applied onto the slide. The resulting hook elements will hybridised to their respective targets from the patient sample.

In a preferred embodiment, the ABMH according to the invention can be used for the determination of efficacy and toxicity in drug screening and/or for the production of drugs as well as compounds used for drug production.

In another preferred embodiment the ABMH according to the invention can be used for the detection of synthetic contaminants in organisms, food, drugs, environment.

DESCRIPTION OF THE KITS

The invention also provides a kit for the use of ABMH and the simultaneous detection of multiple targets in a simple manner.

The kit comprises:

1) Several individual homing sequences containing either an identical reporter or a quencher. 2) Several individual hook elements containing either an identical reporter or a quencher, so that the complete ABMH has a reporter /quencher pair or vice versa or a identical reporter / reporter pair.

In a preferred embodiment, the kit comprises:

1) Several individual homing sequences containing either a different fluorophore or a quencher.

2) Several individual hook elements containing either different fluorophore or a quencher, so that the complete ABMH has compatible a fluorophore /quencher pair or vice versa or a compatible fluorophore / fluorophore pair.

The invention also provides a kit for the addressable immobilisation of ABMH and the simultaneous detection of multiple targets in a multiplex manner. Multiplexing is of particular use for the assessment/monitoring of single nucleotide polymorphisms (SNP).

The kit comprises:

1) Several individual homing sequences containing either a different reporter or a quencher.

2) Several individual hook elements containing either different reporter or a quencher, so that the complete ABMH has compatible a reporter /quencher pair or vice versa or compatible a reporter / reporter pair.

In all the above described kits, it has to be understood, that the binding sequence of individual hook element may comprise a known sequence complementary to a specific target sequence or a multi cloning site (MCS) for insertion of any desired probe sequence. DETAILED DESCRIPTION OF THE INVENTION VIA TWO EXAMPLES.

Two Examples demonstrate the feasibility and the improvement resulting from novel dual-modified hairpin probes according to the invention (ABMH). Using MB and TMB technologies for immobilisation onto a solid support have proven inadequate and/or expensive and lots remain to be done with respect to immobilisation procedures, proper addressing of the loop to a specific location, increasing their specificity as well as reducing background., Using the novel type of hairpin probes according to the invention the above mentioned issues have been eliminated.

1) Example 1 illustrates the thermal denaturation profile and specificity of MB, TMB and ABMH.

2) Example 2 illustrates the immobilisation of ABMH onto a modified glass surface, its hybridization with complementary target and the determination of the resulting signal/noise ratios.

For these 2 examples, the following MB, ABMH and TMB were used.

MB- (TAMRA)-gCACg T GGGGGAAGGAGCCAC CAGCCAG TCCAcgTgC- (DABSYL)

ABMH- Homing sequence as Homing Element:

5' Amino C6-dT- l I I I I I I I I I I I I I I ACTgACTgACTgAcTgACTgACTgACTgAC TAMRA 3' Hook elements: hook element TRAF-BODIPY: 5' BODIPY630-

GCACGTGGAAGGAGCCACCAGCCAGTACG

TGCCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGT-3'

TMB- FDNA^*:5' TAMRA-GCGGAGCGTGGCAGG-2 X SPACER 18-[ AMC7] 3' QDNA*:3' DABCYL-GAGCGTGGCAGGTGG-(2 X SPACER 18-[AM UNI]) 5' LDNA: 5' CCTGCCACGCTCCGCGCACGTGGAAGGAGCCACCAGCCAGTACG

TGCCTCGCACCGTCCACC 3'

* Modified sequences: originals from Nutiu and Li[19]

Targets: Traf target:

5'GTCTCTGAAATCTGAGGACTGGCTGGTGGCTCCTTCCCCC GTGTCAGTGAACTTG 3'

FAM-labelled Traf target: 5'GTCTCTGAAATCTGAGGACTGGCTGGTGGCT CCTTCCCCCGTGTCAGTGAACTTG-FA 3'

Irrelevant target:

ACCTTTTACAGAACGATCTCTTCACTTCCTGCCCAGCAGAC ATTCATACTGTTTCCT (To assess for target specificity).

Example 1 :

TMB experiments were performed with 1 part FDNA, 1 part Loop, 1 part QDNA (1 F 1 L 1Q) or with 1 part FDNA, 2 parts Loop, 3 parts QDNA (1 F 2L 3Q). The latter being equivalent to what was described in Nutiu and Li [19]. Thermal denaturation profiles from MB (Traf2) were determined in buffers having three compositions to assess their functioning in various salt concentrations (buffer 1 : 20 mM Tris-HCI, pH δ.Oand 1 mM MgCI₂ , buffer 2: 10 mM Tris-HCI, pH 8.0, 50 mM KCI and 4 mM MgCI₂, buffer 3: 10 mM Tris- HCl, pH 8.0, 10 mM KCI and 2 mM MgCI₂). Thermal denaturation profiles from TMB (Traf2) 1 F1 L1 Q, TMB (Traf2) 1 F2L3Q, ABMH (traf2-bodipy) were determined in the TMB buffer (10 mM Tris-HCI, pH 8.3, 0.5 M NaCl and 3.5 mM MgCI₂) described by Nutiu and Li [19] for comparison purposes. The respective DNA mixtures were heated to 95°C for 5 minutes, then cooled to 80°C were the fluorescence was first measured. Subsequently, the temperature was decrease by 1°C per min and fluorescence recorded at each temperature plateau for 1 min. The temperature profile are presented in figure 3.

Melting curves (Figure 6) performed with buffers containing various salt concentrations and MB(Traf2) with or without target, i.e. classic molecular beacon design for solution experiments, proved the design to be successful. However, due to the immobilisation limitations previously mentioned, this design was set out to be transfered to TMB and their efficiencies assessed.

Thermal denaturation profiles obtained from various FDNA (Figure 1 B, 9), LDNA(Figure 1 B, 11 ,2,1 ,3,12) and QDNA(Figure 1 B, 10) stochiometries were performed. The melting curves (Figures 4 and 6) did not display all the usual marked characteristics (Tyagi and Kramer, 1996) of a typical MB melt curve despite the use of the described optimised TMB buffer, due to the various conformational restrictions of their complex structure. TMB (traf2) 1 F1 L1 Q (S/N -1.5) and TMB (traf2) 1 F2L3Q (S/N ~2) gave similar signal/noise ratios when either analysed under FRET or no FRET conditions (Figures 7 and 8). However, target specificity (using an irrelevant target) was shown to be dependant upon the stochiometry used, where TMB (traf2) 1 F 1 L 1 Q (Figure 7) displayed a better discrimination than TMB (traf2) 1 F 2L 3Q (Figure 8). In contratst to the TMB results, similar experiment using an irrelevant target in combination with ABMH according to the invention resulted in a signal identical to the no target signal (Figure 9).

A system equivalent to the ABMH FRET combination for TMB(Traf2) was not possible as the TMB structure restricts the choice of fluorophore (Bodipy's chemistry can not allow coupling to the 3' end of QDNA). A FRET system with the TMB structure via 3' FAM labelling of the target was designed and resulted in similar signal/noise ratios between 12 to 40°C. However, the resulting TMB curve obtained was not displaying the characteristics of a typical MB melt curve as obtained with ABMH according to the invention and would result in an increased fluorescent background and a lower sensitivity.

When the classic MB structure of MB(Traf2) was transferred to the ABMH structure according to the invention , the usual marked characteristics of a typical MB melt curve were clearly displayed demonstrating that this new structure possesses the solution characteristics of classic MB. These advantages were also demonstrated with regards to sensitivity, suggesting that hybridisation of hook element to its target in solution prior to hybridisation of the resulting complex to a solid support will be as discriminating as their MB equivalent in solution (see Example 2 for the complementary results).

Example 2:

This example demonstrates the proper functioning of this novel design when ABMH according to the invention are immobilised and addressed onto a solid support. No comparison with spotted MB and TMB equivalent was possible as these did not display any visible difference when in presence or absence of target, despite the many conditions assessed (e.g. for TMB: immobilisation via modified FDNA, or both modified FDNA and modified QDNA, various spotting and hybridisation buffers, slide chemistries, etc.) and that a comparable and appropriate FRET system could not be obtained due to the TMB design limitations ( see example 1).

First, dilution series of 3'-end TAMRA modified homing sequence as well as relevant positive and negative controls were prepared in various spotting buffers and arrayed on three- dimensional modified glass surface (3-D CodeLink™, Amersham, U.K.) Hook element TRAF, modified at 5'-end with BODIPY630/650, and its target were subsequently hybridized and fluorescence was recorded after each of these hybridizations via confocal epifluorescence scanner. In addition, the initial TAMRA fluorescence signal intensities of spots of homing sequence after immobilization were recorded. All resulting data were normalized and BODIPY630/650/TAMRA ratios calculated (Figures 10,11).

It was clearly shown that hook element hybridizations resulted in proper ABMH assemblage, as BODIPY630 signal appeared and, in parallel, a concomitant decrease of TAMRA signals (via FRET with BODIPY630) was observed (Figure 10 A and B).

Therefore, spot-specific BODIPY630/TAMRA ratios were obtained. After target hybridization, the resultant ratios pointed to the proper ABMH functioning as the above ratios were approximately 2-3 times lower than those obtained in previous step. The signal (with target)/noise (without target) ratio obtained in solution was around a 5 fold increase (Figure 9). On slide (Figure 11 A and B), this ratio was in most buffer conditions >2. It is known in the art that the signal/noise ratio is significantly decreased when these probes are immobilised on a solid support due to surface interferences such as, for example, those of spatial [15] or electrostatic [16] nature. In the example 2 of the present invention, the loss in signal/noise ratio (Figure 11 A and B) is <2.5 fold which is considerably better than what has been reported to date (e.g. [12]: (S/N) loss using classic modified MB is nearly 10 fold (S/N in solution - 10 fold, S/N attached- 1.6 fold)). It is worthy to note that ABMH S/N ratio is relatively constant across the various buffer and concentration ranges used during this example (Figure 11 A and B). The inconsistency at 5 μM is due to the fact that at this concentration the spot intensity becomes saturated rendering the S/N ratio difficult to assess (11 A and B).

Furthermore, the sensitivity at 1 μM and 0.2 μM are similar showing the possibility to use minimal amount (e.g. 0.2 μM) of ABMH for an equivalent signal (Figure 9). In comparison, reported spotting concentration of linear labelled oligonucleotide starts from 25 μM (100 fold more than ABMH) and MB probes [23] at 50 μM (200 fold more than ABMH). When the high MB synthesis price and the resulting array price are taken into account, the use of ABMH would results in considerable savings.

In the proposed scheme the immobilization and assemblage were performed in two steps, each dealing with specific component of the final composed structure.

First, a linear oligonucleotide was immobilized. In a subsequent step, final assemblage was performed in solution via hybridization. This solves the problem of unordered immobilization/assemblage of prior art structures.

Hybridization of hook elements to a long homing sequence brings the fluorophore away from the surface, and therefore eliminates the effect of surface interactions with the structure.

In summary the present invention demonstrates that the ABMH design resolves the following problems compared to prior art.

1. Loss of specificity when system transferred to TMB compared to classic MB design.

2. Loss of sensitivity and specificity in classic MB arrays 3. Proper immobilization, addressing of the hook elements and functioning of immobilized AMBH.

References

1. Tyagi S. and Kramer F. R., (1996), Molecular beacons: Probes that fluoresce upon hybridisation, Nat. Biotech, 14: 303-308.

2. Kostrikis L G., Tyagi S., Mhlanga M. M., Ho D. D and Kramer F. R. (1998) Spectral genotyping of human alleles. Science, 279: 1228-29.

3. Marras S. A., Kramer F. R. and Tyagi S. (1999) Multiplex detection of single-nucleotide variations using molecular beacons. Genet. Anal., 14: 151-6.

4. Dubertret B., Calame M. and Libchaber A. (2001) Single-mismatch detection using gold-quenched fluorescent oligonucleotides. Nat. Biotechnol., 19: 365-70.

5. Bonnet G., Tyagi S., Libchaber A., Krammer F. R., (1999), Thermodynamic basis of the enhanced specificity of structured DNA probes, Proc. Natl. Acad. Sci. USA, 96: 6171-6176.

6. Tyagi S., Maras S. A. E., Kramer F. R., (2000), Wavelength-shifting molecular beacons, Nat. Biotech, 18: 1191-1196.

7. US 2003/01296011 : Dual resonance energy transfer nucleic acid probes, Xu Y. Bao G., Tsourkas A.

8. Zhang P., Beck T., Tan W., (2001), design of a molecular beacon DNA probe with two fluorophore, Angew. Chem.. Int. Ed., 40 (2): 402-405. 9. Joshi H. S., Tor Y., (2001), Metal-containing DNA hair-pins as hybridisation probes, Chem. Comm., 549-550.

lO. Steemers F. J., Ferguson J. A., Walt D. R., (2000), screening unlabelled DNA targets with randomly ordered fiber-optic gene arrays, Nat. Biotech, 18: 91-94.

11. Brown L. J., Cummins J., Hamilton A., Brown T., (2000), Molecular beacons attached to glass beads fluoresce upon hybridisation to target DNA, Chem. Comm., 621-622.

12. Fang X., Liu X., Schuster S., Tan W., (1999), Designing of a novel molecular beacon for surface-immobilised DNA hybridisation studies, J. Am. Chem. Soc, 121 : 2921-2922.

13.Wang H., Li J., Liu H., Liu Q., Mei Q., Wang Y., Zhu J., He N., Lu Z., (2002), Label-free hybridisation detection of a single nucleotide mismatch by immobilisation of molecular beacons on an agarose film, Nucl. Ac. Res., 30 (12): e61.

14. Du H., Disney D., Miller B. L, Krauss T., D., (2003), Hxbridisation-baxsed unquenching of DNA hairpins on Au surfaces: prototypical ..molecular beacon" biosensors, J. Am. Chem. Soc, 125: 4012-4013.

15. Shchepinov, M.S., Case-Green, S.C. and Southern, E.M. (1997) Steric factors influencing hybridization of nucleic acids to oligonucleotide arrays. Nucleic Acids Res. 25(6), 1155-1161.

16.Vainrub A., Pettitt M. Coulomb blockage of hybridization in two- dimeentional DNA arrays. (2002) Physical Review E 66, 041905. 17. Monroe W.T., Haselton F.R. Molecular beacon sequence design algorithm. (2003) BioTechniques 34: 68-73.

18. Nutiu R., Li Y., (2002), Tripartite molecular beacons, Nucl. Ac. Res., 30 (18): e94

19. WO 03/054223 (2002): Tripartite molecular beacons, LI Y., Nutiu R.

20. Frutos A. G., Pal S., Quesada M., Lahiri J., (2002), Mehtod for detection of single-base mismatches using bimolecular beacons, J. Am. Chem. Soc, 124 (11):2396-2397.

21. Foerster, T. (1948). Annalen der Physik, 2, 55-75

22. Bone RC, Balk RA, Cerra FB, Dellinger EP, Fein AM, Knaus WA, Schein RM, Sibbald WJ, the ACCP/SCCM Consensus Conference Committee (1992) Definitions for Sepsis and organ failure and guidelines for the use of innovative therapies in Sepsis. Chest 101 ,1656-1662; and Crit Care Med 1992; 20: 864-874.

23. Ramachandran A., Flinchbaugh J., Ayoubi P., Olah G. A., Malayer J. R., (2003), Target discrimination by surface-immobilsed molecular beacons designed to detect francisella tularensis, Biosens. Bioeleα, 19 : 727-736.

Claims

Claims

1. A molecular probe assembly comprising: a homing element (19) comprising a recognition motive (14); a hook element (20) comprising a loop like region (1), said loop like region (1) comprising a target (6) specific site, and said loop like region (1) is stabilized by a double stranded polynucleotide stem region (2,3,4), wherein one strand (2) of the stem region (2,3,4) is prolonged into an element (17) complementary to at least one part of the recognition motive (14) of the homing element (19) .

2. Assembly according to claim 1 , wherein the assembly is capable of being in a closed state when a target (6) is not attached to its target specific site (21), and said assembly is capable of being in an open state when a target (6) is specifically attached to its target specific site (21).

3. Assembly according to claim 1 or 2, wherein the assembly includes means (5) for distinguishing said closed and open state, in order to determine whether a target (6) is specifically attached to its target specific site (21) on said loop like region (1) of hook element (20).

4. Assembly according to anyone of claims 1 to 3, wherein the molecular probe assembly is an addressable bipartite molecular hook.

5. Assembly according to anyone of claims 1 to 4, wherein the recognition motive (14) is a nucleic acid sequence, or an amino acid sequence or a sequence of sythetic analogs of nucleic acids or amino acids.

6. Assembly according to claim 5, wherein the recognition motive (14) is a unique address sequence.

7. Assembly according to anyone of claims 1 to 6, wherein the homing element (19) bears at least one modification (5).

8. Assembly according to claim 7, wherein the modification (5) is a fluorescent reporter, a luminescent reporter, a metal, a radioactive reporter, a protein, a quencher or a molecule which can bind additional reporter molecules.

9. Assembly according to anyone of claims 1 to 8, wherein the homing element (19) comprises a spacer (15) .

10. Assembly according to anyone of claims 1 to 9, wherein the homing element (19) comprises a linker (16) .

11. Assembly according to anyone of claims 1 to 10, wherein the loop like region (1) and the stem region (2,3,4) of the hook element (20) is a nucleic acid sequence, in particular a DNA or RNA sequence.

12. Assembly according to claim 11 , wherein the loop region (1) comprises several partial sequences or a sequence complementary to or being recognized in general by a specific target (6) sequence or a multi-cloning site.

13. Assembly according to anyone of claims 1 to 12, wherein the element (17) of the hook element (20) complementary to at least one part of the recognition motive (14) of the homing element (19) is a nucleic acid sequence, or an amino acid sequence or a sequence of sythetic analogs of nucleic acids or amino acids.

14. Assembly according to claim 13, wherein the element of the hook element (20) is an address complement sequence complementary to the address sequence (14) of the homing element (19).

15. Assembly according to anyone of claims 1 to 14, wherein the hook element (20) bears at least one modification (5).

16. Assembly according to claim 15, wherein the modification (5) is a fluorescent reporter, a luminescent reporter, a metal, a radioactive reporter, a protein, a quencher or a molecule which can bind additional reporter molecules.

17. Assembly according to anyone of claims 1 to 16, wherein the homing element (19) and the hook element (20) bears the same modification (5).

18. Assembly according to anyone of claims 1 to 16, wherein the homing element (19) and the hook element (20) bears different modifications (5).

19. Assembly according to anyone of claims 1 to 18, wherein a fluorophore is covalently linked to the homing element (19) and another fluorophore is covalently linked to the hook element (20).

20. Assembly according to anyone of claims 1 to 18, wherein a quencher is covalently linked to the homing element (19) and a fluorophore is covalently linked to the hook sequence (20).

21. Assembly according to anyone of claims 1 to 18, wherein a fluorophore is covalently linked to the homing element (19) and a quencher is covalently linked to the hook sequence (20).

22. Assembly according to anyone of claims 1 to 21, wherein the address sequence/address complement hybrids do not dissociate upon formation of the binding sequence with the target (6) sequence.

23. Assembly according to anyone of claims 1 to 22, wherein the first complementary sequence/second complementary sequence hybrids dissociate upon hybrid formation between the binding sequence with the target (6) sequence.

24. Method for the detection of a target (6) using the assembly in accordance with claims 1 to 23, comprising the following steps: a. reacting at least one hook element (20) with its corresponding target (6); b. addressing a formed hook element -target (δ)-complex to the, homing element (19); and c. detecting a signal generated by means (5) for distinguisihing between a closed and open state of the assembly.

25. Method for the detection of a target (6) using the assembly in accordance with claims 1 to 23, comprising the following steps: a. reacting at least one hook element (20) with its corresponding homing element (19); b. reacting at least one target (6) with its corresponding addressed assembly according to anyone of claims 1 to 23; and c. detecting a signal generated by means (5) for distinguisihing between a closed and open state of the assembly.

26. Method according to claims 24 or 25, wherein the homing element (19) is immobilized on a solid support.

27. Method according to claim 26, wherein the immobilization is performed via bringing the reactive group contained in the linker (16) into contact with a reactive group contained on the modified surface of said solid support.

28. Method according to anyone of claims 24 to 27, wherein the solid support is a microscopic slide, a bead, a column, a microtiter plate, a tube, a membrane, an optic fibre or a nanoparticle.

29. Method according to anyone of claims 24 to 28, wherein the assembly interacts with one or several targets (6), individually, in combination or in a complex mixture.

30. Method according to anyone of claims 24 to 29, wherein the target (6) is of biological origin.

31. Method according to claim 30, wherein the biological origin is selected of the group consisting of human, animal, plants, invertebrates, lower eukaryotes, prokaryotes, and viral origin.

32. Method according to claim 30, wherein the target (6) is derived from tissue, body fluids or cells.

33. Method according to anyone of claims 24 to 32, wherein target (6) is of synthetic origin.

34. Method according to anyone of claims 24 to 33, wherein the target (6) is a nucleic acid, in particular, DNA or RNA, or a peptide-nucleic-acid, or a peptide, or a peptidomimetic, or a protein or an aptamer.

35. Use of the assembly according to anyone of claims 1 to 23 for the investigation of nucleotides and/or peptides and/or proteins and/or low molecular weight molecules.

36. Use of claim 35, wherein the investigation includes detection, and/or separation and/or analysis of nucleotides and/or synthetic analogs, and/or peptides and/or proteins and/or peptidomimetics and/or low molecular weight molecules.

37. Use according to claim 35 or 36, including gene expression analysis, genotyping analysis, real-time monitoring of nucleic acid amplifications, analysis of protein-DNA interaction and/or protein-RNA interactions, sequencing or high-throughput screening or any combination thereof.

38. Use according to anyone of claims 35 to 37 as a component of a microarray and/or of an integrated analytical system and/or an electronic evaluation system and/or of a patient management system and/or as part of a kit.

39. Use according to anyone of claims 35 to 38 for in vitro/ex vivo diagnosis.

40. Use according to claim 39 for in vitro/ex vivo diagnosis of sepsis and/or therapy monitoring of sepsis.

41. Use according to anyone of claims 35 to 40 for the determination of efficiacy and toxicity in drug screening and/or for the production of drugs as well as compounds used for drug production

42. Use according to claims 35 to 41 for the detection of synthetic contaminants in organisms, food, drugs, environment.

43. A kit comprising the assembly according to anyone of claims 1 to 23.

44. A kit according to claim 43 for the use in solution and/or for addressable immobilization of the assembly according claims 1-23 comprising:

a. several individual homing elements (19) containing either an identical reporter (5) or a quencher (5); b. several individual hook elements (20) containing either an identical reporter or a quencher (5), so that the complete assembly has a reporter /quencher pair or vice versa or a identical reporter / reporter pair.

45. Kit according to claim 43 oder 44 for the use in solution and/or for addressable immobilization of the assembly according to anyone of claims 1 to 23 comprising:

a. several individual homing elements (19) containing either a different fluorophore (5) or a quencher (5);

b. several individual hook elements (20) containing either different fluorophore (5) or a quencher (5), so that the complete assembly has compatible fluorophore / quencher pair or vice versa or a compatible fluorophore / fluorophore pair.

6. Kit according to anyone of claims 43 to 45 for the simultaneous detection of multiple targets (6) in a multiplex manner.