WO2007024866A2 - Methods and compositions for the expression of a polynucleotide of interest - Google Patents

Methods and compositions for the expression of a polynucleotide of interest Download PDF

Info

Publication number
WO2007024866A2
WO2007024866A2 PCT/US2006/032792 US2006032792W WO2007024866A2 WO 2007024866 A2 WO2007024866 A2 WO 2007024866A2 US 2006032792 W US2006032792 W US 2006032792W WO 2007024866 A2 WO2007024866 A2 WO 2007024866A2
Authority
WO
WIPO (PCT)
Prior art keywords
polynucleotide
plant
enhancer
cell
interest
Prior art date
Application number
PCT/US2006/032792
Other languages
French (fr)
Other versions
WO2007024866A3 (en
Inventor
Billy Fred Mccutchen
Christine B. Hazel
Donglong Liu
Albert L. Lu
Wayne J. Mehre
Paul D. Olson
James F. H. Wong
Original Assignee
Pioneer Hi-Bred International, Inc.
E.I. Du Pont De Nemours And Company
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Pioneer Hi-Bred International, Inc., E.I. Du Pont De Nemours And Company filed Critical Pioneer Hi-Bred International, Inc.
Priority to BRPI0615087-0A priority Critical patent/BRPI0615087A2/en
Priority to EP06836107A priority patent/EP1931791B1/en
Priority to AT06836107T priority patent/ATE544861T1/en
Priority to MX2008002615A priority patent/MX2008002615A/en
Priority to CA2620002A priority patent/CA2620002C/en
Publication of WO2007024866A2 publication Critical patent/WO2007024866A2/en
Publication of WO2007024866A3 publication Critical patent/WO2007024866A3/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8209Selection, visualisation of transformants, reporter constructs, e.g. antibiotic resistance markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8275Glyphosate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8274Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
    • C12N15/8278Sulfonylurea
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1085Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C12N9/10923-Phosphoshikimate 1-carboxyvinyltransferase (2.5.1.19), i.e. 5-enolpyruvylshikimate-3-phosphate synthase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88Lyases (4.)
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention is drawn to the field of genetics and molecular biology. More particularly, the compositions and methods are directed to expression of polynucleotides of interest.
  • heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed. Where expression in specific tissues or organs is desired, tissue-preferred promoters may be used. Where gene expression in response to a stimulus is desired, inducible promoters are the regulatory element of choice. In contrast, where continuous expression is desired throughout the cells of a plant, constitutive promoters are utilized. Additional regulatory sequences upstream and/or downstream from the core promoter sequence may be included in the expression constructs of transformation vectors to bring about varying levels of expression of heterologous nucleotide sequences in a transgenic plant.
  • a DNA sequence in particular tissues or organs of a plant.
  • increased resistance of a plant to infection by soil- and air-borne pathogens might be accomplished by genetic manipulation of the plant's genome to comprise a tissue-preferred promoter operably linked to a heterologous pathogen-resistance gene such that pathogen-resistance proteins are produced in the desired plant tissue.
  • RNA transcript that interferes with translation of the niRNA of the native DNA sequence.
  • isolation and characterization of regulatory sequences that can be positioned upstream and/or downstream from the core promoter sequence and allow varying levels of expression of heterologous nucleotide sequences in a transgenic plant are needed for genetic manipulation of plants.
  • compositions for expressing a polynucleotide of interest are provided.
  • Compositions comprise an enhancer domain set forth in SEQ ID NO:1, 10, 15, 16, 17 or 18 and active variants and fragments thereof.
  • DNA constructs comprising at least one transcriptional enhancer sequence comprising the nucleotide sequence set forth in SEQ ID NO:1, 10, 15, 16, 17, or 18 or an active variant or fragment thereof, operably linked to a heterologous promoter.
  • Such chimeric transcription regulatory regions can be operably linked any polynucleotide of interest.
  • cells, plants, plant parts, and germplasm comprising the DNA construct.
  • Methods of using the chimeric transcriptional regulatory region are also provided.
  • methods of expressing a polynucleotide of interest including for example, sequences that confer tolerance to herbicides, and methods to select a cell having the DNA construct are provided.
  • Figure 1 provides examples of constructs having 35 S enhancer elements.
  • Figure 2 provides a schematic demonstrating the effect of 35S enhancers on
  • Figure 3 provides a schematic demonstrating the effect of 35S enhancers on TO efficiency.
  • Figure 4 provides a schematic demonstrating the effect of 35S enhancers on event copy number.
  • Figure 5 provides a schematic demonstrating the effect of 35S enhancers on expression.
  • Figure 6 provides an insecticidal gene evaluation assay.
  • Figure 7 provides a schematic showing the development of a GAT selection scheme.
  • Figure 8 demonstrates that GAT can be used as a selectable marker.
  • Figure 9 provides a schematic demonstrating GAT transformation efficiencies.
  • compositions of the invention comprise an enhancer domain of a transcription control region and variants and fragments of that enhancer domain.
  • a functional transcriptional regulation region is formed which can direct expression of an operably linked polynucleotide of interest.
  • the present invention provides isolated polynucleotides comprising the enhancer domain set forth in SEQ ID NO: 1, 10, 15, 16, 17 or 18; active variants and fragments thereof; and, polynucleotide consisting of the sequence of SEQ ID NO: 1, 10, 15, 16, 17 or 18.
  • the enhancer domain employed does not comprise the region to the 35S promoter from about position -90 to about -46.
  • the -90 to -46 region of the promoter is set forth in SEQ IDNO:5.
  • promoter is intended to mean a regulatory region of DNA comprising a transcriptional initiation region, which in some embodiments, comprises a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular coding sequence.
  • the promoter can further be operably linked to additional regulatory elements that influence transcription, including, but not limited to, introns, 5' untranslated regions, and enhancer elements.
  • additional regulatory elements that influence transcription, including, but not limited to, introns, 5' untranslated regions, and enhancer elements.
  • an "enhancer sequence,” “enhancer domain,” “enhancer element,” or “enhancer” when operably linked to an appropriate promoter, will modulate the level of transcription of an operably linked polynucleotide of interest.
  • the enhancer of the invention can alter normal promoter expression patterns.
  • a tissue preferred/specific promoter when operably linked to an enhancer of the invention, will demonstrate ectopic expression that is not normally observed with the promoter alone.
  • the oleosin promoter is a seed-preferred promoter but shows leaf expression in the presence of the enhancer of the invention or active variant or fragment thereof.
  • the Zrp2 promoter which is a leaf-preferred promoter, becomes constitutive when operably linked to the enhancer sequence of the invention or a biologically active variant or fragment thereof
  • the RM2 promoter a root promoter, when operably linked to the enhancer of the invention or biologically active variant or fragment thereof will show leaf expression.
  • compositions of the present invention further comprise a polynucleotide comprising a chimeric transcriptional control region comprising the promoter operably linked to at least one, two, three, four or more copies of the enhancer domain or an active variant or fragment of the domain.
  • a polynucleotide comprising a chimeric transcriptional control region comprising the promoter operably linked to at least one, two, three, four or more copies of the enhancer domain or an active variant or fragment of the domain.
  • the invention encompasses isolated or substantially purified polynucleotide or protein compositions.
  • An "isolated” or “purified” polynucleotide, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide as found in its naturally occurring environment.
  • an isolated or purified polynucleotide is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived.
  • the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived.
  • a polynucleotide that is substantially free of cellular material includes preparations of having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein or polynucleotides.
  • optimally culture medium represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors.
  • Fragments and variants of the disclosed enhancer sequence are also encompassed by the present invention.
  • fragments and variants of the enhancer domain of SEQ ID NO:1, 10, 15, 16, 17 or 18 are provided.
  • fragment means a portion of the polynucleotide. Fragments of an enhancer domain may retain the biological activity of modulating (increase or decrease) the level of transcription when operably linked to an appropriate promoter. Alternatively, fragments of a polynucleotide that is useful as hybridization probes may not necessarily retain biological activity.
  • Fragments of a polynucleotide for the enhancer domain may range from at least about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, and up to the full-length nucleotide sequence of the invention for the enhancer domain of the invention.
  • a fragment of the enhancer domain comprises a length of about 50 to about 100, 100 to about 150, 150 to about 200, 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, about 450 to about 500, about 500 to about 535 nucleotides.
  • the active variants and fragments of the enhancer comprise conserved regions.
  • Such regions include one or more of the underlined sequences set forth below cccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctctta cgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaatatatcaaagatatcccggaaacctcctcggattccattgcccagctatc tgtgaagatagtggaaaaggaggtggctcctacaaatgccatcattgcgataaggaaggtggctctacaaatgccatttctgtgaagatagtggaaaggaggtggctcctacaaatgccatcattgcgataaggaaggcca
  • a biologically active portion of the enhancer domain can be prepared by isolating a portion of the enhancer domain of the invention and assessing the transcriptional regulation activity of the fragment.
  • Methods to detect transcriptional regulation include, for example, assaying for the level of the operably linked polynucleotide of interest or assaying for the expression of a polypeptide encoded by an operably linked sequence of interest. Such assays can directly measure the level of the polynucleotide or polypeptide or they can assay for the activity or an expected phenotype when the expression of the sequence is altered. Such assays are known in the art. As used herein, the term "variants" means substantially similar sequences.
  • a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide.
  • a "native" polynucleotides comprises a naturally occurring nucleotide sequence.
  • variants can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below.
  • variants also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis.
  • variants of a particular polynucleotides of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotides as determined by sequence alignment programs and parameters described elsewhere herein.
  • a biologically active variant of a polynucleotides of the invention may differ from that sequence by as few as 1-15 nucleic acid residues, as few as 1-10, such as 6-10, as few as 10, 9, 8, 7, 6, 5, 4, 3, 2, or even 1 nucleic acid residue.
  • the genes and polynucleotides of the invention include both the naturally occurring sequences as well as mutant forms. Such variants will continue to possess the desired transcription regulatory activity.
  • the deletions, insertions, and substitutions of the sequences encompassed herein are not expected to produce radical changes in the characteristics of the sequence. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated using assays disclosed elsewhere herein.
  • Variant polynucleotides also encompass sequences derived from a mutagenic and recombinogenic procedure such as DNA shuffling.
  • one or more different enhancer domain sequences for the promoter can be manipulated to create a new enhancer domain.
  • libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo.
  • Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91: 10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 75:436-438; Moore et al. (1997) J MoI Biol.
  • the polynucleotides of the invention can be used to isolate corresponding sequences from other organisms, particularly other plants, more particularly other monocots. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire enhancer domain set forth herein or to fragments or variants thereof are encompassed by the present invention.
  • oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from genomic DNA extracted from any plant of interest.
  • Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), hereinafter Sambrook. See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds.
  • PCR PCR Strategies
  • nested primers single specific primers
  • degenerate primers gene-specific primers
  • vector- specific primers partially-mismatched primers
  • hybridization techniques all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments from a chosen organism.
  • the hybridization probes may be labeled with a detectable group such as 32 P, or any other detectable marker.
  • probes for hybridization can be made by labeling synthetic oligonucleotides based on the enhancer domain of the invention.
  • the entire enhancer domain sequence disclosed herein, or one or more portions thereof may be used as a probe capable of specifically hybridizing to corresponding enhancer sequences.
  • probes include sequences that are unique among enhancer domain sequences and are at least about 10 nucleotides in length or at least about 20 nucleotides in length.
  • Such probes may be used to amplify corresponding 35 S enhancer sequences from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism .
  • Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) Cloning: A Laboratory Manual (2 nd ed, Cold Spring Harbor Laboratory Press, Plainview, New York.)
  • Hybridization of such sequences may be carried out under stringent conditions.
  • stringent conditions and “stringent hybridization conditions” are intended to mean conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background).
  • Stringent conditions are sequence-dependent and will be different in different circumstances.
  • target sequences that are 100% complementary to the probe can be identified (homologous probing).
  • stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing).
  • a probe is less than about 1000 nucleotides in length or less than 500 nucleotides in length.
  • stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides).
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37 0 C, and a wash in 0.5X to IX SSC at 55 to 60°C.
  • Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a final wash in 0.1X SSC at 60 to 65°C for a duration of at least 30 minutes. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
  • T m thermal melting point
  • M the molarity of monovalent cations
  • %GC the percentage of guanosine and cytosine nucleotides in the DNA
  • % form the percentage of formamide in the hybridization solution
  • L the length of the hybrid in base pairs.
  • the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe.
  • T m is reduced by about I 0 C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10 0 C.
  • stringent conditions are selected to be about 5°C lower than the T m for the specific sequence and its complement at a defined ionic strength and pH.
  • stringent conditions are selected to be about 5 0 C lower than the T m for the specific sequence at a defined ionic strength and pH.
  • stringent conditions encompass temperatures in the range of about 1°C to about 20°C lower than the T m , depending upon the desired degree of stringency as otherwise qualified herein.
  • sequence relationships between two or more polynucleotides or polypeptides are used to describe the sequence relationships between two or more polynucleotides or polypeptides: (a) “reference sequence”, (b) “comparison window”, (c) “sequence identity”, and, (d) “percentage of sequence identity.”
  • reference sequence is a defined sequence used as a basis for sequence comparison.
  • a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
  • comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two polynucleotides.
  • the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer.
  • the determination of percent sequence identity between any two sequences can be accomplished using a mathematical algorithm.
  • mathematical algorithms are the algorithm of Myers and Miller (1988) CABIOS 4:11- 17; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the global alignment algorithm of Needleman and Wunsch (1970) J. MoI. Biol. 48:443- 453; the search-for-local alignment method of Pearson and Lipman (1988) Proc. Natl. Acad. ScI 85:2444-2448; the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. ScI USA 872264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad.
  • Gapped BLAST in BLAST 2.0
  • PSI-BLAST in BLAST 2.0
  • PSI-BLAST in BLAST 2.0
  • sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof.
  • equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
  • GAP uses the algorithm of Needleman and Wunsch (1970) J. MoI. Biol. 48:443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty.
  • gap creation penalty values and gap extension penalty values in Version 10 of the GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively.
  • the default gap creation penalty is 50 while the default gap extension penalty is 3.
  • the gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200.
  • the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.
  • GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity.
  • the Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold.
  • the scoring matrix used in Version 10 of the GCG Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. ScI USA 89:10915).
  • sequence identity or “identity” in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • sequence identity or “identity” in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
  • sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
  • Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity”. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
  • percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
  • polynucleotide is not intended to limit the present invention to polynucleotides comprising DNA.
  • polynucleotides can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides.
  • deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues.
  • the polynucleotides of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.
  • the polynucleotide disclosed in the present invention are useful in the genetic manipulation of any plant.
  • the enhancer domain or the active fragment or variant thereof are useful in this aspect when operably linked to a heterologous promoter.
  • Such transcriptional regulatory control regions are referred to herein as "chimeric" transcriptional regulatory control regions.
  • the chimeric transcriptional control regions can be opererably linked to a polynucleotide whose expression is to be controlled to achieve a desired phenotypic response.
  • the polynucleotide for the enhancer domain or the chimeric transcriptional regulatory control region of the invention may be provided in expression cassettes along with a polynucleotide of interest for expression in the organism of interest.
  • the chimeric transcriptional regulatory region can comprise multiple copies of the enhancer domain or active variants and fragments thereof.
  • the chimeric transcriptional regulatory control region comprises at least 1, 2, 3, 4, 5, 6, 7 or more copies of the enhancer domain.
  • the enhancer domain employed does not comprise the sequence set forth in SEQ ID NO:5.
  • an enhancer domain can be positioned at least about 10000 to about 15000, about 10000 to about a 9000, about 9000 to about 8000, about 8000 to about 7000, about 7000 to about 6000, about 6000 to about 5000, about 5000 to about 4000, about 4000 to about 3000, about 3000 to about 2000, about 2000 to about 1000, about 1000 to about 500, about 500 to about 250, about 250 to immediately adjacent to the promoter.
  • one or more copies of the enhancer can be placed upstream (5') of the prompter or alternatively, one or more copies of the enhancer can be located 3' to the promoter.
  • the enhancer when located 3' of the promoter, the enhancer is downstream of the terminator region.
  • one or more of the enhancers can be arranged either in the 5' or 3' orientation (as shown in SEQ ID NO:1) or in the 3' to 5' orientation. If multiple enhancers are employed, the enhancers can be positioned in the construct with respect to the promoter such that the desired affect on expression is achieved.
  • the enhances can be immediately adjacent to each other or at least between 1 to 100, 100 to 300, 300 to 500, 500 to 1000 nucleotides apart.
  • Such constructs can be provided in expression cassettes for expression in the organism of interest.
  • the cassette can include 3' regulatory sequences and 5' regulatory sequences operably linked to a polynucleotide of interest.
  • "Operably linked” is intended to mean a functional linkage between two or more elements.
  • an operable linkage between a polynucleotide of interest and a regulatory sequence i.e., a promoter
  • a regulatory sequence i.e., a promoter
  • An operable linkage between an enhancer and a transcriptional initiation region is a linkage which allows for the transcriptional control region to transcribe an operably linked polynucleotide of interest.
  • Operably linked elements may be contiguous or non-contiguous.
  • the cassette may additionally contain at least one additional gene to be cotransformed into the organism.
  • the additional gene(s) can be provided on multiple expression cassettes.
  • Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the polynucleotide of interest to be under the transcriptional regulation of the regulatory regions.
  • the expression cassette may additionally contain selectable marker genes.
  • the expression cassette can include, in the 5 '-3' direction of transcription, a chimeric transcriptional regulatory region comprising the enhancer domain or an active variant or fragment thereof, a promoter, or active variant or fragment thereof, a translational initiation region, a polynucleotide of interest, a translational termination region and, optionally, a transcriptional termination region functional in the host organism.
  • the regulatory regions i.e., promoters, enhancer domains, and translational termination regions, etc.
  • the polynucleotide of interest may be native/analogous to the host cell or to each other.
  • the regulatory regions and/or the polynucleotide of interest may be heterologous to the host cell or to each other.
  • heterologous in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.
  • a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.
  • a "heterologous polynucleotide” as it relates to an enhancer domain is intended to mean a sequence that is not naturally occurring with the enhancer domain sequence of the invention. While this promoter is heterologous to the enhancer domain sequence, it may be homologous, or native, or heterologous, or foreign, to the plant host.
  • the termination region may be native with the enhancer domain or the transcriptional initiation region, may be native with the operably linked polynucleotide of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the enhancer domain, the transcriptional initiation region, , the polynucleotide of interest, the plant host, or any combination thereof.
  • Convenient termination regions are available from the Ti- plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (199I) Mo/. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149;
  • the expression cassette comprising the sequences of the present invention may also contain at least one additional nucleotide sequence for a gene to be cotransformed into the organism.
  • the additional sequence(s) can be provided on another expression cassette. Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression.
  • the G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
  • the expression cassettes may additionally contain 5' leader sequences.
  • leader sequences can act to enhance translation.
  • Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci.
  • TEV leader tobacco Etch Virus
  • MDMV leader Maize Dwarf Mosaic Virus ⁇ Virology 154:9-20
  • human immunoglobulin heavy-chain binding protein BiP
  • AMV RNA 4 alfalfa mosaic virus
  • TMV tobacco mosaic virus leader
  • Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et a (1991) Virology 81:382-385). See also, Della-Cioppa et al (1987) Plant Physiol. 84:965-968.
  • the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame.
  • adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like.
  • in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions may be involved.
  • the expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues.
  • Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4- dichlorophenoxyacetate (2,4-D).
  • Additional selectable markers include phenotypic markers such as ⁇ -galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al (2004) Biotechnol Bioeng 85:610-9 and Fetter et al (2004) Plant Cell 16:215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al (2002) Plant Physiol 129:913-42), and yellow florescent protein (PhiYFPTM from Evrogen, see, Bolte et al. (2004) J. Cell Science 117:943-54).
  • GFP green fluorescent protein
  • CYP cyan florescent protein
  • PhiYFPTM yellow florescent protein
  • any selectable marker gene can be used in the present invention.
  • a chimeric transcriptional regulatory region comprising at least one copy of the enhancer domain or active variant or fragment thereof operably linked to a heterologous promoter are provided.
  • Any promoter of interest can be operably linked to the enhancer domain of the invention.
  • Such promoters can be selected based on the desired outcome and can comprises constitutive, inducible, tissue-preferred, or other promoters for expression in a host cell of interest (i.e., a plant).
  • Constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810- 812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant MoI. Biol. 12:619-632 and Christensen et al. (1992) Plant MoI. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81 :581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Patent No.
  • the promoter comprises an inducible promoter, particularly from a pathogen-inducible promoter.
  • a pathogen-inducible promoter include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc.
  • PR proteins pathogenesis-related proteins
  • SAR proteins pathogenesis-related proteins
  • beta-l,3-glucanase chitinase, etc.
  • Van Loon (1985) Plant MoI. Virol. 4:111-116 See also WO 99/43819, herein incorporated by reference.
  • Promoters that are expressed locally at or near the site of pathogen infection can be used. See, for example, Marineau et al. (1987) Plant MoI. Biol. 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) MoI. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al.
  • a wound-inducible promoter may be used in the constructions of the invention.
  • Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotechnology 14:494-498); wunl and wun2, U.S. Patent No. 5,428,148; winl and win2 (Stanford et al. (1989) MoI. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225:1570-1573); WIPl (Rohmeier et al.
  • Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator.
  • the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression.
  • Chemical- inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid.
  • Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. ScI USA 88:10421-10425 and McNellis et al. (1998) Plant J.
  • Tissue-preferred promoters can be utilized to target enhanced expression of a polynucleotide of interest within a particular plant tissue.
  • Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) MoI. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant
  • Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et ⁇ /. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant MoI. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. ScI USA 90(20):9586-9590.
  • Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant MoI. Biol. 20(2):207-218 (soybean root- specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant MoI. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al.
  • MAS mannopine synthase
  • Seed-preferred promoters include both seed-specific promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as seed-germinating promoters (those promoters active during seed germination). See Thompson et al. (1989) BioEssays 10:108, herein incorporated by reference. Such seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message); cZ19Bl (maize 19 kDa zein); milps (myo-inositol-1- phosphate synthase) (see WO 00/11177 and U.S. Patent No. 6,225,529; herein incorporated by reference).
  • Gamma-zein is an endosperm-specific promoter.
  • Globulin 1 (GIb-I) is a representative embryo-specific promoter.
  • seed-specific promoters include, but are not limited to, bean ⁇ -phaseolin, napin, ⁇ - conglycinin, soybean lectin, cruciferin, and the like.
  • seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, gamma-zein, waxy, shrunken 1, shrunken 2, Globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from endl and end! genes are disclosed; herein incorporated by reference.
  • Polynucleotide sequences expressed by the chimeric transcriptional regulatory control region of the invention may be used for varying the phenotype of a plant.
  • Various changes in phenotype are of interest including modifying expression of a gene in a plant embryo, altering a plant's pathogen or insect defense mechanism, increasing the plants tolerance to herbicides in a plant, altering embryo development to respond to environmental stress, and the like.
  • These results can be achieved by the expression of a heterologous nucleotide sequence of interest comprising an appropriate gene product.
  • the heterologous nucleotide sequence of interest is an endogenous plant sequence whose expression level is increased in the plant or plant part.
  • the results can be achieved by providing for a reduction of expression of one or more polynucleotide of interest.
  • the chimeric transcriptional regulatory control region of the invention can further comprise additional portions of other transcriptional regulatory regions.
  • the transcriptional regulatory control element disclosed herein, comprising the enhancer domain and a heterologous promoter can comprise upstream regulatory elements such as, those responsible for tissue and temporal expression of the coding sequence.
  • the term "regulatory element” also refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which includes sequences which modulate the expression of the coding region.
  • nucleotide sequences, located within introns, or 3' of the coding region sequence may also contribute to the regulation of expression of a coding region of interest.
  • suitable introns include, but are not limited to, the maize IVS6 intron, or the maize actin intron.
  • a regulatory element may also include those elements located downstream (3') to the site of transcription initiation, or within transcribed regions, or both.
  • a post-transcriptional regulatory element may include elements that are active following transcription initiation, for example translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability determinants.
  • the enhancer of the invention can be positioned in the DNA construct between and operably linked to a first and a second promoter.
  • the enhancer allows for a modulation in expression of both the first and the second promoters from a divergent direction.
  • Exemplary, but non- limiting, examples of such DNA constructs comprise in the 5' to 3' or 3' to 5' orientation: a first polynucleotide of interest operably linked to a first promoter, operably linked to at least one copy of an enhancer of the invention, operably linked to a second promoter, operably linked to a second polynucleotide of interest.
  • the enhancer sequence is heterologous to the first and the second enhancer sequence.
  • the term plant includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like.
  • Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species.
  • Progeny, variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the introduced polynucleotides.
  • the present invention may be used for transformation of any plant species, including, but not limited to, monocots and dicots.
  • plant species of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B.
  • jimced particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativd), rice (Oryza sativ ⁇ ), rye (Secale cerea ⁇ e), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracandj), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot
  • Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativd), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C sativus), cantaloupe (C cantalupensis), and musk melon (C melo).
  • tomatoes Locopersicon esculentum
  • lettuce e.g., Lactuca sativd
  • green beans Phaseolus vulgaris
  • lima beans Phaseolus limensis
  • peas Lathyrus spp.
  • members of the genus Cucumis such as cucumber (C sativus), cantaloupe (C cantalupensis), and musk melon (C melo).
  • Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrid ⁇ ), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrimd), and chrysanthemum.
  • Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsame ⁇ ); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis).
  • pines such as loblolly pine (Pinus taeda), slash pine (P
  • plants of the present invention are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.).
  • corn and soybean plants are optimal, and in yet other embodiments corn plants are optimal.
  • plants of interest include grain plants that provide seeds of interest, oil- seed plants, and leguminous plants.
  • Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc.
  • Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc.
  • Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
  • a "subject plant or plant cell” is one in which genetic alteration, such as transformation, has been effected as to a gene of interest, or is a plant or plant cell which is descended from a plant or cell so altered and which comprises the alteration.
  • a "control” or “control plant” or “control plant cell” provides a reference point for measuring changes in phenotype of the subject plant or plant cell.
  • a control plant or plant cell may comprise, for example: (a) a wild-type plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has been transformed with a null construct (i.e.
  • a construct which has no known effect on the trait of interest such as a construct comprising a marker gene
  • a construct comprising a marker gene a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene
  • a plant or plant cell which is a non- transformed segregant among progeny of a subject plant or plant cell
  • a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to conditions or stimuli that would induce expression of the gene of interest or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.
  • any organism having a chimeric transcriptional control region comprising an enhancer domain of the invention or an active variant or fragment thereof are provided.
  • plants, plant parts, cells, and germplasm having a chimeric transcriptional control region comprising an enhancer domain of the invention or an active variant or fragment thereof are provided.
  • the chimeric transcriptional control region is operably linked to a polynucleotide of interest.
  • polynucleotides include, for example, any polynucleotide that confers tolerance to a herbicide. Plant cells, plant parts and germplasm comprising such sequences are further provided.
  • the chimeric transcriptional regulatory control region having the enhancer domain or an active variant or fragment thereof can be used to express any polynucleotide of interest.
  • General categories of polynucleotides of interest for the present invention include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes, for example, include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, and environmental stress resistance (altered tolerance to cold, salt, drought, etc).
  • Insect resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European corn borer, and the like.
  • Such genes include, for example, Bacillus thuringiensis toxic protein genes (U.S. Patent Nos. 5,366,892; 5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al. (1986) Gene 48:109); and the like.
  • Genes encoding disease resistance traits include detoxification genes, such as those which detoxify fumonisin (U.S. Patent No. 5,792,931); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266:1 '89; Martin et al. (1993) Science 262:1432; and Mindrinos et al. (1994) Cell 7S:1089); and the like.
  • Exogenous products include plant enzymes and products as well as those from other sources including prokaryotes and other eukaryotes. Such products include enzymes, cofactors, hormones, and the like.
  • RNAi refers to a series of related techniques to reduce the expression of genes (See for example U.S.
  • the polynucleotides may be optimized for increased expression in the transformed plant. That is, the polynucleotides can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831, and 5,436,391, and Murray et al (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.
  • the polynucleotide of interest encodes a polynucleotide that confers tolerance to a herbicide of interest.
  • the polynucleotide that confers tolerance to herbicide of interest comprises an ALS inhibitor tolerant polypeptide which confers tolerance of a dose of sulfonylurea, imidazolinone, triazolopyrimidines, pyrimidinyoxy(thio)benzoates, and/or sulfonylamino-carbonyl-triazonline herbicide.
  • Sulfonylurea and imidazolinone herbicides inhibit growth of higher plants by blocking acetolactate synthase (ALS), also known as, acetohydroxy acid synthase (AHAS).
  • ALS acetolactate synthase
  • AHAS acetohydroxy acid synthase
  • plants containing particular mutations in ALS ⁇ e.g., the S4 and/or HRA mutations) are tolerant to sulfonylurea herbicides.
  • the production of sulfonylurea-tolerant plants and imidazolinone-tolerant plants is described more fully in U.S. Patent Nos.
  • the ALS inhibitor tolerant polypeptide comprises a sulfonamide- tolerant acetolactate synthase, a sulfonamide-tolerant acetohydroxy acid synthase, an imidazolinone-tolerant acetolactate synthase, or an imidazolinone-tolerant acetohydroxy acid synthase.
  • Polynucleotides coding for resistance to herbicides that act to inhibit action of glutamine synthase such as phosphinothricin or basta (e.g., the bar gene), glyphosate (e.g., the EPSPS gene and the GAT gene; see, for example, U.S. Publication No. 20040082770 and WO 03/092360) or other such genes known in the art can also be used .
  • the bar gene encodes resistance to the herbicide basta
  • the nptll gene encodes resistance to the antibiotics kanamycin and geneticin
  • the ALS gene mutants encode resistance to the herbicide chlorsulfuron.
  • Glyphosate resistance is imparted by mutant 5-enolpyruvl-3-phosphikimate synthase (EPSP) and aroA genes.
  • EPEP 5-enolpyruvl-3-phosphikimate synthase
  • aroA aroA genes.
  • U.S. Patent No. 4,940,835 to Shah et al. discloses the nucleotide sequence of a form of EPSPS which can confer glyphosate resistance.
  • U.S. Patent No. 5,627,061 to Barry et al. also describes genes encoding EPSPS enzymes. See also U.S. Patent Nos.
  • Glyphosate resistance is also imparted to plants that express a gene that encodes a glyphosate oxido-reductase enzyme as described more fully in U.S. Patent Nos. 5,776,760 and 5,463,175, which are incorporated herein by reference for this purpose.
  • glyphosate resistance can be imparted to plants by the over expression of genes encoding glyphosate N-acetyltransferase. See, for example, U.S. Patent Application Serial Nos. 10/004,357 and 10/427,692, each of which are herein incorporated by reference.
  • Polypeptides conferring tolerance to herbicides which inhibit the enzyme glutamine synthase, such as phosphinothricin or glufosinate (e.g., the bar gene) can also be used.
  • glutamine synthase such as phosphinothricin or glufosinate (e.g., the bar gene)
  • glutamine synthase such as phosphinothricin or glufosinate
  • GS Glutamine synthetase
  • Glufosinate herbicides have been developed based on the toxic effect due to the inhibition of GS in plants. These herbicides are non-selective; that is, they inhibit growth of all the different species of plants present.
  • the development of plants containing an exogenous phosphinothricin acetyltransferase is described in U.S. Patent Nos.
  • polypeptides involving other modes of herbicide resistance are employed.
  • hydroxyphenylpyruvatedioxygenases are enzymes that catalyze the reaction in which para-hydroxyphenylpyruvate (HPP) is transformed into homogentisate. Molecules which inhibit this enzyme and which bind to the enzyme in order to inhibit transformation of the HPP into homogentisate are useful as herbicides. Plants more resistant to certain herbicides are described in U.S. Patent Nos. 6,245,968; 6,268,549; and 6,069,115; and international publication WO 99/23886, which are incorporated herein by reference in their entireties for all purposes. Mutated hydroxyphenylpyruvatedioxygenase having this activity are also disclosed.
  • Additional herbicides include but are not limited to, an acetyl Co-A carboxylase inhibitor such as quizalofop-P-ethyl, a synthetic auxin such as quinclorac, a protoporphyrinogen oxidase (PPO) inhibitor herbicide (such as sulfentrazone), a pigment synthesis inhibitor herbicide such as a hydroxyphenylpyruvate dioxygenase inhibitor ⁇ e.g., mesotrione or sulcotrione), a phosphinothricin acetyltransferase or a phytoene desaturase inhibitor like diflufenican or pigment synthesis inhibitor.
  • PPO protoporphyrinogen oxidase
  • a pigment synthesis inhibitor herbicide such as a hydroxyphenylpyruvate dioxygenase inhibitor ⁇ e.g., mesotrione or sulcotrione
  • the DNA construct comprising the enhancer domain of the present invention operably linked to a heterologous promoter can be used to transform any organism of interest.
  • the organism comprises a plant or part thereof. In this manner, genetically modified plants, plant cells, plant tissue, seed, embryos, and the like can be obtained.
  • the methods of the invention involve introducing a polypeptide or polynucleotide into a plant.
  • "Introducing" is intended to mean presenting to the plant the polynucleotide in such a manner that the sequence gains access to the interior of a cell of the plant.
  • the methods of the invention do not depend on a particular method for introducing a sequence into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant.
  • Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.
  • “Stable transformation” is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof.
  • “Transient transformation” is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.
  • Transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechnigues 4:320-334), electroporation (Riggs et al.
  • the DNA construct of the invention can be provided to a plant using a variety of transient transformation methods.
  • transient transformation methods include, the DNA construct comprising the enhancer domain can be transiently transformed into the plant using techniques known in the art.
  • Such techniques include viral vector system and the precipitation of the polynucleotide in a manner that precludes subsequent release of the DNA.
  • Such methods include the use particles coated with polyethylimine (PEI; Sigma #P3143).
  • the polynucleotide of the invention may be introduced into plants by contacting plants with a virus or viral nucleic acids.
  • such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule.
  • promoters of the invention also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing an operably linked sequence, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Patent Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and Porta et al. (1996) Molecular Biotechnology 5:209-221; herein incorporated by reference.
  • the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system.
  • a site-specific recombination system See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference.
  • the polynucleotide of the invention can be contained in transfer cassette flanked by two non-recombinogenic recombination sites.
  • the transfer cassette is introduced into a plant having stably incorporated into its genome a target site which is flanked by two non-recombinogenic recombination sites that correspond to the sites of the transfer cassette.
  • An appropriate recombinase is provided and the transfer cassette is integrated at the target site.
  • the polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.
  • the cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting progeny having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as "transgenic seed") having a polynucleotide of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.
  • the polynucleotides of the present invention can be stacked with any combination of polynucleotide sequences of interest in order to create plants with a desired trait.
  • a trait refers to the phenotype derived from a particular sequence or groups of sequences.
  • the polynucleotides of the present invention may be stacked with any other polynucleotides encoding polypeptides having pesticidal and/or insecticidal activity and/or herbicidal activity, such as other Bacillus thuringiensis toxic proteins (described in U.S. Patent Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756;
  • the combinations generated can also include multiple copies of any one of the polynucleotides of interest.
  • the polynucleotides of the present invention can also be stacked with any other gene or combination of genes to produce plants with a variety of desired trait combinations including, but not limited to, traits desirable for animal feed such as high oil genes (e.g., U.S. Patent No. 6,232,529); balanced amino acids (e.g., hordothionins (U.S.
  • modified storage proteins U.S. Application Serial No. 10/053,410, filed November 7, 2001
  • thioredoxins U
  • polynucleotides of the present invention can also be stacked with traits desirable for disease or herbicide resistance (e.g., fumonisin detoxification genes (U.S. Patent No. 5,792,931); avirulence and disease resistance genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al.
  • diseases or herbicide resistance e.g., fumonisin detoxification genes (U.S. Patent No. 5,792,931)
  • avirulence and disease resistance genes Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al.
  • acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations
  • inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance (EPSPS gene)
  • traits desirable for processing or process products such as high oil (e.g., U.S. Patent No. 6,232,529 ); modified oils (e.g., fatty acid desaturase genes (U.S. Patent No.
  • modified starches e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE), and starch debranching enzymes (SDBE)
  • polymers or bioplastics e.g., U.S. Patent No. 5.602,321; beta-ketothiolase, polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-5847) facilitate expression of polyhydroxyalkanoates (PHAs)); the disclosures of which are herein incorporated by reference.
  • polynucleotides of the present invention could also combine with polynucleotides providing agronomic traits such as male sterility (e.g., see U.S. Patent No. 5.583,210), stalk strength, flowering time, or transformation technology traits such as cell cycle regulation or gene targeting (e.g., WO 99/61619, WO 00/17364, and WO 99/25821); the disclosures of which are herein incorporated by reference.
  • stacked combinations can be created by any method including, but not limited to, cross-breeding plants by any conventional or TopCross methodology, or genetic transformation.
  • the polynucleotide sequences of interest can be combined at any time and in any order.
  • a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation.
  • the traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes.
  • the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of the polynucleotide of interest.
  • polynucleotide sequences can be stacked at a desired genomic location using a site-specific recombination system. See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference.
  • concentration and/or activity is increased or decreased by at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% relative to a native control plant, plant part, or cell which did not have the sequence of the invention introduced. Modulation in the present invention may occur during and/or subsequent to growth of the plant to the desired stage of development.
  • the expression level of the polynucleotide or polypeptide of interest may be measured directly, for example, by assaying for the level of the polypeptide or polynucleotide in the organism, or indirectly, for example, by measuring the activity of the polypeptide or polypeptide in the organism.
  • the DNA construct comprising the enhancer domain is introduced into the plant cell.
  • a plant cell having the introduced sequence of the invention is selected using methods known to those of skill in the art such as, but not limited to, Southern blot analysis, DNA sequencing, PCR analysis, or phenotypic analysis.
  • a population of cells is provided and a DNA construct comprising a chimeric transcriptional regulatory region of the invention operably linked to the polynucleotide comprising a selectable marker is introduced into at least one cell of the population.
  • the population of cells is then contacted with an effective concentration of an appropriate selection agent; and, the plant cell expressing the polynucleotide is selected.
  • the plant cells having the DNA construct are thereby identified.
  • a plant or plant part altered or modified by the foregoing embodiments is grown under plant forming conditions for a time sufficient to modulate the concentration and/or activity of the polynucleotide operably linked to the transcriptional control region comprising the enhancer domain.
  • Plant forming conditions are well known in the art and are discussed briefly elsewhere herein.
  • the enhancer of the invention is employed to modulate the expression of two polynucleotides of interest.
  • a DNA construct having the enhancer of the invention positioned between and operably linked to a first and a second promoter is introduced into a plant.
  • the enhancer allows for a modulation in expression of both the first and the second promoters from a divergent direction.
  • Exemplary, but non-limiting, examples of such DNA constructs comprise in the 5' to 3' or 3' to 5' orientation: a first polynucleotide of interest operably linked to a first promoter, operably linked to at least one copy of an enhancer of the invention, operably linked to a second promoter, operably linked to a second polynucleotide of interest.
  • the enhancer sequence is heterologous to the first and the second enhancer sequence.
  • the chimeric transcriptional regulatory region comprising the enhancer domain can be used in DNA constructs which are operably linked to a selectable marker, such as a polynucleotide that can confer tolerance to a herbicide.
  • a DNA construct comprising a chimeric transcriptional regulatory region comprising an enhancer domain of the invention is operably linked to a polynucleotide that can confers tolerance to a herbicide which can function as a selectable marker, e.g., in a plant, bacteria, actinomycete, yeast, algae or other fungi.
  • an organism that has been transformed with such a DNA construct can be selected based on its ability to grow in the presence of a herbicide that would not allow a control organism to grow.
  • an effective concentration of a selective agent is a concentration of an agent that allows cells expressing the polynucleotide of interest to survive, but cells not expressing the polynucleotide sequence of interest will not survive in the presence of the agent at that concentration.
  • such methods of selection allow one to evaluate expression of a polynucleotide of interest. For example, in specific embodiments such methods allow one to potential problems with the expression of a polynucleotide of interest at early stages in the transformation process.
  • the construct comprising the chimeric transcriptional regulatory region is operably linked to a polynucleotide encoding a selectable marker.
  • the same construct further comprises a polynucleotide of interest which is also operably linked to the chimeric transcriptional regulatory region or to a separate promoter of interest. While any polynucleotide of interest can be employed, in specific examples, insecticidal polynucleotides are employed.
  • a construct comprising a chimeric transcriptional regulatory region comprising an enhancer domain is operably linked to a polynucleotide of interest may exhibit a very high transformation efficiency, such as an efficiency of at least 20%, 30%, 40%, 50%, or 60% or higher.
  • the polynucleotide of interest confers tolerance to a selectable marker, and in a more specific embodiment, the sequence confers tolerance to a herbicide of interest). In this manner, improved methods of transformation are provided.
  • transformants that are obtained may exhibit a very high frequency of tolerance to the marker, so that, for example, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the transformants are tolerant to the marker.
  • transformation efficacy is defined as the percentage of TO events that display the desired phenotype of the polynucleotide of interest (i.e., display tolerance to a herbicide).
  • the frequency of transformation events in which only a single copy of the construct is inserted into the genome may be as high as at least 35%, 40%, 50%, 60%, 70%, 80%, 90%, or higher.
  • the invention also provides improved methods of transformation. It is recognized that multiple copies of the enhancer domain can be used, including 1, 2, 3, 4, 5, 6 or more. In such methods, the transformants may be selected using the appropriate method based on the polynucleotide introduced into the organism.
  • the invention further provides a kit comprising at least one nucleic acid construct which comprises a chimeric transcriptional regulatory region comprising at least one copy of the enhancer domain of the invention or an active variant or fragment thereof.
  • a construct of the invention will comprise a T- DNA sequence.
  • the transcriptional control region used was the 3X35 S ENH (-) operably linked to the ZmUbi PRO-5UTR-ZmUbi intron 1 promoter (SEQ ID NO:9).
  • This transcriptional control region (SEQ ID NO:9) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer (3X) in the reverse direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
  • PHP20118 comprises 35S ENH(+):ZmUBI PRO-5UTR-UBI INTRONl (+ denotes forward direction of 35S enhancer).
  • This transcriptional control region (SEQ ID NO:11 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35 S enhancer in the forward direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
  • PHP20122 comprises 3X35S ENH (+):ZmUBI PRO-5UTR-UBI INTRONl (+ denotes forward direction of 35S enhancer).
  • This transcriptional control region (SEQ ID NO: 12 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer in the forward direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
  • PHP20120 comprises 35S ENH (-):ZmUBI PRO-5UTR-UBI INTRONl (- denotes reverse direction of 35S enhancer).
  • This transcriptional control region (SEQ ID NO: 13 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer in the reverse direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
  • PHP20124 comprises 3X35S ENH (-): ZmUBI PRO-5UTR-UBI INTRONl (- denotes reverse direction of 35S enhancer).
  • This transcriptional control region (SEQ ID NO: 14 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer in the reverse direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
  • the transformation experiments were conducted side-by-side using the same embryos from the same ears. Immature embryos of GS3 line were aseptically removed from each ear and divided into five portions. Each portion of the embryos was then infected with A. tumefaciens strain LB A4404 containing the expression cassettes from each of the five constructs, respectively. After 6 days co-cultivation, the embryos were transferred to fresh selection medium containing glyphosate. The transformed cells, which survived the glyphosate selection, proliferated and produced somatic embryogenic calli. After about two months subculture, the calli were then manipulated to regenerate whole transgenic plants with glyphosate presence and were transferred to the greenhouse.
  • TO plants were then subjected to glyphosate spray at 6X (156 oz/ac) Roundup Ready UltraMaxTM a t V3 or V4 stage in the greenhouse. Positive plants were sampled for quantitative PCR for copy number and western for expression. TO plants were then crossed with inbred lines to obtain seeds for further evaluation.
  • Transformation efficiency was measured as the percentage of the infected embryos that produced resistant calli after selection.
  • the average transformation efficiencies for PHP19288, PHP20118, PHP20120, PHP20122, and PHP20124 were 58%, 63%, 59%, 57%, and 51%, respectively.
  • TO plant efficacy was defined as the percentage of the TO events that were completely resistant to the 6x glyphosate spray.
  • the efficacy of the non-35 S construct (PHP19288) was 48.1%.
  • the efficacies of the 35S enhancer constructs (PHP20118, PHP20120, PHP20122, and PHP20124) were 96.6%, 93.5%, 89.1%, and 91.1%, respectively (Fig. 3).
  • the data showed that all 35S enhancer constructs significantly increased the plant efficacy against glyphosate.
  • This assay is being developed to improve the evaluation of expression of an insecticidal gene at a very early stage in the transformation process in order to identify potential problems with expression.
  • the basis of this assay is the use of the glyphosate acetyl transferase (GAT) gene (SEQ ID NO: 8) as a selectable marker.
  • GAT glyphosate acetyl transferase
  • Both GAT and the insecticidal test gene will be driven by a strong constitutive promoter and linked in the same construct.
  • the promoter employed comprised the ZmUBI PRO-5UTR-UBI INTRONl with the 3X35S enhancer as described above in Example 1. As a result it is expected that selection on high levels of glyphosate will identify high insecticidal test gene expressors.
  • the callus tissue from these putative high expressors will then be used in insect bioassays to determine whether the gene product is functional.
  • Those constructs showing efficacy can be advanced into transformation. If the construct does not show efficacy then follow up biochemical and molecular analyses can be conducted to identify the problem and the gene will be redesigned and retested in the system (Fig. 6).
  • Agrobacterium mediated transformation was used to introduce the GAT (SEQ ID NO: 8) expression cassette into the corn genome.
  • the GAT expression cassette comprises the promoter comprising ZmUBI PRO-5UTR-UBI INTRONl with the 3X35 S enhancer (as described above in Example 1) operably linked to the gat gene, and pinll terminator.
  • Agrobacterium tumefaciens, strain LBA4404 was pathogenically disarmed by removing its native T-DNA. Instead, the T-DNA site on the Ti plasmid contained the GAT expression cassette. Immature embryos of maize were aseptically removed from the developing caryopsis and treated with A. tumefaciens strain LBA4404 containing GAT expression cassettes.
  • the embryos were transferred to fresh selection medium that contained antibiotics and glyphosate.
  • the antibiotics kill any remaining Agrobacterium.
  • the selection medium is stimulatory to maize somatic embryogenesis and selective for those cells that contain an integrated gat gene. Therefore, callus that survives glyphosate to proliferate and produce embryogenic tissue is presumably genetically transformed. Callus samples were taken for molecular analysis to verify the presence of the transgene by PCR.
  • the embryonic tissue is then manipulated to regenerate transgenic plants in the presence of glyphosate that are then transferred to the greenhouse. TO plants are sprayed with glyphosate at different concentrations. Positive plants are sampled for molecular analysis for transgene copy number and crossed with inbred lines to obtain seeds from the initially transformed plants.
  • a glyphosate kill curve was established by testing non-transformed embryos response on media with different levels of glyphosate.
  • GS3 embryos were isolated from an immature ear and placed onto media containing glyphosate at 0.0, 0.5, 1.0, and 2.0 mM. After about 40 days culture, the response of the embryos were observed and recorded.
  • infected GS 3 embryos with the GAT construct were placed onto media containing glyphosate at 0.0, 0.5, 1.0, and 2.0 mM. After about 40 days culture, the response of the infected embryos were observed and recorded (Fig. 7).
  • a side-by-side experiment was conducted to compare the transformation efficiencies of GAT, bar and mopat.
  • Immature embryos of GS3 line were aseptically removed from each ear and divided into three portions. Each portion of the embryos was then infected with A. tumefaciens strain LB A4404 containing the expression cassettes of GAT, bar, or mopat respectively. After co-cultivation, the embryos infected with GAT construct were selected on routine glyphosate medium and the embryos infected with bar or mopat constructs were selected on routine glufosinate medium. The subcultures were done every 2 weeks. At about 50 days selection the responses of the embryos were observed and recorded.
  • Immature maize embryos from greenhouse donor plants are bombarded with a plasmid containing a chimeric transcriptional regulatory region comprising the enhancer domain of SEQ ID NO:1 operably linked to ZmUBI PRO-5UTR-ZmUBI INTRONl (SEQ ID NO: 6).
  • the chimeric transcriptional regulatory region is operably linked to a polynucleotide of interest and the selectable marker gene PAT (Wohlleben et al. (1988) Gene 70:25-37), which confers resistance to the herbicide Bialaphos.
  • the selectable marker gene is provided on a separate plasmid. Transformation is performed as follows. Media recipes follow below.
  • the ears are husked and surface sterilized in 30% Clorox bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water.
  • the immature embryos are excised and placed embryo axis side down (scutellum side up), 25 embryos per plate, on 560Y medium for 4 hours and then aligned within the 2.5cm target zone in preparation for bombardment.
  • a plasmid vector comprising the construct described above is made.
  • This plasmid DNA plus plasmid DNA containing a PAT selectable marker is precipitated onto 1.1 ⁇ m (average diameter) tungsten pellets using a CaCl 2 precipitation procedure as follows: 100 ⁇ l prepared tungsten particles in water; 10 ⁇ l (1 ⁇ g) DNA in Tris EDTA buffer (1 ⁇ g total DNA); 100 ⁇ l 2.5 M CaCl 2 ; and 10 ⁇ l 0.1 M spermidine.
  • Each reagent is added sequentially to the tungsten particle suspension, while maintained on the multitube vortexer.
  • the final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes.
  • the tubes are centrifuged briefly, liquid removed, washed with 500 ml 100% ethanol, and centrifuged for 30 seconds. Again the liquid is removed, and 105 ⁇ l 100% ethanol is added to the final tungsten particle pellet.
  • the tungsten/DNA particles are briefly sonicated and 10 ⁇ l spotted onto the center of each macrocarrier and allowed to dry about 2 minutes before bombardment.
  • sample plates are bombarded at level #4 in a particle gun. All samples receive a single shot at 650 PSI, with a total often aliquots taken from each tube of prepared particles/DNA.
  • the embryos are kept on 560Y medium for 2 days, then transferred to 560R selection medium containing 3 mg/liter Bialaphos, and subcultured every 2 weeks. After approximately 10 weeks of selection, selection- resistant callus clones are transferred to 288J medium to initiate plant regeneration. Following somatic embryo maturation (2-4 weeks), well-developed somatic embryos are transferred to medium for germination and transferred to the lighted culture room. Approximately 7-10 days later, developing plantlets are transferred to 272V hormone- free medium in tubes for 7-10 days until plantlets are well established.
  • Plants are then transferred to inserts in flats (equivalent to 2.5" pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1-2 weeks in the greenhouse, then transferred to classic 600 pots (1.6 gallon) and grown to maturity. Plants are monitored and scored for the desired phenotype based on the polynucleotide of interest.
  • Bombardment medium comprises 4.0 g/1 N6 basal salts (SIGMA C- 1416), 1.0 ml/1 Eriksson's Vitamin Mix (100OX SIGMA-1511), 0.5 mg/1 thiamine HCl, 120.0 g/1 sucrose, 1.0 mg/1 2,4-D, and 2.88 g/1 L-proline (brought to volume with D-I H 2 O following adjustment to pH 5.8 with KOH); 2.0 g/1 Gelrite (added after bringing to volume with D-I H 2 O); and 8.5 mg/1 silver nitrate (added after sterilizing the medium and cooling to room temperature).
  • Selection medium comprises 4.0 g/1 N6 basal salts (SIGMA C-1416), 1.0 ml/1 Eriksson's Vitamin Mix (100OX SIGMA-1511), 0.5 mg/1 thiamine HCl, 30.0 g/1 sucrose, and 2.0 mg/1 2,4-D (brought to volume with D-I H 2 O following adjustment to pH 5.8 with KOH); 3.0 g/1 Gelrite (added after bringing to volume with D-I H 2 O); and 0.85 mg/1 silver nitrate and 3.0 mg/1 bialaphos (both added after sterilizing the medium and cooling to room temperature).
  • Plant regeneration medium (288J) comprises 4.3 g/1 MS salts (GIBCO 11117- 074), 5.0 ml/1 MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/1 thiamine HCL, 0.10 g/1 pyridoxine HCL, and 0.40 g/1 glycine brought to volume with polished D-I H 2 O) (Murashige and Skoog (1962) Physiol. Plant.
  • Hormone-free medium comprises 4.3 g/1 MS salts (GIBCO 11117-074), 5.0 ml/1 MS vitamins stock solution (0.100 g/1 nicotinic acid, 0.02 g/1 thiamine HCL, 0.10 g/1 pyridoxine HCL, and 0.40 g/1 glycine brought to volume with polished D-I H 2 O), 0.1 g/1 myo-inositol, and 40.0 g/1 sucrose (brought to volume with polished D-I H 2 O after adjusting pH to 5.6); and 6 g/1 bacto-agar (added after bringing to volume with polished D-I H 2 O), sterilized and cooled to 6O 0 C.
  • Soybean embryogenic suspension cultures (cv. Jack) are maintained in 35 ml liquid medium SB 196 (see recipes below) on rotary shaker, 150 rpm, 26°C with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 60-85 ⁇ E/m2/s. Cultures are subcultured every 7 days to two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid SB 196 (the preferred subculture interval is every 7 days). Soybean embryogenic suspension cultures are transformed with the plasmids and DNA fragments described in the following examples by the method of particle gun bombardment (Klein et al. (1987) Nature, 327:70).
  • Soybean cultures are initiated twice each month with 5-7 days between each initiation.
  • soybeans with immature seeds from available soybean plants 45-55 days after planting are picked, removed from their shells and placed into a sterilized magenta box.
  • the soybean seeds are sterilized by shaking them for 15 minutes in a 5% Clorox solution with 1 drop of ivory soap (95 ml of autoclaved distilled water plus 5 ml Clorox and 1 drop of soap). Mix well.
  • Seeds are rinsed using 2 1 -liter bottles of sterile distilled water and those less than 4 mm are placed on individual microscope slides. The small end of the seed are cut and the cotyledons pressed out of the seed coat. Cotyledons are transferred to plates containing SBl medium (25-30 cotyledons per plate). Plates are wrapped with fiber tape and stored for 8 weeks. After this time secondary embryos are cut and placed into SB 196 liquid media for 7 days.
  • Plasmid DNA for bombardment are routinely prepared and purified using the method described in the PromegaTM Protocols and Applications Guide, Second Edition (page 106). Fragments of the plasmids carrying the chimeric transcriptional regulatory region comprising the enhancer domain of SEQ ID NO: 1 operably linked to ZmUBI PRO-5UTR-ZmUBI INTRONl (SEQ ID NO: 6) which is operably linked to a polynucleotide of interest are obtained by gel isolation of double digested plasmids.
  • plasmid DNA is digested in 0.5 ml of the specific enzyme mix that is appropriate for the plasmid of interest.
  • the resulting DNA fragments are separated by gel electrophoresis on 1% SeaPlaque GTG agarose (BioWhitaker Molecular
  • DNA fragments containing construct described above are cut from the agarose gel.
  • DNA is purified from the agarose using the GELase digesting enzyme following the manufacturer's protocol.
  • a 50 ⁇ l aliquot of sterile distilled water containing 3 mg of gold particles (3 mg gold) is added to 5 ⁇ l of a 1 ⁇ g/ ⁇ l DNA solution (either intact plasmid or DNA fragment prepared as described above), 50 ⁇ l 2.5M CaCl2 and 20 ⁇ l of 0.1 M spermidine.
  • the mixture is shaken 3 min on level 3 of a vortex shaker and spun for 10 sec in a bench microfuge. After a wash with 400 ⁇ l 100% ethanol the pellet is suspended by sonication in 40 ⁇ l of 100% ethanol.
  • Five ⁇ l of DNA suspension is dispensed to each flying disk of the Biolistic PDS1000/HE instrument disk. Each 5 ⁇ l aliquot contains approximately 0.375 mg gold per bombardment (i.e. per disk).
  • Tissue is bombarded 1 or 2 shots per plate with membrane rupture pressure set at 1100 PSI and the chamber evacuated to a vacuum of 27-28 inches of mercury. Tissue is placed approximately 3.5 inches from the retaining / stopping screen.
  • Transformed embryos were selected either using hygromycin (when the hygromycin phosphotransferase, HPT, gene was used as the selectable marker) or chlorsulfuron (when the acetolactate synthase, ALS, gene was used as the selectable marker).
  • the tissue is placed into fresh SB 196 media and cultured as described above.
  • the SB 196 is exchanged with fresh SB 196 containing a selection agent of 30 mg/L hygromycin.
  • the selection media is refreshed weekly.
  • green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters.
  • the tissue is divided between 2 flasks with fresh SB 196 media and cultured as described above.
  • the SB 196 is exchanged with fresh SB 196 containing selection agent of 100 ng/ml Chlorsulfuron.
  • the selection media is refreshed weekly.
  • green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into multiwell plates containing SB 196 to generate new, clonally propagated, transformed embryogenic suspension cultures.
  • the tissue In order to obtain whole plants from embryogenic suspension cultures, the tissue must be regenerated.
  • Embryos are cultured for 4-6 weeks at 26°C in SB 196 under cool white fluorescent (Phillips cool white Econowatt F40/CW/RS/EW) and Agro (Phillips F40 Agro) bulbs (40 watt) on a 16:8 hr photoperiod with light intensity of 90-120 uE/m2s.
  • embryo clusters are removed to a solid agar media, SB 166, for 1-2 weeks.
  • Clusters are then subcultured to medium SB 103 for 3 weeks. During this period, individual embryos can be removed from the clusters and screened for the desired phenotype based on the polynucleotide of interest employed. It should be noted that any detectable phenotype, resulting from the expression of the genes of interest, could be screened at this stage.
  • Matured individual embryos are desiccated by placing them into an empty, small petri dish (35 x 10 mm) for approximately 4-7 days. The plates are sealed with fiber tape (creating a small humidity chamber). Desiccated embryos are planted into SB71-4 medium where they were left to germinate under the same culture conditions described above. Germinated plantlets are removed from germination medium and rinsed thoroughly with water and then planted in Redi-Earth in 24-cell pack tray, covered with clear plastic dome. After 2 weeks the dome is removed and plants hardened off for a further week. If plantlets looked hardy they are transplanted to 10" pot of Redi-Earth with up to 3 plantlets per pot. After 10 to 16 weeks, mature seeds are harvested, chipped and analyzed for proteins.
  • SBl solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/ BRL - Cat#
  • SB 166 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/ BRL - Cat# 11117-066); 1 ml B5 vitamins IOOOX stock; 60 g maltose; 750 mg MgC12 hexahydrate; 5 g activated charcoal; pH 5.7; and, 2 g gelrite.
  • SB 103 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/BRL - Cat# 11117-066); 1 ml B5 vitamins IOOOX stock; 60 g maltose; 750 mg MgC12 hexahydrate; pH 5.7; and, 2 g gelrite.
  • SB 71-4 solid medium (per liter) comprises: 1 bottle Gamborg's B5 salts w/ sucrose (Gibco/BRL - Cat# 21153-036); pH 5.7; and, 5 g TC agar.
  • 2,4-D stock is obtained premade from Phytotech cat# D 295 - concentration is 1 mg/ml.
  • B5 Vitamins Stock (per 100 ml) which is stored in aliquots at -20C comprises: 1O g myo-inositol; 100 mg nicotinic acid; 100 mg pyridoxine HCl; and, 1 g thiamine. If the solution does not dissolve quickly enough, apply a low level of heat via the hot stir plate.
  • Chlorsulfuron Stock comprises lmg / ml in 0.01 N Ammonium Hydroxide

Abstract

Methods and compositions for expressing a polynucleotide of interest are provided. Compositions comprise an enhancer domain set forth in SEQ ID NO: 1, 10, 15, or 16 and active variants and fragments thereof. Further provided are DNA constructs comprising at least one transcriptional enhancer sequence comprising the nucleotide sequence set forth in SEQ ID NO:1, 10, 15, or 16 or an active variant or fragment thereof, operably linked to a heterologous promoter. Such chimeric transcription regulatory regions can be operably linked any polynucleotide of interest. Further provided are cells, plants, plant parts, and germplasm comprising the DNA construct. Methods of using the chimeric transcriptional regulatory region are also provided. In specific embodiments, methods of expressing a polynucleotide of interest, including for example, sequences that confer tolerance to herbicides, and methods to select a cell having the DNA construct are provided.

Description

METHODS AND COMPOSITIONS FOR THE EXPRESSION OF A POLYNUCLEOTIDE OF INTEREST
FIELD OF THE INVENTION
The present invention is drawn to the field of genetics and molecular biology. More particularly, the compositions and methods are directed to expression of polynucleotides of interest.
BACKGROUND OF THE INVENTION
Expression of heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed. Where expression in specific tissues or organs is desired, tissue-preferred promoters may be used. Where gene expression in response to a stimulus is desired, inducible promoters are the regulatory element of choice. In contrast, where continuous expression is desired throughout the cells of a plant, constitutive promoters are utilized. Additional regulatory sequences upstream and/or downstream from the core promoter sequence may be included in the expression constructs of transformation vectors to bring about varying levels of expression of heterologous nucleotide sequences in a transgenic plant.
Frequently it is desirable to express a DNA sequence in particular tissues or organs of a plant. For example, increased resistance of a plant to infection by soil- and air-borne pathogens might be accomplished by genetic manipulation of the plant's genome to comprise a tissue-preferred promoter operably linked to a heterologous pathogen-resistance gene such that pathogen-resistance proteins are produced in the desired plant tissue.
Alternatively, it might be desirable to inhibit expression of a native DNA sequence within a plant's tissues to achieve a desired phenotype. In this case, such inhibition might be accomplished with transformation of the plant to comprise a tissue-preferred promoter operably linked to an antisense nucleotide sequence, such that expression of the antisense sequence produces an RNA transcript that interferes with translation of the niRNA of the native DNA sequence.
Thus, isolation and characterization of regulatory sequences that can be positioned upstream and/or downstream from the core promoter sequence and allow varying levels of expression of heterologous nucleotide sequences in a transgenic plant are needed for genetic manipulation of plants.
BRIEF SUMMARY OF THE INVENTION
Methods and compositions for expressing a polynucleotide of interest are provided. Compositions comprise an enhancer domain set forth in SEQ ID NO:1, 10, 15, 16, 17 or 18 and active variants and fragments thereof. Further provided are DNA constructs comprising at least one transcriptional enhancer sequence comprising the nucleotide sequence set forth in SEQ ID NO:1, 10, 15, 16, 17, or 18 or an active variant or fragment thereof, operably linked to a heterologous promoter. Such chimeric transcription regulatory regions can be operably linked any polynucleotide of interest. Further provided are cells, plants, plant parts, and germplasm comprising the DNA construct.
Methods of using the chimeric transcriptional regulatory region are also provided. In specific embodiments, methods of expressing a polynucleotide of interest, including for example, sequences that confer tolerance to herbicides, and methods to select a cell having the DNA construct are provided.
BRIEF DESCRIPTION OF THE DRAWING(S) Figure 1 provides examples of constructs having 35 S enhancer elements. Figure 2 provides a schematic demonstrating the effect of 35S enhancers on
TX efficiency.
Figure 3 provides a schematic demonstrating the effect of 35S enhancers on TO efficiency.
Figure 4 provides a schematic demonstrating the effect of 35S enhancers on event copy number.
Figure 5 provides a schematic demonstrating the effect of 35S enhancers on expression. Figure 6 provides an insecticidal gene evaluation assay. Figure 7 provides a schematic showing the development of a GAT selection scheme.
Figure 8 demonstrates that GAT can be used as a selectable marker. Figure 9 provides a schematic demonstrating GAT transformation efficiencies.
DETAILED DESCRIPTION OF THE INVENTION The present inventions now will be described more fully hereinafter with reference to the accompanying drawings, in which some, but not all embodiments of the inventions are shown. Indeed, these inventions may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will satisfy applicable legal requirements. Like numbers refer to like elements throughout.
Many modifications and other embodiments of the inventions set forth herein will come to mind to one skilled in the art to which these inventions pertain having the benefit of the teachings presented in the foregoing descriptions and the associated drawings. Therefore, it is to be understood that the inventions are not to be limited to the specific embodiments disclosed and that modifications and other embodiments are intended to be included within the scope of the appended claims. Although specific terms are employed herein, they are used in a generic and descriptive sense only and not for purposes of limitation.
/. Polynucleotides
Compositions of the invention comprise an enhancer domain of a transcription control region and variants and fragments of that enhancer domain. When the enhancer domain is operably linked to a promoter, a functional transcriptional regulation region is formed which can direct expression of an operably linked polynucleotide of interest. In particular, the present invention provides isolated polynucleotides comprising the enhancer domain set forth in SEQ ID NO: 1, 10, 15, 16, 17 or 18; active variants and fragments thereof; and, polynucleotide consisting of the sequence of SEQ ID NO: 1, 10, 15, 16, 17 or 18. In still further embodiments, the enhancer domain employed does not comprise the region to the 35S promoter from about position -90 to about -46. The -90 to -46 region of the promoter is set forth in SEQ IDNO:5.
The term "promoter" is intended to mean a regulatory region of DNA comprising a transcriptional initiation region, which in some embodiments, comprises a TATA box capable of directing RNA polymerase II to initiate RNA synthesis at the appropriate transcription initiation site for a particular coding sequence. The promoter can further be operably linked to additional regulatory elements that influence transcription, including, but not limited to, introns, 5' untranslated regions, and enhancer elements. As used herein, an "enhancer sequence," "enhancer domain," "enhancer element," or "enhancer," when operably linked to an appropriate promoter, will modulate the level of transcription of an operably linked polynucleotide of interest. In specific embodiments, the enhancer of the invention can alter normal promoter expression patterns. For example, a tissue preferred/specific promoter, when operably linked to an enhancer of the invention, will demonstrate ectopic expression that is not normally observed with the promoter alone. For example, the oleosin promoter is a seed-preferred promoter but shows leaf expression in the presence of the enhancer of the invention or active variant or fragment thereof. In another example, the Zrp2 promoter, which is a leaf-preferred promoter, becomes constitutive when operably linked to the enhancer sequence of the invention or a biologically active variant or fragment thereof, and the RM2 promoter, a root promoter, when operably linked to the enhancer of the invention or biologically active variant or fragment thereof will show leaf expression. Thus, the compositions of the present invention further comprise a polynucleotide comprising a chimeric transcriptional control region comprising the promoter operably linked to at least one, two, three, four or more copies of the enhancer domain or an active variant or fragment of the domain. Such compositions allow for the expression of an operably linked polynucleotide of interest.
The invention encompasses isolated or substantially purified polynucleotide or protein compositions. An "isolated" or "purified" polynucleotide, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an "isolated" polynucleotide is free of sequences (optimally protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5' and 3' ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A polynucleotide that is substantially free of cellular material includes preparations of having less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of contaminating protein or polynucleotides. When the polynucleotide of the invention or biologically active portion thereof is recombinantly produced, optimally culture medium represents less than about 30%, 20%, 10%, 5%, or 1% (by dry weight) of chemical precursors.
Fragments and variants of the disclosed enhancer sequence are also encompassed by the present invention. In particular, fragments and variants of the enhancer domain of SEQ ID NO:1, 10, 15, 16, 17 or 18 are provided. As used herein, the term "fragment" means a portion of the polynucleotide. Fragments of an enhancer domain may retain the biological activity of modulating (increase or decrease) the level of transcription when operably linked to an appropriate promoter. Alternatively, fragments of a polynucleotide that is useful as hybridization probes may not necessarily retain biological activity. Fragments of a polynucleotide for the enhancer domain may range from at least about 50 nucleotides, about 100 nucleotides, about 150 nucleotides, about 200 nucleotides, about 250 nucleotides, about 300 nucleotides, about 350 nucleotides, about 400 nucleotides, about 450 nucleotides, about 500 nucleotides, and up to the full-length nucleotide sequence of the invention for the enhancer domain of the invention. In other embodiments, a fragment of the enhancer domain comprises a length of about 50 to about 100, 100 to about 150, 150 to about 200, 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, about 450 to about 500, about 500 to about 535 nucleotides. In specific embodiments, the active variants and fragments of the enhancer comprise conserved regions. Such regions include one or more of the underlined sequences set forth below cccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctctta cgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaatatcaaagatacag tctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatc tgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttga agatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaacc acgtcttcaaagcaagtggattgatgtgat (SEQ ID NO:1). See, also, Fang et al. (1989) The Plant Cell 1:141-150, herein incorporated by reference.
A biologically active portion of the enhancer domain can be prepared by isolating a portion of the enhancer domain of the invention and assessing the transcriptional regulation activity of the fragment. Methods to detect transcriptional regulation include, for example, assaying for the level of the operably linked polynucleotide of interest or assaying for the expression of a polypeptide encoded by an operably linked sequence of interest. Such assays can directly measure the level of the polynucleotide or polypeptide or they can assay for the activity or an expected phenotype when the expression of the sequence is altered. Such assays are known in the art. As used herein, the term "variants" means substantially similar sequences.
For polynucleotides, naturally occurring variants can be identified with the use of well-known molecular biology techniques, such as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined herein. For polynucleotides, a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a "native" polynucleotides comprises a naturally occurring nucleotide sequence. For polynucleotides, naturally occurring variants can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis. Generally, variants of a particular polynucleotides of the invention will have at least about 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to that particular polynucleotides as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a polynucleotides of the invention may differ from that sequence by as few as 1-15 nucleic acid residues, as few as 1-10, such as 6-10, as few as 10, 9, 8, 7, 6, 5, 4, 3, 2, or even 1 nucleic acid residue.
Thus, the genes and polynucleotides of the invention include both the naturally occurring sequences as well as mutant forms. Such variants will continue to possess the desired transcription regulatory activity. The deletions, insertions, and substitutions of the sequences encompassed herein are not expected to produce radical changes in the characteristics of the sequence. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays. That is, the activity can be evaluated using assays disclosed elsewhere herein. Variant polynucleotides also encompass sequences derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different enhancer domain sequences for the promoter can be manipulated to create a new enhancer domain. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91: 10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 75:436-438; Moore et al. (1997) J MoI Biol. 272:336-347; Zhang et al (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 397:288-291; and U.S. Patent Nos. 5,605,793 and 5,837,458.
The polynucleotides of the invention can be used to isolate corresponding sequences from other organisms, particularly other plants, more particularly other monocots. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire enhancer domain set forth herein or to fragments or variants thereof are encompassed by the present invention.
In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from genomic DNA extracted from any plant of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, New York), hereinafter Sambrook. See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector- specific primers, partially-mismatched primers, and the like.
In hybridization techniques, all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments from a chosen organism. The hybridization probes may be labeled with a detectable group such as 32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the enhancer domain of the invention. Methods for preparation of probes for hybridization and for construction of genomic libraries are generally known in the art and are disclosed in Sambrook.
For example, the entire enhancer domain sequence disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding enhancer sequences. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique among enhancer domain sequences and are at least about 10 nucleotides in length or at least about 20 nucleotides in length. Such probes may be used to amplify corresponding 35 S enhancer sequences from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism . Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) Cloning: A Laboratory Manual (2nd ed, Cold Spring Harbor Laboratory Press, Plainview, New York.)
Hybridization of such sequences may be carried out under stringent conditions. The terms "stringent conditions" and "stringent hybridization conditions" are intended to mean conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length or less than 500 nucleotides in length. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37°C, and a wash in IX to 2X SSC (2OX SSC = 3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 370C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a final wash in 0.1X SSC at 60 to 65°C for a duration of at least 30 minutes. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.
Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA- DNA hybrids, the Tm (thermal melting point) can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: Tm = 81.5°C + 16.6 (log M) + 0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about I0C for each 1% of mismatching; thus, Tm, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 100C. Generally, stringent conditions are selected to be about 5°C lower than the Tm for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the Tra; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the Tm; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 200C lower than the Tm. Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology — Hybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al. , eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See also Sambrook.
Thus, isolated sequences that have embryo-preferred promoter activity and which hybridize under stringent conditions to the enhancer domain sequences disclosed herein, or to fragments thereof, are encompassed by the present invention. Generally, stringent conditions are selected to be about 50C lower than the Tm for the specific sequence at a defined ionic strength and pH. However, stringent conditions encompass temperatures in the range of about 1°C to about 20°C lower than the Tm, depending upon the desired degree of stringency as otherwise qualified herein.
The following terms are used to describe the sequence relationships between two or more polynucleotides or polypeptides: (a) "reference sequence", (b) "comparison window", (c) "sequence identity", and, (d) "percentage of sequence identity."
(a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
(b) As used herein, "comparison window" makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two polynucleotides. Generally, the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches. Methods of alignment of sequences for comparison are well known in the art.
Thus, the determination of percent sequence identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988) CABIOS 4:11- 17; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the global alignment algorithm of Needleman and Wunsch (1970) J. MoI. Biol. 48:443- 453; the search-for-local alignment method of Pearson and Lipman (1988) Proc. Natl. Acad. ScI 85:2444-2448; the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. ScI USA 872264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. ScI USA 90:5873-5877. Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, California, USA). Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins et al. (1988) Gene 73:237-244 (1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) CABIOS 8:155-65; and Pearson et al. (1994) Meth. MoI. Biol. 24:307-331. The ALIGN program is based on the algorithm of Myers and Miller (1988) supra. A PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. The BLAST programs of Altschul et al (1990) J. MoI. Biol. 215:403 are based on the algorithm of Karlin and Altschul (1990) supra. BLAST nucleotide searches can be performed with the BLASTN program, score = 100, wordlength = 12, to obtain nucleotide sequences homologous to a nucleotide sequence encoding a protein of the invention. BLAST protein searches can be performed with the BLASTX program, score = 50, wordlength = 3, to obtain amino acid sequences homologous to a protein or polypeptide of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST5 PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may also be performed manually by inspection.
Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using GAP Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using GAP Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. By "equivalent program" is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.
GAP uses the algorithm of Needleman and Wunsch (1970) J. MoI. Biol. 48:443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater. GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity. The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the GCG Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. ScI USA 89:10915).
(c) As used herein, "sequence identity" or "identity" in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
(d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
//. DNA Constructs The use of the term "polynucleotide" is not intended to limit the present invention to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides, can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides of the invention also encompass all forms of sequences including, but not limited to, single-stranded forms, double-stranded forms, hairpins, stem-and-loop structures, and the like.
The polynucleotide disclosed in the present invention, as well as, variants and fragments thereof, are useful in the genetic manipulation of any plant. The enhancer domain or the active fragment or variant thereof are useful in this aspect when operably linked to a heterologous promoter. Such transcriptional regulatory control regions are referred to herein as "chimeric" transcriptional regulatory control regions. The chimeric transcriptional control regions can be opererably linked to a polynucleotide whose expression is to be controlled to achieve a desired phenotypic response. In this manner, the polynucleotide for the enhancer domain or the chimeric transcriptional regulatory control region of the invention may be provided in expression cassettes along with a polynucleotide of interest for expression in the organism of interest.
The chimeric transcriptional regulatory region can comprise multiple copies of the enhancer domain or active variants and fragments thereof. In specific embodiments, the chimeric transcriptional regulatory control region comprises at least 1, 2, 3, 4, 5, 6, 7 or more copies of the enhancer domain. In further embodiments, the enhancer domain employed does not comprise the sequence set forth in SEQ ID NO:5.
The distance between the promoter and the enhancer domain can vary, so long as the chimeric transcriptional regulatory region continues to direct transcription of the operably linked polynucleotide of interest in the desired manner. For example, an enhancer domain can be positioned at least about 10000 to about 15000, about 10000 to about a 9000, about 9000 to about 8000, about 8000 to about 7000, about 7000 to about 6000, about 6000 to about 5000, about 5000 to about 4000, about 4000 to about 3000, about 3000 to about 2000, about 2000 to about 1000, about 1000 to about 500, about 500 to about 250, about 250 to immediately adjacent to the promoter. It is further recognized that one or more copies of the enhancer can be placed upstream (5') of the prompter or alternatively, one or more copies of the enhancer can be located 3' to the promoter. In specific embodiments, when located 3' of the promoter, the enhancer is downstream of the terminator region. In still further embodiments, one or more of the enhancers can be arranged either in the 5' or 3' orientation (as shown in SEQ ID NO:1) or in the 3' to 5' orientation. If multiple enhancers are employed, the enhancers can be positioned in the construct with respect to the promoter such that the desired affect on expression is achieved. For example, the enhances can be immediately adjacent to each other or at least between 1 to 100, 100 to 300, 300 to 500, 500 to 1000 nucleotides apart.
Such constructs can be provided in expression cassettes for expression in the organism of interest. The cassette can include 3' regulatory sequences and 5' regulatory sequences operably linked to a polynucleotide of interest. "Operably linked" is intended to mean a functional linkage between two or more elements. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (i.e., a promoter) is a functional link that allows for expression of the polynucleotide of interest. An operable linkage between an enhancer and a transcriptional initiation region is a linkage which allows for the transcriptional control region to transcribe an operably linked polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the polynucleotide of interest to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.
The expression cassette can include, in the 5 '-3' direction of transcription, a chimeric transcriptional regulatory region comprising the enhancer domain or an active variant or fragment thereof, a promoter, or active variant or fragment thereof, a translational initiation region, a polynucleotide of interest, a translational termination region and, optionally, a transcriptional termination region functional in the host organism. The regulatory regions (i.e., promoters, enhancer domains, and translational termination regions, etc.) and/or the polynucleotide of interest may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide of interest may be heterologous to the host cell or to each other. As used herein, "heterologous" in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide. A "heterologous polynucleotide" as it relates to an enhancer domain is intended to mean a sequence that is not naturally occurring with the enhancer domain sequence of the invention. While this promoter is heterologous to the enhancer domain sequence, it may be homologous, or native, or heterologous, or foreign, to the plant host.
The termination region may be native with the enhancer domain or the transcriptional initiation region, may be native with the operably linked polynucleotide of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the enhancer domain, the transcriptional initiation region, , the polynucleotide of interest, the plant host, or any combination thereof. Convenient termination regions are available from the Ti- plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (199I) Mo/. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149;
Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639.
The expression cassette comprising the sequences of the present invention may also contain at least one additional nucleotide sequence for a gene to be cotransformed into the organism. Alternatively, the additional sequence(s) can be provided on another expression cassette. Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.
The expression cassettes may additionally contain 5' leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5' noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (GaIUe et a (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus) {Virology 154:9-20), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et a (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et a (1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et a (1991) Virology 81:382-385). See also, Della-Cioppa et al (1987) Plant Physiol. 84:965-968.
In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved. The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4- dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as β-galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al (2004) Biotechnol Bioeng 85:610-9 and Fetter et al (2004) Plant Cell 16:215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al (2002) Plant Physiol 129:913-42), and yellow florescent protein (PhiYFP™ from Evrogen, see, Bolte et al. (2004) J. Cell Science 117:943-54). For additional selectable markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al (1992) Proc. Natl. Acad. Set USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) MoI Microbiol. 6:2419-2422; Barkley et al (1980) in The Operon, pp. 177-220; Hu et al (1987) Cell 48:555-566; Brown et al (1987) Cell 49:603-612; Figge et al (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl Acad. Ad. USA 86:5400-5404; Fuerst et al (1989) Proc. Natl. Acad. Set USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al (1993) Proc. Natl. Acad. ScI USA 90:1917-1921; Labow et al. (199O) MoI Cell Biol 10:3343-3356; Zambretti et al (1992) Proc. Natl Acad. Sci. USA 89:3952-3956; Bairn et al (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman (1989) Topics MoI. Struc. Biol. 10:143-162; Degenkolb etal (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al (1985) Handbook of Experimental Pharmacology, Vol. 78 ( Springer- Verlag, Berlin); Gill etal (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference. The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the present invention. As discussed above, a chimeric transcriptional regulatory region comprising at least one copy of the enhancer domain or active variant or fragment thereof operably linked to a heterologous promoter are provided. Any promoter of interest can be operably linked to the enhancer domain of the invention. Such promoters can be selected based on the desired outcome and can comprises constitutive, inducible, tissue-preferred, or other promoters for expression in a host cell of interest (i.e., a plant). Constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Patent No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810- 812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant MoI. Biol. 12:619-632 and Christensen et al. (1992) Plant MoI. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81 :581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Patent No.
5,659,026), and the like. Other constitutive promoters include, for example, U.S. Patent Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.
In one embodiment, the promoter comprises an inducible promoter, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-l,3-glucanase, chitinase, etc. See, for example, Redolfi et al (1983) Neth J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant MoI. Virol. 4:111-116. See also WO 99/43819, herein incorporated by reference.
Promoters that are expressed locally at or near the site of pathogen infection can be used. See, for example, Marineau et al. (1987) Plant MoI. Biol. 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) MoI. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA 91:2507-2511; Warner et al. (1993) Plant J. 3:191-201; Siebertz et al. (1989) Plant Cell 1:961-968; U.S. Patent No. 5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero et al. (1992) Physiol. MoI. Plant Path. 41:189-200). Additionally, as pathogens find entry into plants through wounds or insect damage, a wound-inducible promoter may be used in the constructions of the invention. Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotechnology 14:494-498); wunl and wun2, U.S. Patent No. 5,428,148; winl and win2 (Stanford et al. (1989) MoI. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225:1570-1573); WIPl (Rohmeier et al. (1993) Plant MoI. Biol. 22:783-792; Eckelkamp et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2):141-150); and the like, herein incorporated by reference. Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical- inducible promoters are known in the art and include, but are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR- Ia promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. ScI USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline- repressible promoters (see, for example, Gatz et al. (1991) MoI. Gen. Genet. 227:229- 237, and U.S. Patent Nos. 5,814,618 and 5,789,156), herein incorporated by reference.
Tissue-preferred promoters can be utilized to target enhanced expression of a polynucleotide of interest within a particular plant tissue. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) MoI. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2):157-168; Rinehart et al. (1996) Plant
Physiol. 112(3):1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al (1994) Plant Cell Physiol. 35 (5) :773-778; Lam (1994) Results Probl. Cell Differ. 20:181- 196; Orozco et αl. (1993) Plant MoI Biol. 23(6):1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. ScI USA 90(20):9586-9590; and Guevara-Garcia et al (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression. Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et α/. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant MoI. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. ScI USA 90(20):9586-9590. Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant MoI. Biol. 20(2):207-218 (soybean root- specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10):1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant MoI. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991) Plant Cell 3(1):11-22 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also Bogusz et al. (1990) Plant Cell 2(7):633-641, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a β-glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved. Leach and Aoyagi (1991) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes (see Plant Science (Limerick) 79(l):69-76). They concluded that enhancer and tissue- preferred DNA determinants are dissociated in those promoters. Teeri et al. (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2' gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see EMBOJ. 8(2):343-350). The TRl' gene, fused to nptll (neomycin phosphotransferase II) showed similar characteristics. Additional root- preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant MoI. Biol. 29(4):759-772); and rolB promoter (Capana et al. (1994) Plant MoI. Biol. 25(4):681-691. See also U.S. Patent Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and 5,023,179.
Seed-preferred promoters include both seed-specific promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as seed-germinating promoters (those promoters active during seed germination). See Thompson et al. (1989) BioEssays 10:108, herein incorporated by reference. Such seed-preferred promoters include, but are not limited to, Ciml (cytokinin-induced message); cZ19Bl (maize 19 kDa zein); milps (myo-inositol-1- phosphate synthase) (see WO 00/11177 and U.S. Patent No. 6,225,529; herein incorporated by reference). Gamma-zein is an endosperm-specific promoter. Globulin 1 (GIb-I) is a representative embryo-specific promoter. For dicots, seed- specific promoters include, but are not limited to, bean β-phaseolin, napin, β- conglycinin, soybean lectin, cruciferin, and the like. For monocots, seed-specific promoters include, but are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, gamma-zein, waxy, shrunken 1, shrunken 2, Globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from endl and end! genes are disclosed; herein incorporated by reference.
Polynucleotide sequences expressed by the chimeric transcriptional regulatory control region of the invention may be used for varying the phenotype of a plant. Various changes in phenotype are of interest including modifying expression of a gene in a plant embryo, altering a plant's pathogen or insect defense mechanism, increasing the plants tolerance to herbicides in a plant, altering embryo development to respond to environmental stress, and the like. These results can be achieved by the expression of a heterologous nucleotide sequence of interest comprising an appropriate gene product. In specific embodiments, the heterologous nucleotide sequence of interest is an endogenous plant sequence whose expression level is increased in the plant or plant part. Alternatively, the results can be achieved by providing for a reduction of expression of one or more polynucleotide of interest. The chimeric transcriptional regulatory control region of the invention can further comprise additional portions of other transcriptional regulatory regions. Thus, the transcriptional regulatory control element disclosed herein, comprising the enhancer domain and a heterologous promoter can comprise upstream regulatory elements such as, those responsible for tissue and temporal expression of the coding sequence. In the context of this disclosure, the term "regulatory element" also refers to a sequence of DNA, usually, but not always, upstream (5') to the coding sequence of a structural gene, which includes sequences which modulate the expression of the coding region. It is to be understood that nucleotide sequences, located within introns, or 3' of the coding region sequence may also contribute to the regulation of expression of a coding region of interest. Examples of suitable introns include, but are not limited to, the maize IVS6 intron, or the maize actin intron. A regulatory element may also include those elements located downstream (3') to the site of transcription initiation, or within transcribed regions, or both. In the context of the present invention a post-transcriptional regulatory element may include elements that are active following transcription initiation, for example translational and transcriptional enhancers, translational and transcriptional repressors, and mRNA stability determinants.
It is further recognized that the enhancer of the invention can be positioned in the DNA construct between and operably linked to a first and a second promoter. In such embodiments, the enhancer allows for a modulation in expression of both the first and the second promoters from a divergent direction. Exemplary, but non- limiting, examples of such DNA constructs comprise in the 5' to 3' or 3' to 5' orientation: a first polynucleotide of interest operably linked to a first promoter, operably linked to at least one copy of an enhancer of the invention, operably linked to a second promoter, operably linked to a second polynucleotide of interest. In specific embodiments, the enhancer sequence is heterologous to the first and the second enhancer sequence.
///. Plants and Parts Thereof
As used herein, the term plant includes plant cells, plant protoplasts, plant cell tissue cultures from which plants can be regenerated, plant calli, plant clumps, and plant cells that are intact in plants or parts of plants such as embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like. Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the introduced polynucleotides.
The present invention may be used for transformation of any plant species, including, but not limited to, monocots and dicots. Examples of plant species of interest include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. jimced), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativd), rice (Oryza sativά), rye (Secale cereaϊe), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracandj), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.)5 coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado
(Persea americanά), fig (Ficus casica), guava (Psidium guajava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew (Anacardium occidentale), macadamia (Macadamia integrifolia), almond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, barley, vegetables, ornamentals, and conifers.
Vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativd), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C sativus), cantaloupe (C cantalupensis), and musk melon (C melo). Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybridά), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrimd), and chrysanthemum.
Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsameά); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis). In specific embodiments, plants of the present invention are crop plants (for example, corn, alfalfa, sunflower, Brassica, soybean, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, etc.). In other embodiments, corn and soybean plants are optimal, and in yet other embodiments corn plants are optimal.
Other plants of interest include grain plants that provide seeds of interest, oil- seed plants, and leguminous plants. Seeds of interest include grain seeds, such as corn, wheat, barley, rice, sorghum, rye, etc. Oil-seed plants include cotton, soybean, safflower, sunflower, Brassica, maize, alfalfa, palm, coconut, etc. Leguminous plants include beans and peas. Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc. A "subject plant or plant cell" is one in which genetic alteration, such as transformation, has been effected as to a gene of interest, or is a plant or plant cell which is descended from a plant or cell so altered and which comprises the alteration. A "control" or "control plant" or "control plant cell" provides a reference point for measuring changes in phenotype of the subject plant or plant cell. A control plant or plant cell may comprise, for example: (a) a wild-type plant or cell, i.e., of the same genotype as the starting material for the genetic alteration which resulted in the subject plant or cell; (b) a plant or plant cell of the same genotype as the starting material but which has been transformed with a null construct (i.e. with a construct which has no known effect on the trait of interest, such as a construct comprising a marker gene); (c) a plant or plant cell which is a non- transformed segregant among progeny of a subject plant or plant cell; (d) a plant or plant cell genetically identical to the subject plant or plant cell but which is not exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the subject plant or plant cell itself, under conditions in which the gene of interest is not expressed.
Any organism having a chimeric transcriptional control region comprising an enhancer domain of the invention or an active variant or fragment thereof are provided. In specific embodiments, plants, plant parts, cells, and germplasm having a chimeric transcriptional control region comprising an enhancer domain of the invention or an active variant or fragment thereof are provided. In specific embodiments, the chimeric transcriptional control region is operably linked to a polynucleotide of interest. Such polynucleotides include, for example, any polynucleotide that confers tolerance to a herbicide. Plant cells, plant parts and germplasm comprising such sequences are further provided.
IV. Polynucleotides of Interest The chimeric transcriptional regulatory control region having the enhancer domain or an active variant or fragment thereof can be used to express any polynucleotide of interest. General categories of polynucleotides of interest for the present invention include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes, for example, include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, and environmental stress resistance (altered tolerance to cold, salt, drought, etc).
Insect resistance genes may encode resistance to pests that have great yield drag such as rootworm, cutworm, European corn borer, and the like. Such genes include, for example, Bacillus thuringiensis toxic protein genes (U.S. Patent Nos. 5,366,892; 5,747,450; 5,736,514; 5,723,756; 5,593,881; and Geiser et al. (1986) Gene 48:109); and the like.
Genes encoding disease resistance traits include detoxification genes, such as those which detoxify fumonisin (U.S. Patent No. 5,792,931); avirulence (avr) and disease resistance (R) genes (Jones et al. (1994) Science 266:1 '89; Martin et al. (1993) Science 262:1432; and Mindrinos et al. (1994) Cell 7S:1089); and the like. Exogenous products include plant enzymes and products as well as those from other sources including prokaryotes and other eukaryotes. Such products include enzymes, cofactors, hormones, and the like.
Examples of other applicable genes and their associated phenotype include the gene which encodes viral coat protein and/or RNA, or other viral or plant genes that confer viral resistance; genes that confer fungal resistance; genes that promote yield improvement; and genes that provide for resistance to stress, such as cold, dehydration resulting from drought, heat and salinity, toxic metal or trace elements, or the like. As noted, the polynucleotide operably linked to the transcription control region comprising the enhancer domain herein may be an antisense sequence for a targeted gene. Thus, the promoter sequences disclosed herein may be operably linked to antisense DNA sequences to reduce or inhibit expression of a native protein in the plant embryo. "RNAi" refers to a series of related techniques to reduce the expression of genes (See for example U.S. Patent No. 6,506,559). Older techniques referred to by other names are now thought to rely on the same mechanism, but are given different names in the literature. These include "antisense inhibition," the production of antisense RNA transcripts capable of suppressing the expression of the target protein, and "co-suppression" or "sense-suppression," which refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar foreign or endogenous genes (U.S. Patent No. 5,231,020, incorporated herein by reference). Such techniques rely on the use of constructs resulting in the accumulation of double stranded RNA with one strand complementary to the target gene to be silenced. The 35S enhancer in the context of a transcription control region of the embodiments may be used to drive expression of constructs that will result in RNA interference including microRNAs and siRNAs.
Where appropriate, the polynucleotides may be optimized for increased expression in the transformed plant. That is, the polynucleotides can be synthesized using plant-preferred codons for improved expression. See, for example, Campbell and Gowri (1990) Plant Physiol. 92:1-11 for a discussion of host-preferred codon usage. Methods are available in the art for synthesizing plant-preferred genes. See, for example, U.S. Patent Nos. 5,380,831, and 5,436,391, and Murray et al (1989) Nucleic Acids Res. 17:477-498, herein incorporated by reference.
In one embodiment, the polynucleotide of interest encodes a polynucleotide that confers tolerance to a herbicide of interest. In one embodiment, the polynucleotide that confers tolerance to herbicide of interest comprises an ALS inhibitor tolerant polypeptide which confers tolerance of a dose of sulfonylurea, imidazolinone, triazolopyrimidines, pyrimidinyoxy(thio)benzoates, and/or sulfonylamino-carbonyl-triazonline herbicide. Sulfonylurea and imidazolinone herbicides inhibit growth of higher plants by blocking acetolactate synthase (ALS), also known as, acetohydroxy acid synthase (AHAS). For example, plants containing particular mutations in ALS {e.g., the S4 and/or HRA mutations) are tolerant to sulfonylurea herbicides. The production of sulfonylurea-tolerant plants and imidazolinone-tolerant plants is described more fully in U.S. Patent Nos. 5,605,011 ; 5,013,659; 5,141,870; 5,767,361; 5,731,180; 5,304,732; 4,761,373; 5,331,107; 5,928,937; and 5,378,824; and international publication WO 96/33270, which are incorporated herein by reference in their entireties for all purposes. In specific embodiments, the ALS inhibitor tolerant polypeptide comprises a sulfonamide- tolerant acetolactate synthase, a sulfonamide-tolerant acetohydroxy acid synthase, an imidazolinone-tolerant acetolactate synthase, or an imidazolinone-tolerant acetohydroxy acid synthase.
Polynucleotides coding for resistance to herbicides that act to inhibit action of glutamine synthase, such as phosphinothricin or basta (e.g., the bar gene), glyphosate (e.g., the EPSPS gene and the GAT gene; see, for example, U.S. Publication No. 20040082770 and WO 03/092360) or other such genes known in the art can also be used . The bar gene encodes resistance to the herbicide basta, the nptll gene encodes resistance to the antibiotics kanamycin and geneticin, and the ALS gene mutants encode resistance to the herbicide chlorsulfuron.
Glyphosate resistance is imparted by mutant 5-enolpyruvl-3-phosphikimate synthase (EPSP) and aroA genes. See, for example, U.S. Patent No. 4,940,835 to Shah et al., which discloses the nucleotide sequence of a form of EPSPS which can confer glyphosate resistance. U.S. Patent No. 5,627,061 to Barry et al. also describes genes encoding EPSPS enzymes. See also U.S. Patent Nos. 6,248,876 Bl; 6,040,497; 5,804,425; 5,633,435; 5,145,783; 4,971,908; 5,312,910; 5,188,642; 4,940,835; 5,866,775; 6,225,114 Bl; 6,130,366; 5,310,667; 4,535,060; 4,769,061; 5,633,448; 5,510,471; Re. 36,449; RE 37,287 E; and 5,491,288; and international publications WO 97/04103; WO 97/04114; WO 00/66746; WO 01/66704; WO 00/66747 and WO 00/66748, which are incorporated herein by reference for this purpose. Glyphosate resistance is also imparted to plants that express a gene that encodes a glyphosate oxido-reductase enzyme as described more fully in U.S. Patent Nos. 5,776,760 and 5,463,175, which are incorporated herein by reference for this purpose. In addition glyphosate resistance can be imparted to plants by the over expression of genes encoding glyphosate N-acetyltransferase. See, for example, U.S. Patent Application Serial Nos. 10/004,357 and 10/427,692, each of which are herein incorporated by reference.
Polypeptides conferring tolerance to herbicides which inhibit the enzyme glutamine synthase, such as phosphinothricin or glufosinate (e.g., the bar gene) can also be used. Glutamine synthetase (GS) appears to be an essential enzyme necessary for the development and life of most plant cells, and inhibitors of GS are toxic to plant cells. Glufosinate herbicides have been developed based on the toxic effect due to the inhibition of GS in plants. These herbicides are non-selective; that is, they inhibit growth of all the different species of plants present. The development of plants containing an exogenous phosphinothricin acetyltransferase is described in U.S. Patent Nos. 5,969,213; 5,489,520; 5,550,318; 5,874,265; 5,919,675; 5,561,236; 5,648,477; 5,646,024; 6,177,616; and 5,879,903, which are incorporated herein by reference in their entireties for all purposes. Mutated phosphinothricin acetyltransferase having this activity are also disclosed. In still other embodiments, polypeptides conferring tolerance to herbicides which inhibit protox (protoporphyrinogen oxidase) can be used. Protox is necessary for the production of chlorophyll, which is necessary for all plant survival. The protox enzyme serves as the target for a variety of herbicidal compounds. These herbicides also inhibit growth of all the different species of plants present. The development of plants containing altered protox activity which are resistant to these herbicides are described in U.S. Patent Nos. 6,288,306; 6,282,837; and 5,767,373; and international publication WO 01/12825, which are incorporated herein by reference in their entireties for all purposes.
In still other embodiments, polypeptides involving other modes of herbicide resistance are employed. For example, hydroxyphenylpyruvatedioxygenases are enzymes that catalyze the reaction in which para-hydroxyphenylpyruvate (HPP) is transformed into homogentisate. Molecules which inhibit this enzyme and which bind to the enzyme in order to inhibit transformation of the HPP into homogentisate are useful as herbicides. Plants more resistant to certain herbicides are described in U.S. Patent Nos. 6,245,968; 6,268,549; and 6,069,115; and international publication WO 99/23886, which are incorporated herein by reference in their entireties for all purposes. Mutated hydroxyphenylpyruvatedioxygenase having this activity are also disclosed.
Additional herbicides, include but are not limited to, an acetyl Co-A carboxylase inhibitor such as quizalofop-P-ethyl, a synthetic auxin such as quinclorac, a protoporphyrinogen oxidase (PPO) inhibitor herbicide (such as sulfentrazone), a pigment synthesis inhibitor herbicide such as a hydroxyphenylpyruvate dioxygenase inhibitor {e.g., mesotrione or sulcotrione), a phosphinothricin acetyltransferase or a phytoene desaturase inhibitor like diflufenican or pigment synthesis inhibitor.
V. Methods of Introducing
The DNA construct comprising the enhancer domain of the present invention operably linked to a heterologous promoter can be used to transform any organism of interest. In specific embodiments, the organism comprises a plant or part thereof. In this manner, genetically modified plants, plant cells, plant tissue, seed, embryos, and the like can be obtained.
The methods of the invention involve introducing a polypeptide or polynucleotide into a plant. "Introducing" is intended to mean presenting to the plant the polynucleotide in such a manner that the sequence gains access to the interior of a cell of the plant. The methods of the invention do not depend on a particular method for introducing a sequence into a plant, only that the polynucleotide or polypeptides gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotide or polypeptides into plants are known in the art including, but not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.
"Stable transformation" is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. "Transient transformation" is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.
Transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechnigues 4:320-334), electroporation (Riggs et al.
(1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediatad transformation (U.S. Patent No. 5,563,055 and U.S. Patent No. 5,981,840), direct gene transfer (Paszkowski et αl. (1984) EMBO J. 3 :2717-2722), and ballistic particle acceleration (see, for example, U.S. Patent Nos. 4,945,050; U.S. Patent No. 5,879,918; U.S. Patent No. 5,886,244; and, 5,932,782; Tomes et αl. (1995) in Plαnt Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lecl transformation (WO 00/28058). Also see Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P: 175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); U.S. Patent Nos. 5,240,855; 5,322,783; and, 5,324,646; Klein et al. (1988) Plant Physiol. 91 :440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311 :763-764; U.S. Patent No. 5,736,369 (cereals); Bytebier et al.
(1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium turnefaciens); all of which are herein incorporated by reference.
In specific embodiments, the DNA construct of the invention can be provided to a plant using a variety of transient transformation methods. Such transient transformation methods include, the DNA construct comprising the enhancer domain can be transiently transformed into the plant using techniques known in the art. Such techniques include viral vector system and the precipitation of the polynucleotide in a manner that precludes subsequent release of the DNA. Thus, the transcription from the particle-bound DNA can occur, but the frequency with which its released to become integrated into the genome is greatly reduced. Such methods include the use particles coated with polyethylimine (PEI; Sigma #P3143).
In other embodiments, the polynucleotide of the invention may be introduced into plants by contacting plants with a virus or viral nucleic acids. Generally, such methods involve incorporating a nucleotide construct of the invention within a viral DNA or RNA molecule. Further, it is recognized that promoters of the invention also encompass promoters utilized for transcription by viral RNA polymerases. Methods for introducing polynucleotides into plants and expressing an operably linked sequence, involving viral DNA or RNA molecules, are known in the art. See, for example, U.S. Patent Nos. 5,889,191, 5,889,190, 5,866,785, 5,589,367, 5,316,931, and Porta et al. (1996) Molecular Biotechnology 5:209-221; herein incorporated by reference.
Methods are known in the art for the targeted insertion of a polynucleotide at a specific location in the plant genome. In one embodiment, the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system., See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference. Briefly, the polynucleotide of the invention can be contained in transfer cassette flanked by two non-recombinogenic recombination sites. The transfer cassette is introduced into a plant having stably incorporated into its genome a target site which is flanked by two non-recombinogenic recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.
The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting progeny having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the present invention provides transformed seed (also referred to as "transgenic seed") having a polynucleotide of the invention, for example, an expression cassette of the invention, stably incorporated into their genome.
In certain embodiments the polynucleotides of the present invention can be stacked with any combination of polynucleotide sequences of interest in order to create plants with a desired trait. A trait, as used herein, refers to the phenotype derived from a particular sequence or groups of sequences. For example, the polynucleotides of the present invention may be stacked with any other polynucleotides encoding polypeptides having pesticidal and/or insecticidal activity and/or herbicidal activity, such as other Bacillus thuringiensis toxic proteins (described in U.S. Patent Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756;
5,593,881; and Geiser et al. (1986) Gene 48:109), lectins (Van Damme et al. (1994) Plant MoI. Biol. 24:825, pentin (described in U.S. Patent No. 5,981,722), and the like. The combinations generated can also include multiple copies of any one of the polynucleotides of interest. The polynucleotides of the present invention can also be stacked with any other gene or combination of genes to produce plants with a variety of desired trait combinations including, but not limited to, traits desirable for animal feed such as high oil genes (e.g., U.S. Patent No. 6,232,529); balanced amino acids (e.g., hordothionins (U.S. Patent Nos. 5,990,389; 5,885,801; 5,885,802; and 5,703,409); barley high lysine (Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO 98/20122) and high methionine proteins (Pedersen et al. (1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; and Musumura et al (1989) Plant MoI. Biol. 12:123)); increased digestibility (e.g., modified storage proteins (U.S. Application Serial No. 10/053,410, filed November 7, 2001); and thioredoxins (U.S. Application Serial No. 10/005,429, filed December 3, 2001)); the disclosures of which are herein incorporated by reference.
The polynucleotides of the present invention can also be stacked with traits desirable for disease or herbicide resistance (e.g., fumonisin detoxification genes (U.S. Patent No. 5,792,931); avirulence and disease resistance genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al. (1994) Cell 78:1089); acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations; inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance (EPSPS gene)); and traits desirable for processing or process products such as high oil (e.g., U.S. Patent No. 6,232,529 ); modified oils (e.g., fatty acid desaturase genes (U.S. Patent No. 5,952,544; WO 94/11516)); modified starches (e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE), and starch debranching enzymes (SDBE)); and polymers or bioplastics (e.g., U.S. Patent No. 5.602,321; beta-ketothiolase, polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-5847) facilitate expression of polyhydroxyalkanoates (PHAs)); the disclosures of which are herein incorporated by reference. One could also combine the polynucleotides of the present invention with polynucleotides providing agronomic traits such as male sterility (e.g., see U.S. Patent No. 5.583,210), stalk strength, flowering time, or transformation technology traits such as cell cycle regulation or gene targeting (e.g., WO 99/61619, WO 00/17364, and WO 99/25821); the disclosures of which are herein incorporated by reference. These stacked combinations can be created by any method including, but not limited to, cross-breeding plants by any conventional or TopCross methodology, or genetic transformation. If the sequences are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences will be introduced, the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of the polynucleotide of interest. This may be combined with any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant. It is further recognized that polynucleotide sequences can be stacked at a desired genomic location using a site-specific recombination system. See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference.
VI. Methods of Use
A method for modulating the concentration and/or activity of any polynucleotide or polypeptide encoded thereby is provided. In general, concentration and/or activity is increased or decreased by at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% relative to a native control plant, plant part, or cell which did not have the sequence of the invention introduced. Modulation in the present invention may occur during and/or subsequent to growth of the plant to the desired stage of development. The expression level of the polynucleotide or polypeptide of interest may be measured directly, for example, by assaying for the level of the polypeptide or polynucleotide in the organism, or indirectly, for example, by measuring the activity of the polypeptide or polypeptide in the organism.
In specific embodiments, the DNA construct comprising the enhancer domain is introduced into the plant cell. Subsequently, a plant cell having the introduced sequence of the invention is selected using methods known to those of skill in the art such as, but not limited to, Southern blot analysis, DNA sequencing, PCR analysis, or phenotypic analysis. In one method, a population of cells is provided and a DNA construct comprising a chimeric transcriptional regulatory region of the invention operably linked to the polynucleotide comprising a selectable marker is introduced into at least one cell of the population. The population of cells is then contacted with an effective concentration of an appropriate selection agent; and, the plant cell expressing the polynucleotide is selected. The plant cells having the DNA construct are thereby identified. A plant or plant part altered or modified by the foregoing embodiments is grown under plant forming conditions for a time sufficient to modulate the concentration and/or activity of the polynucleotide operably linked to the transcriptional control region comprising the enhancer domain. Plant forming conditions are well known in the art and are discussed briefly elsewhere herein.
In one embodiment, the enhancer of the invention is employed to modulate the expression of two polynucleotides of interest. In such methods, a DNA construct having the enhancer of the invention positioned between and operably linked to a first and a second promoter is introduced into a plant. In such methods, the enhancer allows for a modulation in expression of both the first and the second promoters from a divergent direction. Exemplary, but non-limiting, examples of such DNA constructs comprise in the 5' to 3' or 3' to 5' orientation: a first polynucleotide of interest operably linked to a first promoter, operably linked to at least one copy of an enhancer of the invention, operably linked to a second promoter, operably linked to a second polynucleotide of interest. In specific embodiments, the enhancer sequence is heterologous to the first and the second enhancer sequence.
In some embodiments, the chimeric transcriptional regulatory region comprising the enhancer domain can be used in DNA constructs which are operably linked to a selectable marker, such as a polynucleotide that can confer tolerance to a herbicide. For example, a DNA construct comprising a chimeric transcriptional regulatory region comprising an enhancer domain of the invention is operably linked to a polynucleotide that can confers tolerance to a herbicide which can function as a selectable marker, e.g., in a plant, bacteria, actinomycete, yeast, algae or other fungi. For example, an organism that has been transformed with such a DNA construct can be selected based on its ability to grow in the presence of a herbicide that would not allow a control organism to grow. As used herein "an effective concentration" of a selective agent is a concentration of an agent that allows cells expressing the polynucleotide of interest to survive, but cells not expressing the polynucleotide sequence of interest will not survive in the presence of the agent at that concentration. As demonstrated in Example 4 and Figure 6, such methods of selection allow one to evaluate expression of a polynucleotide of interest. For example, in specific embodiments such methods allow one to potential problems with the expression of a polynucleotide of interest at early stages in the transformation process. In such embodiments, the construct comprising the chimeric transcriptional regulatory region is operably linked to a polynucleotide encoding a selectable marker. The same construct further comprises a polynucleotide of interest which is also operably linked to the chimeric transcriptional regulatory region or to a separate promoter of interest. While any polynucleotide of interest can be employed, in specific examples, insecticidal polynucleotides are employed.
In other embodiments, a construct comprising a chimeric transcriptional regulatory region comprising an enhancer domain is operably linked to a polynucleotide of interest may exhibit a very high transformation efficiency, such as an efficiency of at least 20%, 30%, 40%, 50%, or 60% or higher. In specific embodiments, the polynucleotide of interest confers tolerance to a selectable marker, and in a more specific embodiment, the sequence confers tolerance to a herbicide of interest). In this manner, improved methods of transformation are provided. Moreover, when a construct comprising an enhancer domain of the invention is operably linked to a polynucleotide that can confer tolerance to a selectable marker (such as a sequence that confers herbicide tolerance), the transformants that are obtained may exhibit a very high frequency of tolerance to the marker, so that, for example, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the transformants are tolerant to the marker. As used herein, "transformation efficacy" is defined as the percentage of TO events that display the desired phenotype of the polynucleotide of interest (i.e., display tolerance to a herbicide).
In addition, when a construct comprising a chimeric transcriptional regulatory domain comprising at least one copy of the enhancer domain is operably linked to a polynucleotide of interest, the frequency of transformation events in which only a single copy of the construct is inserted into the genome may be as high as at least 35%, 40%, 50%, 60%, 70%, 80%, 90%, or higher. In this manner, the invention also provides improved methods of transformation. It is recognized that multiple copies of the enhancer domain can be used, including 1, 2, 3, 4, 5, 6 or more. In such methods, the transformants may be selected using the appropriate method based on the polynucleotide introduced into the organism.
The invention further provides a kit comprising at least one nucleic acid construct which comprises a chimeric transcriptional regulatory region comprising at least one copy of the enhancer domain of the invention or an active variant or fragment thereof. In some aspects, a construct of the invention will comprise a T- DNA sequence.
The following examples are offered by way of illustration and not by way of limitation.
EXPERIMENTAL Example 1. Methods of Transformation Employing a GAT sequence in Maize /. Preparation of Agrobacterium master plate
1. Obtain engineered Agrobacterium tumefaciens strain with GAT components (SEQ ID NO:7 or 8) and stored in -8O0C degree freezer as a 50% glycerol stock. The transcriptional control region used was the 3X35 S ENH (-) operably linked to the ZmUbi PRO-5UTR-ZmUbi intron 1 promoter (SEQ ID NO:9). This transcriptional control region (SEQ ID NO:9) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer (3X) in the reverse direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
atcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgg gaccactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgtaggagccaccttccttttccac tatcttcacaataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtctcaat tgccctttggtcttctgagactgtatctttgatatttttggagtagacaagcgtgtcgtgctccaccatgttgacgaagattttcttc ttgtcattgagtcgtaagagactctgtatgaactgttcgccagtctttacggcgagttctgttaggtcctctatttgaatctttgact ccatggacggtatcgataagctagcttgatatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacg atgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatg atggcatttgtaggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatggaatccgaggaggtt tccggatattaccctttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttggagtagacaagcgtg tcgtgctccaccatgttgacgaagattttcttcttgtcattgagtcgtaagagactctgtatgaactgttcgccagtctttacggc gagttctgttaggtcctctatttgaatctttgactccatgatcgaattatcacatcaatccacttgctttgaagacgtggttggaac gtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatcttcaacgatggccttt cctttatcgcaatgatggcatttgtaggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatgga atccgaggaggtttccggatattaccctttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttgga gtagacaagcgtgtcgtgctccaccatgttgacgaagattttcttcttgtcattgagtcgtaagagactctgtatgaactgttcg ccagtctttacggcgagttctgttaggtcctctatttgaatctttgactccatgggaattcctgcagcccagcttgcatgcctgca gtgcagcgtgacccggtcgtgcccctctctagagataatgagcattgcatgtctaagttataaaaaattaccacatattttttttg tcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactttactctacgaataatataatctatagtactacaataat atcagtgttttagagaatcatataaatgaacagttagacatggtctaaaggacaattgagtattttgacaacaggactctacagt tttatctttttagtgtgcatgtgttctcciitttttttgcaaatagcttcacctatataatacttcatccattttattagtacatccatttag ggtttagggttaatggtttttatagactaatttttttagtacatctattttattctattttagcctctaaattaagaaaactaaaactctat tttagtttttttatttaataatttagatataaaatagaataaaataaagtgactaaaaattaaacaaataccctttaagaaattaaaaa aactaaggaaacatttttcttgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacggacaccaaccag cgaaccagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctggacccctctcgaga gttccgctccaccgttggacttgctccgctgtcggcatccagaaattgcgtggcggagcggcagacgtgagccggcacgg caggcggcctcctcctcctctcacggcaccggcagctacgggggattcctttcccaccgctccttcgctttcccttcctcgcc cgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgttgttcggagcgcacacacacacaaccagatc tcccccaaatccacccgtcggcacctccgcttcasLggtacgccgctcgtcctcccccccccccctctctaccttctctagat cggcgttccggtccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgct gctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcct gggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttccttt atttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggeg gtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatatt catagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcgggttttactgatgcat atacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtagaat actgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatgga tggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctatt catatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatgg catatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcac cctgttgtttggtgttacttctgca (SEQ ID NO:9)
2. Prepare master plate from a glycerol stock by streaking the bacteria to produce single colonies on #800 medium and incubate the bacteria at 280C in the dark for
3-4 days.
3. Prepare a working plate by streaking 1 colony from the master plate across #810 media. Incubate bacteria at 280C in the dark for 1-2 days.
II. Preparation of bacteria for embryo infection 1. Prepare liquid culture of Agrobacterium 1 day prior to embryo isolation. Set up a flask with 30 mis of 557A medium, 30 μl of 2% acetosyringone and 30 μl of 5% spectinomycin. 2. Inoculate with 1 loopful of Agrobacterium from 810 medium and place on shaker
(200 rpm) in dark room at 280C overnight. 3. On morning of infection, take samples of the liquid culture of Agrobacterium and make a 1A dilution with 557A. Use the diluted liquid culture to take OD reading using visible light at 550 run.
4. Make dilutions to Agrobacterium culture as appropriate according the OD reading to maintain OD reading between 0.2-0.8 during embryo isolation. 5. When preparing Agrobacterium for infection, repeat OD reading of liquid culture. Using the OD reading calculate the number of mis required to obtain 5 ElO cfu/ml (cfu=colony forming unit) by using the formula EXPONENT (1.755 *(lnOD) + 21.77) as derived from a standard curve. Pipet the calculated amount of Agrobacterium liquid culture into 14 ml tube and centrifuge at 4500 rpm at 4 — 20 0C for ten minutes. Remove the supernatant and resuspend Agrobacterium in appropriate amount of 100 uM acetosyringone solution in 56 IQ.
///. Immature embryo isolation
1. Harvest GS 3 ears at 9-11 days after pollination with embryo size of 1-2 mm in length. 2. Sterilize ear in 50% bleach and 1 drop Tween for 20-30 minutes. Rinse 3-5 times in sterile water. 3. Isolate embryos from kernels and place in microtube containing 2 mis 56 IQ.
VI. Agrobacterium infection of embryos
1. Remove 56 IQ with pipette from the microtube with isolated embryos and add 1 ml of Agrobacterium suspension at OD described above. 2. Mix by vortexing for about 30 seconds.
3. Allow 5 minutes for infection at room temperature.
V. Co-cultivation
1. After removing liquid medium, transfer embryos and orient the embryos with embryonic axis down on the surface of 562P co-cultivation medium. 2. Place embryos in 200C incubator for 3 days. Transfer to 280C for 3 additional days.
VI. Selection of transgenic putative callus events
1. After co-cultivation, transfer embryos to 5631 selection medium containing 1 niM glyphosate. Culture the embryos at 280C in dark. 2. Every 14-21 days transfer embryos to fresh 5631 medium. The selection process may last about 2 months until actively growing putative callus events can be identified. Maintain putative callus events on 5631 medium and sample callus for PCR.
VII. Regeneration of TO plants 1. Transfer callus events to 2871 medium containing 0.1 mM Glyphosate until somatic embryos mature. Culture the callus at 280C in dark.
2. Transfer mature embryos to 2731 embryo germination medium containing 0.1 mM glyphosate in plates. Culture the plates at 280C in light.
3. When shoots and roots emerge, transfer individual plants to 2731 containing 0.1 mM Glyphosate in tubes. Culture the tubes at 280C in light.
4. Plantlets with established shoots and roots shall be transferred to greenhouse for further growth and production of Tl seed. Example 2. Effect of 35 S enhancer on Transformation Efficiency and Efficacy of GAT and ALS in Maize Materials and Methods
Four 35S enhancer constructs (PHP20118, PHP20120, PHP20122, PHP20124) and one non-35 S construct (PHP 19288) were used to produce events to evaluate the effect of 35S enhancer on transformation efficiency and efficacy of GAT (SEQ ID NO: 7) (Fig. 1). The differences between the four 35 S enhancer constructs are the copy numbers of the 35S enhancer and the orientations of the 35S enhancer in the constructs. A summary of each 35S enhancer construct is provided below.
PHP20118 comprises 35S ENH(+):ZmUBI PRO-5UTR-UBI INTRONl (+ denotes forward direction of 35S enhancer). This transcriptional control region (SEQ ID NO:11 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35 S enhancer in the forward direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
cccatqqagtcaaaqattcaaataqagqacctaacagaactcgccgtaaagactgqcqaacaqttcatacaqagtctcttacqa ctcaatgacaaqaaqaaaatcttcqtcaacatqqtqqaqcacqacacqcttqtctactccaaaaatatcaaaqatacagtctcaq aagaccaaagggcaattgaqacttttcaacaaagggtaatatccqqaaacctcctcqgattccattqcccagctatctqtcactttat tqtqaagatagtggaaaaggaaqgtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgcc qacaqtqgtcccaaaqatqqacccccacccacgaggagcatcgtqqaaaaaqaaqacqttccaaccacqtcttcaaagcaag tggattgatgtqatatcaagcttatcgataccgtcgacctcgagggggggcccagcttgcatgccigcaqtqcagcqtqacccggtc gtqcccctctctaqaqataatqaqcattqcatqtctaaqttataaaaaattaccacatattttttttqtcacacttqtttqaaqtqcaqtttat ctatctttatacatatatttaaactttactctacqaataatataatctataqtactacaataatatcaqtqttttaqaqaatcatataaatqa acagttagacatggtctaa^gggcaattgagtattttgacaacaggactctacagttttatctttttagtgtgcatgtattctcctttttttttgc aaataqcttcacctatataatacttcatccattttattaqtacatccatttaqqqtttaqqqttaatqqtttttataqactaatttttttaqtacat ctattttattctattttaqcctctaaattaaqaaaactaaaactctattttaqtttttttatttaataatttaqatataaaataqaataaaataaa gtqactaaaaattaaacaaataccctttaaqaaattaaaaaaactaaqcιaaacatttttcttqtttcqa.qtaqataatqccaqcctqtt aaacqccqtcqacqaqtctaacqqacaccaaccaqcqaaccaqcaqcqtcqcc)tcqqqccaaqcc)aaqcaqacqqcacq. qcatctctqtcqctqcctctqqacccctctcqaqaqttccqctccaccqttqqacttqctccgctqtcqqcatccaqaaattqcqtqcjc ggaqcqqcaqacgtqaqccqqcacqqcaqqcqqcctcctcctcctctcacqqcaccqqcaqctacqqqqqattcctttcccacc gctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgttgttcggagcgnan acacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggfacgccgcfcgtoctecccccccccccfcfcf accttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgt gctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcctggga tggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgcc gtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaatt ctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaa atatcgatctaggataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgt ggttgggcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtc atacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatac atgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgat atacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgat gctcaccctgttgtttggtgttacttctgca (SEQ ID NO: 11)
PHP20122 comprises 3X35S ENH (+):ZmUBI PRO-5UTR-UBI INTRONl (+ denotes forward direction of 35S enhancer). This transcriptional control region (SEQ ID NO: 12 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer in the forward direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
cccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctctta cgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaatatcaaagatacag tctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatc tgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttga agatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaacc acgtcttcaaagcaagtggattgatgtgataattcgatcatggagtcaaagattcaaatagaggacctaacagaactcgccgt aaagactggcgaacagttcatacagagtctcttacgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacga cacgcttgtctactccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatat ccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaa tgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccacccac gaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgatatcaagcttatcgatacc gccatggagtcaaagattcaaatagaggacctaacagaactcgccgtaaagactggcgaacagttcatacagagtctctta cgactcaatgacaagaagaaaatcttcgtcaacatggtggagcacgacacgcttgtctactccaaaaatatcaaagatacag tctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatc tgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttga agatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaacc acgtcttcaaagcaagtggattgatgtgatgtctgcagtgcagcgtgacccggtcgtgcccctctctagagataatpapcatt gcatgtctaagttataaaaaattaccacatatittttttgtcacacttgtttgaagtgcagffi^ tactctacpaataatataatctatagtactacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtctaaa ggacaattgagtattttgacaacaggactctacagttttatctttttagtgtgcatgtgttctcctiiiiilttgcaaatagcttcacct atataatacttcatccattttattagtacatccatttagggtttaggRttaatggtttttatagactaatttttttagtacatctattttatt ctattttagcctctaaattaagaaaactaaaactctattttagtttttttatttaataatttagatataaaatagaataaaataaagtga ctaaaaattaaacaaataccctttaagaaattaaaaaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgtta aacgccgtcgacgagtctaacggacaccaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacggca cggcatctctgtcgctgcctctggacccctctcgagagttccgctccaccgttggacttgctccgctgtcggcatccagaaat tgcgtggcggagcggcagacgtgagccggcacggcaggcggcctcctcctcctctcacggcaccggcagctacgggg gattcctttcccaccgctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccacaccctctttccccaacc tcgtgttgttcggagcgcacacacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtøcgccg ctcgtcctcccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgttc atgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgttct gattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgatttt ttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgctttt ttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaattctgtttcaaactacctggtggattt attaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctaggat aggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgg gcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgt gtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggttttact gatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtatgt tttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacgct atttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgca (SEQ ID NO: 12)
PHP20120 comprises 35S ENH (-):ZmUBI PRO-5UTR-UBI INTRONl (- denotes reverse direction of 35S enhancer). This transcriptional control region (SEQ ID NO: 13 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer in the reverse direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
atcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgg gaccactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgtaggagccaccttccttttccac tatcttcacaataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtctcaat tgccctttggtcttctgagactgtatctttgatatttttggagtagacaagcgtgtcgtgctccaccatgttgacgaagattttcttc ttgtcattgagtcgtaagagactctgtatgaactgttcgccagtctttacggcgagttctgttaggtcctctatttgaatctttgact ccatgggaattcctgcagcccagcttgcatgcctgcagtgcagcgtgacccggtcgtgcccctctctagagataatgagca ttgcatgtctaagttataaaaaattaccacatatfflttttgtcacacttgtttgaagtgcagtttatctatctttatacatatatttaaac tttactctacgaataatataatctatagtactacaataatatcagtgttttagagaatcatataaatgaacagttagacatggtcta aaggacaattgagtattttgacaacaggactctacagttttatcttWagtgtgcatgtgttctcctttttttttgcaaatagcttcac ctatataatacttcatccattttattagtacatccatttagggtttagggttaatggtttttatagactaatttitttagtacatctatttta ttctattttagcctctaaattaagaaaactaaaactctattttagtttttttatttaataatttagatataaaatagaataaaataaagtg actaaaaattaaacaaataccctttaagaaattaaaaaaactaaggaaacatttttcttgtttcgagtagataatgccagcctgtt aaacgccgtcgacgagtctaacggacaccaaccagcgaaccagcagcgtcgcgtcgggccaagcgaagcagacggc acggcatctctgtcgctgcctctggacccctctcgagagttccgctccaccgttggacttgctccgctgtcggcatccagaa attgcgtggcggagcggcagacgtgagccggcacggcaggcggcctcctcctcctctcacggcaccggcagctacggg ggattcctttcccaccgctccttcgctttcccttcctcgcccgccgtaataaatagacaccccctccacaccctctttccccaac ctcgtgttgttcggagcgcacacacacacaaccagatctcccccaaatccacccgtcggcacctccgcttcaaggtocgcc gctcgtcctcccccccccccctctctaccttctctagatcggcgttccggtccatggttagggcccggtagttctacttctgtt catgtttgtgttagatccgtgtttgtgttagatccgtgctgctagcgttcgtacacggatgcgacctgtacgtcagacacgtt ctgattgctaacttgccagtgtttctctttggggaatcctgggatggctctagccgttccgcagacgggatcgatttcatgat tttttttgtttcgttgcatagggtttggtttgcccttttcctttatttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgct tttttttgtcttggttgtgatgatgtggtctggttgggcggtcgttctagatcggagtagaattctgtttcaaactacctggtgga tttattaattttggatctgtatgtgtgtgccatacatattcatagttacgaattgaagatgatggatggaaatatcgatctagg ataggtatacatgttgatgcgggttttactgatgcatatacagagatgctttttgttcgcttggttgtgatgatgtggtgtggtt gggcggtcgttcattcgttctagatcggagtagaatactgtttcaaactacctggtgtatttattaattttggaactgtatgtgt gtgtcatacatcttcatagttacgagtttaagatggatggaaatatcgatctaggataggtatacatgttgatgtgggtttta ctgatgcatatacatgatggcatatgcagcatctattcatatgctctaaccttgagtacctatctattataataaacaagtat gttttataattattttgatcttgatatacttggatgatggcatatgcagcagctatatgtggatttttttagccctgccttcatacg ctatttatttgcttggtactgtttcttttgtcgatgctcaccctgttgtttggtgttacttctgca (SEQ ID NO: 13)
PHP20124 comprises 3X35S ENH (-): ZmUBI PRO-5UTR-UBI INTRONl (- denotes reverse direction of 35S enhancer). This transcriptional control region (SEQ ID NO: 14 ) is set forth below denoting the location of the various regions of the regulatory region: a) the 35S enhancer in the reverse direction has a single underline; b) the UBI promoter has a double underline, and c) the UBI intron is in italics.
atcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacgatgctcctcgtgggtgggggtccatctttgg gaccactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatgatggcatttgtaggagccaccttccttttccac tatcttcacaataaagtgacagatagctgggcaatggaatccgaggaggtttccggatattaccctttgttgaaaagtctcaat tgccctttggtcttctgagactgtatctttgatatttttggagtagacaagcgtgtcgtgctccaccatgttgacgaagattttcttc ttgtcattgagtcgtaagagactctgtatgaactgttcgccagtctttacggcgagttctgttaggtcctctatttgaatctttgact ccatggacggtatcgataagctagcttgatatcacatcaatccacttgctttgaagacgtggttggaacgtcttctttttccacg atgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatcttcaacgatggcctttcctttatcgcaatg atggcatttgtaggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatggaatccgaggaggtt tccggatattacccfflgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttggagtagacaagcgtg tcgtgctccaccatgttgacgaagattttcttcttgtcattgagtcgtaagagactctgtatgaactgttcgccagtctttacggc gagttctgttaggtcctctatttgaatctttgactccatgatcgaattatcacatcaatccacttgctttgaagacgtggttggaac gtcttctttttccacgatgctcctcgtgggtgggggtccatctttgggaccactgtcggcagaggcatcttcaacgatggccttt cctttatcgcaatgatggcatttgtaggagccaccttccttttccactatcttcacaataaagtgacagatagctgggcaatgga atccgaggaggfflccggatattaccctttgttgaaaagtctcaattgccctttggtcttctgagactgtatctttgatatttttgga gtagacaagcgtgtcgtgctccaccatgttgacgaagattttcttcttgtcattgagtcgtaagagactctgtatgaactgttcg ccagtctttacggcgagttctgttaggtcctctatttgaatctttgactccatgggaattcctgcagcccagcttgcatgcctgca gtgcagcgtgacccggtcgtgcccctctctagagataatgagcattgcatgtctaagttataaaaaattaccacatattttttttg tcacacttgtttgaagtgcagtttatctatctttatacatatatttaaactttactctacgaataatataatctatagtactacaataat atcagtgttttagagaatcatataaatgaacagttagacatggtctaaaggacaattgagtattttgacaacaggactctacagt tttatctttttagtgtgcatgtgttctcclUlULUgcaaatagcttcacctatataatacttcatccattttattagtacatccatttag ggtttagggttaatggtttttatagactaatttttttagtacatctattttattctattttagcctctaaattaagaaaactaaaactcM tttagtttttttatttaataatttagatataaaatagaataaaataaagtgactaaaaattaaacaaataccctttaagaaattaaaaa aactaaggaaacatttttcttgtttcgagtagataatgccagcctgttaaacgccgtcgacgagtctaacggacaccaaccag cgaaccagcagcgtcgcgtcgggccaagcgaagcagacggcacggcatctctgtcgctgcctctggacccctctcgaga gttccgctccaccgttggacttgctccgctgtcggcatccagaaattgcgtggcggagcggcagacgtgagccggcacgg caggcggcctcctcctcctctcacggcaccggcagctacgggggattcctttcccaccgctccttcgctttcccttcctcgcc cgccgtaataaatagacaccccctccacaccctctttccccaacctcgtgttgttcggagcgcacacacacacaaccagatc tcccccaaatccacccgtcggcacctccgcttca&ggtacgccgctcgtcctcccccccccccctctctaccttctctagat cggcgttccggtccatggttagggcccggtagttctacttctgttcatgtttgtgttagatccgtgtttgtgttagatccgtgct gctagcgttcgtacacggatgcgacctgtacgtcagacacgttctgattgctaacttgccagtgtttctctttggggaatcct gggatggctctagccgttccgcagacgggatcgatttcatgattttttttgtttcgttgcatagggtttggtttgcccttttccttt atttcaatatatgccgtgcacttgtttgtcgggtcatcttttcatgcttttttttgtcttggttgtgatgatgtggtctggttgggcg gtcgttctagatcggagtagaattctgtttcaaactacctggtggatttattaattttggatctgtatgtgtgtgccatacatatt catagttacgaattgaagatgatggatggaaatatcgatctaggataggtatacatgttgatgcgggttttactgatgcat atacagagatgctttttgttcgcttggttgtgatgatgtggtgtggttgggcggtcgttcattcgttctagatcggagtagaat actgtttcaaactacctggtgtatttattaattttggaactgtatgtgtgtgtcatacatcttcatagttacgagtttaagatgga tggaaatatcgatctaggataggtatacatgttgatgtgggttttactgatgcatatacatgatggcatatgcagcatctatt catatgctctaaccttgagtacctatctattataataaacaagtatgttttataattattttgatcttgatatacttggatgatgg catatgcagcagctatatgtggatttttttagccctgccttcatacgctatttatttgcttggtactgtttcttttgtcgatgctcac cctgttgtttggtgttacttctgca (SEQ ID NO: 14)
The transformation experiments were conducted side-by-side using the same embryos from the same ears. Immature embryos of GS3 line were aseptically removed from each ear and divided into five portions. Each portion of the embryos was then infected with A. tumefaciens strain LB A4404 containing the expression cassettes from each of the five constructs, respectively. After 6 days co-cultivation, the embryos were transferred to fresh selection medium containing glyphosate. The transformed cells, which survived the glyphosate selection, proliferated and produced somatic embryogenic calli. After about two months subculture, the calli were then manipulated to regenerate whole transgenic plants with glyphosate presence and were transferred to the greenhouse. TO plants were then subjected to glyphosate spray at 6X (156 oz/ac) Roundup Ready UltraMaxTM at V3 or V4 stage in the greenhouse. Positive plants were sampled for quantitative PCR for copy number and western for expression. TO plants were then crossed with inbred lines to obtain seeds for further evaluation.
Results
Transformation efficiency was measured as the percentage of the infected embryos that produced resistant calli after selection. The average transformation efficiencies for PHP19288, PHP20118, PHP20120, PHP20122, and PHP20124 were 58%, 63%, 59%, 57%, and 51%, respectively. The data indicated that all constructs had quite high and similar transformation efficiencies, although PHP20118 showed a slight increase (Fig 2).
TO plant efficacy was defined as the percentage of the TO events that were completely resistant to the 6x glyphosate spray. The efficacy of the non-35 S construct (PHP19288) was 48.1%. In contrast, the efficacies of the 35S enhancer constructs (PHP20118, PHP20120, PHP20122, and PHP20124) were 96.6%, 93.5%, 89.1%, and 91.1%, respectively (Fig. 3). The data showed that all 35S enhancer constructs significantly increased the plant efficacy against glyphosate.
Another significant improvement of using 35S enhancer was in integration pattern of the transgene. The percentage of the tested events that were single copy for the non-35 S enhancer construct was only 38%, but for the four 35S enhancer constructs (PHP20118, PHP20120, PHP20122, and PHP20124) single copy events represented 65%, 63%, 71%, and 88% of the events, respectively (Fig. 4).
A subset of events from all five constructs were sampled by Western analysis to look any comparative differences in GAT expression between non 35S and 35S events. This analysis showed that events from the non-35 S enhancer construct had very low levels of GAT expression whereas the majority of the events from the 35S enhancer constructs showed very high levels of GAT expression (Fig. 5).
Example 3. Using 35S Enhancer GAT in Developing A Novel Callus-Based Gene/Construct Evaluation System. Materials and Methods
This assay is being developed to improve the evaluation of expression of an insecticidal gene at a very early stage in the transformation process in order to identify potential problems with expression. The basis of this assay is the use of the glyphosate acetyl transferase (GAT) gene (SEQ ID NO: 8) as a selectable marker. Both GAT and the insecticidal test gene will be driven by a strong constitutive promoter and linked in the same construct. The promoter employed comprised the ZmUBI PRO-5UTR-UBI INTRONl with the 3X35S enhancer as described above in Example 1. As a result it is expected that selection on high levels of glyphosate will identify high insecticidal test gene expressors. The callus tissue from these putative high expressors will then be used in insect bioassays to determine whether the gene product is functional. Those constructs showing efficacy can be advanced into transformation. If the construct does not show efficacy then follow up biochemical and molecular analyses can be conducted to identify the problem and the gene will be redesigned and retested in the system (Fig. 6).
Results
Preliminary data has shown that the activity of an efficacious insect control gene can be detected at the callus stage. The correlation between the callus activity and the plant efficacy is currently being evaluated.
Example 4. GAT as a Selectable Marker Materials and Method
Agrobacterium mediated transformation was used to introduce the GAT (SEQ ID NO: 8) expression cassette into the corn genome. The GAT expression cassette comprises the promoter comprising ZmUBI PRO-5UTR-UBI INTRONl with the 3X35 S enhancer (as described above in Example 1) operably linked to the gat gene, and pinll terminator. Agrobacterium tumefaciens, strain LBA4404, was pathogenically disarmed by removing its native T-DNA. Instead, the T-DNA site on the Ti plasmid contained the GAT expression cassette. Immature embryos of maize were aseptically removed from the developing caryopsis and treated with A. tumefaciens strain LBA4404 containing GAT expression cassettes. After a period of embryo and Agrobacterium co-cultivation on solid culture medium without glyphosate presence, the embryos were transferred to fresh selection medium that contained antibiotics and glyphosate. The antibiotics kill any remaining Agrobacterium. The selection medium is stimulatory to maize somatic embryogenesis and selective for those cells that contain an integrated gat gene. Therefore, callus that survives glyphosate to proliferate and produce embryogenic tissue is presumably genetically transformed. Callus samples were taken for molecular analysis to verify the presence of the transgene by PCR. The embryonic tissue is then manipulated to regenerate transgenic plants in the presence of glyphosate that are then transferred to the greenhouse. TO plants are sprayed with glyphosate at different concentrations. Positive plants are sampled for molecular analysis for transgene copy number and crossed with inbred lines to obtain seeds from the initially transformed plants.
A glyphosate kill curve was established by testing non-transformed embryos response on media with different levels of glyphosate. GS3 embryos were isolated from an immature ear and placed onto media containing glyphosate at 0.0, 0.5, 1.0, and 2.0 mM. After about 40 days culture, the response of the embryos were observed and recorded. Similarly, infected GS 3 embryos with the GAT construct were placed onto media containing glyphosate at 0.0, 0.5, 1.0, and 2.0 mM. After about 40 days culture, the response of the infected embryos were observed and recorded (Fig. 7). A side-by-side experiment was conducted to compare the transformation efficiencies of GAT, bar and mopat. Immature embryos of GS3 line were aseptically removed from each ear and divided into three portions. Each portion of the embryos was then infected with A. tumefaciens strain LB A4404 containing the expression cassettes of GAT, bar, or mopat respectively. After co-cultivation, the embryos infected with GAT construct were selected on routine glyphosate medium and the embryos infected with bar or mopat constructs were selected on routine glufosinate medium. The subcultures were done every 2 weeks. At about 50 days selection the responses of the embryos were observed and recorded.
Results
From the glyphosate kill curve experiment, all embryos on medium with 0.0 mM glyphosate initiated healthy callus, while about half of the embryos on medium with 0.5 mM glyphosate showed callus initiation. There was very little callus growth with embryos on media containing 1.0 and 2.0 mm glyphosate. This indicated that 0.5 mM is not enough to inhibit all embryos growth, but 1 mM or 2 mM is strong enough to kill the non-transformed embryos. In the infected embryo experiment, more callus was grown on media with 0.0 and 0.5 mM glyphosate, but some embryos initiated resistant callus on media with 1.0 mM or 2.0 mM glyphosate. Western or PCR analysis has confirmed that these resistant calli were transformed. Currently, GAT has performed consistently as an effective selectable marker with excellent transformation efficiency in both GS3 and introEF09B genotypes (Fig. 9 and Table
1). Table 1 GAT transformation efficiency in introEF09B txn % based selectable # infected # events to genotype construct on # events to marker embryos GH
GH
EFWWBTX GATHRA GAT 1332 354 27%
EFWWCTX GATHRA GAT 136 47 35%
EFWWETX GATHRA GAT 1109 158 14%
EFWWZTX GATHRA GAT 1790 502 28%
4367 1061 24%
In the side-by-side experiment to compare GAT, bar and mopat, GAT gave the best transformation efficiency at about 64%, bar at 34%, and mopat at 30%. Calli with GAT selection seem to grow faster that those selected on glufosinate (Fig. 9).
Example 5: Transformation and Regeneration of Transgenic Plants
Immature maize embryos from greenhouse donor plants are bombarded with a plasmid containing a chimeric transcriptional regulatory region comprising the enhancer domain of SEQ ID NO:1 operably linked to ZmUBI PRO-5UTR-ZmUBI INTRONl (SEQ ID NO: 6). The chimeric transcriptional regulatory region is operably linked to a polynucleotide of interest and the selectable marker gene PAT (Wohlleben et al. (1988) Gene 70:25-37), which confers resistance to the herbicide Bialaphos. Alternatively, the selectable marker gene is provided on a separate plasmid. Transformation is performed as follows. Media recipes follow below.
Preparation of Target Tissue
The ears are husked and surface sterilized in 30% Clorox bleach plus 0.5% Micro detergent for 20 minutes, and rinsed two times with sterile water. The immature embryos are excised and placed embryo axis side down (scutellum side up), 25 embryos per plate, on 560Y medium for 4 hours and then aligned within the 2.5cm target zone in preparation for bombardment.
A plasmid vector comprising the construct described above is made. This plasmid DNA plus plasmid DNA containing a PAT selectable marker is precipitated onto 1.1 μm (average diameter) tungsten pellets using a CaCl2 precipitation procedure as follows: 100 μl prepared tungsten particles in water; 10 μl (1 μg) DNA in Tris EDTA buffer (1 μg total DNA); 100 μl 2.5 M CaCl2; and 10 μl 0.1 M spermidine.
Each reagent is added sequentially to the tungsten particle suspension, while maintained on the multitube vortexer. The final mixture is sonicated briefly and allowed to incubate under constant vortexing for 10 minutes. After the precipitation period, the tubes are centrifuged briefly, liquid removed, washed with 500 ml 100% ethanol, and centrifuged for 30 seconds. Again the liquid is removed, and 105 μl 100% ethanol is added to the final tungsten particle pellet. For particle gun bombardment, the tungsten/DNA particles are briefly sonicated and 10 μl spotted onto the center of each macrocarrier and allowed to dry about 2 minutes before bombardment.
The sample plates are bombarded at level #4 in a particle gun. All samples receive a single shot at 650 PSI, with a total often aliquots taken from each tube of prepared particles/DNA.
Following bombardment, the embryos are kept on 560Y medium for 2 days, then transferred to 560R selection medium containing 3 mg/liter Bialaphos, and subcultured every 2 weeks. After approximately 10 weeks of selection, selection- resistant callus clones are transferred to 288J medium to initiate plant regeneration. Following somatic embryo maturation (2-4 weeks), well-developed somatic embryos are transferred to medium for germination and transferred to the lighted culture room. Approximately 7-10 days later, developing plantlets are transferred to 272V hormone- free medium in tubes for 7-10 days until plantlets are well established. Plants are then transferred to inserts in flats (equivalent to 2.5" pot) containing potting soil and grown for 1 week in a growth chamber, subsequently grown an additional 1-2 weeks in the greenhouse, then transferred to classic 600 pots (1.6 gallon) and grown to maturity. Plants are monitored and scored for the desired phenotype based on the polynucleotide of interest.
Bombardment medium (560Y) comprises 4.0 g/1 N6 basal salts (SIGMA C- 1416), 1.0 ml/1 Eriksson's Vitamin Mix (100OX SIGMA-1511), 0.5 mg/1 thiamine HCl, 120.0 g/1 sucrose, 1.0 mg/1 2,4-D, and 2.88 g/1 L-proline (brought to volume with D-I H2O following adjustment to pH 5.8 with KOH); 2.0 g/1 Gelrite (added after bringing to volume with D-I H2O); and 8.5 mg/1 silver nitrate (added after sterilizing the medium and cooling to room temperature). Selection medium (560R) comprises 4.0 g/1 N6 basal salts (SIGMA C-1416), 1.0 ml/1 Eriksson's Vitamin Mix (100OX SIGMA-1511), 0.5 mg/1 thiamine HCl, 30.0 g/1 sucrose, and 2.0 mg/1 2,4-D (brought to volume with D-I H2O following adjustment to pH 5.8 with KOH); 3.0 g/1 Gelrite (added after bringing to volume with D-I H2O); and 0.85 mg/1 silver nitrate and 3.0 mg/1 bialaphos (both added after sterilizing the medium and cooling to room temperature).
Plant regeneration medium (288J) comprises 4.3 g/1 MS salts (GIBCO 11117- 074), 5.0 ml/1 MS vitamins stock solution (0.100 g nicotinic acid, 0.02 g/1 thiamine HCL, 0.10 g/1 pyridoxine HCL, and 0.40 g/1 glycine brought to volume with polished D-I H2O) (Murashige and Skoog (1962) Physiol. Plant. 15:473), 100 mg/1 myoinositol, 0.5 mg/1 zeatin, 60 g/1 sucrose, and 1.0 ml/1 of 0.1 mM abscisic acid (brought to volume with polished D-I H2O after adjusting to pH 5.6); 3.0 g/1 Gelrite (added after bringing to volume with D-I H2O); and 1.0 mg/1 indoleacetic acid and 3.0 mg/1 bialaphos (added after sterilizing the medium and cooling to 6O0C). Hormone-free medium (272V) comprises 4.3 g/1 MS salts (GIBCO 11117-074), 5.0 ml/1 MS vitamins stock solution (0.100 g/1 nicotinic acid, 0.02 g/1 thiamine HCL, 0.10 g/1 pyridoxine HCL, and 0.40 g/1 glycine brought to volume with polished D-I H2O), 0.1 g/1 myo-inositol, and 40.0 g/1 sucrose (brought to volume with polished D-I H2O after adjusting pH to 5.6); and 6 g/1 bacto-agar (added after bringing to volume with polished D-I H2O), sterilized and cooled to 6O0C.
Example 6. Soybean Embryo Transformation Culture Conditions
Soybean embryogenic suspension cultures (cv. Jack) are maintained in 35 ml liquid medium SB 196 (see recipes below) on rotary shaker, 150 rpm, 26°C with cool white fluorescent lights on 16:8 hr day/night photoperiod at light intensity of 60-85 μE/m2/s. Cultures are subcultured every 7 days to two weeks by inoculating approximately 35 mg of tissue into 35 ml of fresh liquid SB 196 (the preferred subculture interval is every 7 days). Soybean embryogenic suspension cultures are transformed with the plasmids and DNA fragments described in the following examples by the method of particle gun bombardment (Klein et al. (1987) Nature, 327:70).
Soybean Embryogenic Suspension Culture Initiation
Soybean cultures are initiated twice each month with 5-7 days between each initiation.
Pods with immature seeds from available soybean plants 45-55 days after planting are picked, removed from their shells and placed into a sterilized magenta box. The soybean seeds are sterilized by shaking them for 15 minutes in a 5% Clorox solution with 1 drop of ivory soap (95 ml of autoclaved distilled water plus 5 ml Clorox and 1 drop of soap). Mix well. Seeds are rinsed using 2 1 -liter bottles of sterile distilled water and those less than 4 mm are placed on individual microscope slides. The small end of the seed are cut and the cotyledons pressed out of the seed coat. Cotyledons are transferred to plates containing SBl medium (25-30 cotyledons per plate). Plates are wrapped with fiber tape and stored for 8 weeks. After this time secondary embryos are cut and placed into SB 196 liquid media for 7 days.
Preparation of DNA for Bombardment Either an intact plasmid or a DNA plasmid fragment containing the genes of interest and the selectable marker gene are used for bombardment. Plasmid DNA for bombardment are routinely prepared and purified using the method described in the Promega™ Protocols and Applications Guide, Second Edition (page 106). Fragments of the plasmids carrying the chimeric transcriptional regulatory region comprising the enhancer domain of SEQ ID NO: 1 operably linked to ZmUBI PRO-5UTR-ZmUBI INTRONl (SEQ ID NO: 6) which is operably linked to a polynucleotide of interest are obtained by gel isolation of double digested plasmids. In each case, 100 μg of plasmid DNA is digested in 0.5 ml of the specific enzyme mix that is appropriate for the plasmid of interest. The resulting DNA fragments are separated by gel electrophoresis on 1% SeaPlaque GTG agarose (BioWhitaker Molecular
Applications) and the DNA fragments containing construct described above are cut from the agarose gel. DNA is purified from the agarose using the GELase digesting enzyme following the manufacturer's protocol.
A 50 μl aliquot of sterile distilled water containing 3 mg of gold particles (3 mg gold) is added to 5 μl of a 1 μg/μl DNA solution (either intact plasmid or DNA fragment prepared as described above), 50 μl 2.5M CaCl2 and 20 μl of 0.1 M spermidine. The mixture is shaken 3 min on level 3 of a vortex shaker and spun for 10 sec in a bench microfuge. After a wash with 400 μl 100% ethanol the pellet is suspended by sonication in 40 μl of 100% ethanol. Five μl of DNA suspension is dispensed to each flying disk of the Biolistic PDS1000/HE instrument disk. Each 5 μl aliquot contains approximately 0.375 mg gold per bombardment (i.e. per disk).
Tissue Preparation and Bombardment with DNA
Approximately 150-200 mg of 7 day old embryonic suspension cultures are placed in an empty, sterile 60 x 15 mm petri dish and the dish covered with plastic mesh. Tissue is bombarded 1 or 2 shots per plate with membrane rupture pressure set at 1100 PSI and the chamber evacuated to a vacuum of 27-28 inches of mercury. Tissue is placed approximately 3.5 inches from the retaining / stopping screen.
Selection of Transformed Embryos Transformed embryos were selected either using hygromycin (when the hygromycin phosphotransferase, HPT, gene was used as the selectable marker) or chlorsulfuron (when the acetolactate synthase, ALS, gene was used as the selectable marker).
Hygromycin (HPT) Selection
Following bombardment, the tissue is placed into fresh SB 196 media and cultured as described above. Six days post-bombardment, the SB 196 is exchanged with fresh SB 196 containing a selection agent of 30 mg/L hygromycin. The selection media is refreshed weekly. Four to six weeks post selection, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters.
Isolated, green tissue is removed and inoculated into multiwell plates to generate new, clonally propagated, transformed embryogenic suspension cultures. Chlorsulfuron (ALS) Selection
Following bombardment, the tissue is divided between 2 flasks with fresh SB 196 media and cultured as described above. Six to seven days post-bombardment, the SB 196 is exchanged with fresh SB 196 containing selection agent of 100 ng/ml Chlorsulfuron. The selection media is refreshed weekly. Four to six weeks post selection, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated, green tissue is removed and inoculated into multiwell plates containing SB 196 to generate new, clonally propagated, transformed embryogenic suspension cultures.
Regeneration of Soybean Somatic Embryos into Plants
In order to obtain whole plants from embryogenic suspension cultures, the tissue must be regenerated.
Embryo Maturation
Embryos are cultured for 4-6 weeks at 26°C in SB 196 under cool white fluorescent (Phillips cool white Econowatt F40/CW/RS/EW) and Agro (Phillips F40 Agro) bulbs (40 watt) on a 16:8 hr photoperiod with light intensity of 90-120 uE/m2s. After this time embryo clusters are removed to a solid agar media, SB 166, for 1-2 weeks. Clusters are then subcultured to medium SB 103 for 3 weeks. During this period, individual embryos can be removed from the clusters and screened for the desired phenotype based on the polynucleotide of interest employed. It should be noted that any detectable phenotype, resulting from the expression of the genes of interest, could be screened at this stage.
Embryo Desiccation and Germination
Matured individual embryos are desiccated by placing them into an empty, small petri dish (35 x 10 mm) for approximately 4-7 days. The plates are sealed with fiber tape (creating a small humidity chamber). Desiccated embryos are planted into SB71-4 medium where they were left to germinate under the same culture conditions described above. Germinated plantlets are removed from germination medium and rinsed thoroughly with water and then planted in Redi-Earth in 24-cell pack tray, covered with clear plastic dome. After 2 weeks the dome is removed and plants hardened off for a further week. If plantlets looked hardy they are transplanted to 10" pot of Redi-Earth with up to 3 plantlets per pot. After 10 to 16 weeks, mature seeds are harvested, chipped and analyzed for proteins.
Media Recipes
SB 196 - FN Lite liquid proliferation medium (per liter) -
MS FeEDTA - 10Ox Stock 1 10 ml
MS Sulfate - 10Ox Stock 2 10 ml FN Lite Halides - 10Ox Stock 3 10 ml
FN Lite P5B5Mo - 100x Stock 4 10 ml
B5 vitamins (lml/L) 1.0 ml
2,4-D (10mg/L final concentration) 1.0 ml
KNO3 2.83 gm (NH4 )2 SO 4 0.463 gm
Asparagine 1.0 gm
Sucrose (1%) 10 gm pH 5.8
FN Lite Stock Solutions
Stock # 1000ml 500ml
1 MS Fe EDTA 100x Stock
Na2 EDTA* 3.724 g 1.862 g
FeSO4 - 7H2O 2.784 g 1.392 g Add first, dissolve in dark bottle while stirring
2 MS Sulfate 10Ox stock
MgSO4 - 7H2O 37.O g 18.5 g
MnSO4 - H2O 1.69 g 0.845 g
ZnSO4 - 7H2O 0.86 g 0.43 g CuSO4 - 5H2O 0.0025 g 0.00125 g 3 FN Lite Halides 10Ox Stock
CaCl2 - 2H2O 30.O g 15.O g
KI 0.083 g 0.0715 g
CoCl2 - 6H2O 0.0025 g 0.00125 g
4 FN Lite P5B5Mo 10Ox Stock
KH2PO4 18.5 g 9.25 g
H3BO3 0.62 g 0.31 g
Na2MoO4 - 2H2O 0.025 g 0.0125 g
SBl solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/ BRL - Cat#
11117-066); 1 ml B5 vitamins IOOOX stock; 31.5 g sucrose; 2 ml 2,4-D (20mg/L final concentration); pH 5.7; and, 8 g TC agar.
SB 166 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/ BRL - Cat# 11117-066); 1 ml B5 vitamins IOOOX stock; 60 g maltose; 750 mg MgC12 hexahydrate; 5 g activated charcoal; pH 5.7; and, 2 g gelrite.
SB 103 solid medium (per liter) comprises: 1 pkg. MS salts (Gibco/BRL - Cat# 11117-066); 1 ml B5 vitamins IOOOX stock; 60 g maltose; 750 mg MgC12 hexahydrate; pH 5.7; and, 2 g gelrite.
SB 71-4 solid medium (per liter) comprises: 1 bottle Gamborg's B5 salts w/ sucrose (Gibco/BRL - Cat# 21153-036); pH 5.7; and, 5 g TC agar.
2,4-D stock is obtained premade from Phytotech cat# D 295 - concentration is 1 mg/ml.
B5 Vitamins Stock (per 100 ml) which is stored in aliquots at -20C comprises: 1O g myo-inositol; 100 mg nicotinic acid; 100 mg pyridoxine HCl; and, 1 g thiamine. If the solution does not dissolve quickly enough, apply a low level of heat via the hot stir plate. Chlorsulfuron Stock comprises lmg / ml in 0.01 N Ammonium Hydroxide
The article "a" and "an" are used herein to refer to one or more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one or more element.
AU publications and patent applications mentioned in the specification are indicative of the level of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.

Claims

THAT WHICH IS CLAIMED:
1. A method of expressing a polynucleotide of interest comprising introducing into a cell at least one DNA construct comprising a chimeric transcriptional regulatory region comprising at least one enhancer domain operably linked to a heterologous promoter, said chimeric transcriptional regulatory region operably linked to the polynucleotide of interest, wherein said enhancer domain is selected from the group consisting of:
(a) the nucleotide sequence comprising SEQ ID NO: 1, 17; (b) the nucleotide sequence comprising at least 95% sequence identity to SEQ ID NO:1 or 17, wherein said polynucleotide has transcriptional regulatory activity; and,
(c) the nucleotide sequence comprising at least 100 consecutive nucleotides of SEQ ID NO:1 or 17.
2. The method of claim 1 , wherein said enhancer domain does not comprise the sequence set forth in SEQ ID NO:5.
3. The method of claim 1 or 2, wherein said chimeric transcriptional regulatory region comprises at least two copies or at least three copies of said enhancer.
4. The method of claim 3, wherein a) said copies of said enhancer are immediately adjacent to one another; or, b) at least one of said enhancers is in orientated in the forward or reverse orientation with respect to said promoter.
5. The method of claim 1, 2, 3, or 4, wherein said polynucleotide of interest encodes a polypeptide.
6. The method of claim 1 , 2, 3, 4, or 5, wherein said polynucleotide of interest comprises a selectable marker.
7. The method of claim 6, wherein said selectable marker comprises a polynucleotide that confers tolerance to a herbicide.
8. The method of any one of claims 1-7, wherein said cell is a plant cell.
9. The method of claim 7, wherein said method further comprise culturing said cell in a media comprising an effective concentration of the herbicide.
10. The method of claim 8, wherein said plant cell is from a dicot.
11. The method of claim 10, wherein said dicot is soybean, wheat, canola, sunflower, cotton, or alfalfa.
12. The method of claim 8, wherein said plant cell is from a monocot.
13. The method of claim 12, wherein said monocot is maize, wheat, rice, barley, sorghum, or rye.
14. A method to select a cell having a polynucleotide of interest comprising a) providing a population of cells; b) introducing into at least one cell from said population a DNA construct comprising the polynucleotide of interest and further comprising a chimeric transcriptional regulatory region comprising at least one enhancer domain operably linked to a first heterologous promoter, said chimeric transcriptional regulatory region operably linked to a selectable marker, wherein said enhancer domain is selected from the group consisting of: i) the nucleotide sequence comprising SEQ ID NO:1 or 17; ii) the nucleotide sequence comprising at least 95% sequence identity to SEQ ID NO:1 or 17, wherein said polynucleotide has regulating transcriptional activity; and, iii) the nucleotide sequence comprising at least 100 consecutive nucleotides of SEQ ID NO:1 or 17; c) contacting said population of cells with an effective concentration of an appropriate selection agent; and, d) selecting the plant expressing said selectable marker, and thereby identifying plants having the polynucleotide of interest.
15. The method of claim 14, wherein said enhancer domain does not comprise the sequence set forth in SEQ ID NO:5.
16. The method of claim 14 or 15, wherein said chimeric transcriptional regulatory region comprises at least two copies or at least three copies of said enhancer.
17. The method of claim 16, wherein a) the copies of said enhancer are immediately adjacent to one another; or, b) at least one of said enhancers is in orientated in the forward or reverse orientation with respect to said promoter.
18. The method of claim 14, 15, 16, or 17, wherein said selectable marker encodes a polypeptide that confers tolerance to a herbicide.
19. The method of claim 18, wherein said selective agent comprises a herbicide.
20. The method of anyone of claims 14-19, wherein said cell comprises a plant cell.
21. The method of claim 20, wherein said plant cell is from a dicot.
22. The method of claim 21, wherein said dicot is soybean, wheat, canola, sunflower, cotton, or alfalfa.
23. The method of claim 20, wherein said plant cell is from a monocot.
24. The method of claim 23, wherein said monocot is maize, wheat, rice, barley, sorghum, or rye.
25. The method of claim 14, wherein said DNA construct comprises in the 5' to 3' or 3' to 5' orientation: the first polynucleotide of interest operably linked to a second heterologous promoter, operably linked to at least one of said enhancer domains, operably linked to the first heterologous promoter, operably linked to the selectable marker, wherein said first polynucleotide of interest and said selectable marker are expressed in divergent directions.
26. A polynucleotide comprising a chimeric transcriptional regulatory element comprising a promoter that drives expression in a cell operably linked to at least one copy of a heterologous enhancer domain wherein said enhancer domain is selected from the group consisting of:
(a) the nucleotide sequence comprising SEQ ID NO: 1 or 10;
(b) the nucleotide sequence comprising at least 95% sequence identity to SEQ ID NO:1 or 17, wherein said polynucleotide has regulating transcriptional activity; and,
(c) the nucleotide sequence comprising at least 100 consecutive nucleotides of SEQ ID NO:1 or 17.
27. The polynucleotide of claim 26, wherein said enhancer domain does not comprise the sequence of SEQ ID NO : 5.
28. The polynucleotide of claim 26 or 27, wherein said chimeric transcriptional regulatory region comprises at least two copies or at least three copies of said enhancer.
29. The polynucleotide of claim 27, wherein a) the copies of said enhancer are immediately adjacent to one another; b) at least one of said enhancers is in orientated in the forward or reverse orientation with respect to said promoter.
30. An expression vector comprising the polynucleotide of claim 26, 27, 28, or 29.
31. A cell comprising the polynucleotide of claim 26, 27, 28, 29, or 30.
32. The cell of claim 31 , wherein said cell is a plant cell.
33. The cell of claim 32, wherein said plant cell is from a dicot.
34. The cell of claim 33, where said dicot is soybean, wheat, canola, sunflower, cotton, or alfalfa.
35. The cell of claim 32, wherein said plant cell is from a monocot.
36. The cell of claim 35, wherein said monocot is maize, wheat, rice, barley, sorghum, or rye.
37. A plant comprising the polynucleotide of claim 26, 27, 28, or 29.
38. The plant of claim 37, wherein said plant is a dicot.
39. The plant of claim 38, where said dicot is soybean, wheat, canola, sunflower, cotton, or alfalfa.
40. The plant of claim 37, wherein said plant is a monocot.
41. The plant of claim 40, wherein said monocot is maize, wheat, rice, barley, sorghum, or rye.
42. A method for improving transformation efficiency, increasing a single copy integration event, or increasing transformation efficacy of a plant comprising: a) introducing in the plant a cassette comprising a chimeric transcriptional regulatory region comprising at least one enhancer domain operably linked to a heterologous promoter, said chimeric transcriptional regulatory region operably linked to a selectable marker wherein said enhancer domain is selected from the group consisting of: i) the nucleotide sequence comprising SEQ ID NO:1 or 17; ii) the nucleotide sequence comprising at least 95% sequence identity to SEQ ID NO:1 or 17, wherein said polynucleotide has regulating transcriptional activity; and, iii) the nucleotide sequence comprising at least 100 consecutive nucleotides of SEQ ID NO:1 or 17; b) contacting said plant with an effective concentration of an appropriate selection agent; and, c) selecting the plant expressing said selectable marker.
43. The method of claim 42, wherein said enhancer does not comprise the sequence set forth in SEQ ID NO:5.
44. The method of claim 42 or 43, wherein said chimeric transcriptional regulatory region comprises at least two copies or at least three copies of said enhancer.
45. The method of claim 44, wherein a) the copies of said enhancer are immediately adjacent to one another; b) at least one of said enhancers is in orientated in the forward or reverse orientation with respect to said promoter.
46. The method of claim 42, 43, 44, or 45, wherein said cassette further comprises a polynucleotide of interest.
47. The method of claim 42, 43, 44, 45, or 46, wherein said selectable marker confers tolerance to a herbicide.
PCT/US2006/032792 2005-08-24 2006-08-22 Methods and compositions for the expression of a polynucleotide of interest WO2007024866A2 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
BRPI0615087-0A BRPI0615087A2 (en) 2005-08-24 2006-08-22 methods and compositions for the expression of a polynucleotide of interest
EP06836107A EP1931791B1 (en) 2005-08-24 2006-08-22 Methods and compositions for the expression of a polynucleotide of interest
AT06836107T ATE544861T1 (en) 2005-08-24 2006-08-22 METHODS AND COMPOSITIONS FOR EXPRESSING A POLYNUCLEOTIDE OF INTEREST
MX2008002615A MX2008002615A (en) 2005-08-24 2006-08-22 Methods and compositions for the expression of a polynucleotide of interest.
CA2620002A CA2620002C (en) 2005-08-24 2006-08-22 Methods and compositions for the expression of a polynucleotide of interest

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US71085405P 2005-08-24 2005-08-24
US60/710,854 2005-08-24
US81701106P 2006-06-28 2006-06-28
US60/817,011 2006-06-28

Publications (2)

Publication Number Publication Date
WO2007024866A2 true WO2007024866A2 (en) 2007-03-01
WO2007024866A3 WO2007024866A3 (en) 2007-06-21

Family

ID=37772256

Family Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2006/032606 WO2007024782A2 (en) 2005-08-24 2006-08-22 Compositions providing tolerance to multiple herbicides and methods of use thereof
PCT/US2006/032792 WO2007024866A2 (en) 2005-08-24 2006-08-22 Methods and compositions for the expression of a polynucleotide of interest

Family Applications Before (1)

Application Number Title Priority Date Filing Date
PCT/US2006/032606 WO2007024782A2 (en) 2005-08-24 2006-08-22 Compositions providing tolerance to multiple herbicides and methods of use thereof

Country Status (22)

Country Link
US (8) US7622641B2 (en)
EP (2) EP1931791B1 (en)
JP (1) JP2009505654A (en)
KR (1) KR20080052606A (en)
AP (1) AP2008004392A0 (en)
AR (2) AR055128A1 (en)
AT (1) ATE544861T1 (en)
AU (1) AU2006283504B2 (en)
BR (2) BRPI0615087A2 (en)
CA (2) CA2620002C (en)
CL (1) CL2009001635A1 (en)
CR (1) CR9757A (en)
EA (2) EA200800622A1 (en)
EC (1) ECSP088304A (en)
MA (1) MA29777B1 (en)
ME (1) MEP3508A (en)
MX (2) MX2008002615A (en)
NZ (1) NZ568867A (en)
RS (1) RS20080076A (en)
TW (1) TW200730625A (en)
UY (1) UY29761A1 (en)
WO (2) WO2007024782A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7803992B2 (en) 2005-08-24 2010-09-28 Pioneer Hi-Bred International, Inc. Methods and compositions for expressing an herbicide-tolerant polynucleotide
EP3090046A4 (en) * 2013-12-31 2017-06-21 Dow AgroSciences LLC Novel maize ubiquitin promoters
US10329578B2 (en) 2013-10-18 2019-06-25 Pioneer Hi-Bred International, Inc. Glyphosate-N-acetyltransferase (GLYAT) sequences and methods of use

Families Citing this family (615)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7462481B2 (en) * 2000-10-30 2008-12-09 Verdia, Inc. Glyphosate N-acetyltransferase (GAT) genes
US20070197474A1 (en) * 2004-03-30 2007-08-23 Clinton William P Methods for controlling plants pathogens using N-phosphonomethylglycine
CA2561145C (en) 2004-03-30 2014-10-28 Monsanto Technology Llc Methods for controlling plant pathogens using n-phosphonomethylglycine
US7405074B2 (en) * 2004-04-29 2008-07-29 Pioneer Hi-Bred International, Inc. Glyphosate-N-acetyltransferase (GAT) genes
US8314290B2 (en) 2004-12-21 2012-11-20 Monsanto Technology Llc Temporal regulation of gene expression by MicroRNAs
US7855326B2 (en) 2006-06-06 2010-12-21 Monsanto Technology Llc Methods for weed control using plants having dicamba-degrading enzymatic activity
CA2653742C (en) 2006-06-06 2016-01-05 Monsanto Technology Llc Method for selection of plant cells transformed with a polynucleotide encoding dicamba monooxygenase using auxin-like herbicides
US7951995B2 (en) * 2006-06-28 2011-05-31 Pioneer Hi-Bred International, Inc. Soybean event 3560.4.3.5 and compositions and methods for the identification and detection thereof
US7968770B2 (en) 2006-06-28 2011-06-28 Pioneer Hi-Bred International, Inc. Methods for improving yield using soybean event 3560.4.3.5
ES2655700T3 (en) 2006-08-31 2018-02-21 Monsanto Technology, Llc Small RNAs in phase
US7939721B2 (en) 2006-10-25 2011-05-10 Monsanto Technology Llc Cropping systems for managing weeds
US7928296B2 (en) * 2006-10-30 2011-04-19 Pioneer Hi-Bred International, Inc. Maize event DP-098140-6 and compositions and methods for the identification and/or detection thereof
US7897846B2 (en) * 2006-10-30 2011-03-01 Pioneer Hi-Bred Int'l, Inc. Maize event DP-098140-6 and compositions and methods for the identification and/or detection thereof
CL2007003744A1 (en) 2006-12-22 2008-07-11 Bayer Cropscience Ag COMPOSITION THAT INCLUDES A 2-PYRIDILMETILBENZAMIDE DERIVATIVE AND AN INSECTICIDE COMPOUND; AND METHOD TO CONTROL FITOPATOGENOS CULTURES AND INSECTS FACING OR PREVENTIVELY.
CL2007003743A1 (en) 2006-12-22 2008-07-11 Bayer Cropscience Ag COMPOSITION THAT INCLUDES FENAMIDONA AND AN INSECTICIDE COMPOUND; AND METHOD TO CONTROL FITOPATOGENOS CULTURES AND INSECTS FACING OR PREVENTIVELY.
US7838729B2 (en) 2007-02-26 2010-11-23 Monsanto Technology Llc Chloroplast transit peptides for efficient targeting of DMO and uses thereof
JP2010520899A (en) 2007-03-12 2010-06-17 バイエル・クロツプサイエンス・アクチエンゲゼルシヤフト Dihalophenoxyphenylamidine and its use as a fungicide
EP1969930A1 (en) 2007-03-12 2008-09-17 Bayer CropScience AG Phenoxy phenylamidines and their use as fungicides
EP2120558B1 (en) 2007-03-12 2016-02-10 Bayer Intellectual Property GmbH 3,4-Disubstituted phenoxyphenylamidine derivatives and their use as fungicides
EP1969929A1 (en) 2007-03-12 2008-09-17 Bayer CropScience AG Substituted phenylamidines and their use as fungicides
EP1969931A1 (en) * 2007-03-12 2008-09-17 Bayer CropScience Aktiengesellschaft Fluoroalkyl phenylamidines and their use as fungicides
EP1969934A1 (en) * 2007-03-12 2008-09-17 Bayer CropScience AG 4-cycloalkyl or 4-aryl substituted phenoxy phenylamidines and their use as fungicides
JP2008237025A (en) * 2007-03-23 2008-10-09 Research Institute Of Innovative Technology For The Earth Promoter root-specifically inducing expression in plant and utilization thereof
WO2008128639A1 (en) * 2007-04-19 2008-10-30 Bayer Cropscience Aktiengesellschaft Thiadiazolyl oxyphenyl amidines and the use thereof as a fungicide
CN101998988A (en) * 2007-05-30 2011-03-30 先正达参股股份有限公司 Cytochrome P450 genes conferring herbicide resistance
US20100204046A1 (en) * 2007-07-23 2010-08-12 Gowan Co. Processes for the Control of Undesired Vegetation
DE102007045919B4 (en) 2007-09-26 2018-07-05 Bayer Intellectual Property Gmbh Drug combinations with insecticidal and acaricidal properties
DE102007045956A1 (en) 2007-09-26 2009-04-09 Bayer Cropscience Ag Combination of active ingredients with insecticidal and acaricidal properties
DE102007045957A1 (en) 2007-09-26 2009-04-09 Bayer Cropscience Ag Active agent combination, useful e.g. for combating animal pests e.g. insects and treating seeds of transgenic plants, comprises substituted amino-furan-2-one compound and at least one compound e.g. benzoyl urea, buprofezin and cyromazine
DE102007045953B4 (en) 2007-09-26 2018-07-05 Bayer Intellectual Property Gmbh Drug combinations with insecticidal and acaricidal properties
DE102007045920B4 (en) 2007-09-26 2018-07-05 Bayer Intellectual Property Gmbh Synergistic drug combinations
DE102007045922A1 (en) 2007-09-26 2009-04-02 Bayer Cropscience Ag Drug combinations with insecticidal and acaricidal properties
DE102007045955A1 (en) 2007-09-26 2009-04-09 Bayer Cropscience Ag Active agent combination, useful e.g. for combating animal pests and treating seeds of transgenic plants, comprises substituted amino-furan-2-one compound and at least one compound e.g. diazinon, isoxathion, carbofuran or aldicarb
EP2090168A1 (en) 2008-02-12 2009-08-19 Bayer CropScience AG Method for improving plant growth
EP2052603A1 (en) 2007-10-24 2009-04-29 Bayer CropScience AG Application of 2-lodo-N-[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)carbamoyl] benzol sulphonamide and/or its salts for inhibiting unwanted plant growth in selected agricultural crop cultures or non-cultivated land
EP2052604A1 (en) 2007-10-24 2009-04-29 Bayer CropScience AG Salts of 2-lodo-N-[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)carbamoyl] benzol sulphonamide, method for its manufacture and its application as herbicide and plant growth regulator
US8097712B2 (en) 2007-11-07 2012-01-17 Beelogics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
EP2064952A1 (en) 2007-11-29 2009-06-03 Bayer CropScience AG Method for reducing mycotoxin contamination in maize
EP2070415A1 (en) 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
EP2070411A1 (en) 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
EP2070413A1 (en) 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
EP2070414A1 (en) 2007-12-11 2009-06-17 Bayer CropScience AG Active compound combinations
EP2072506A1 (en) 2007-12-21 2009-06-24 Bayer CropScience AG Thiazolyloxyphenylamidine or thiadiazolyloxyphenylamidine und its use as fungicide
EP2254418A2 (en) * 2008-02-12 2010-12-01 Arysta LifeScience North America, LLC Method of controlling unwanted vegetation
EP2092824A1 (en) 2008-02-25 2009-08-26 Bayer CropScience AG Heterocyclyl pyrimidines
EP2103216A1 (en) 2008-03-19 2009-09-23 Bayer CropScience AG Selected salts from 3-(5,6-dihydro-1,4,2-dioxazin-3-yl)-N-[(4,6-dimethoxypyrimidin-2-yl)carbamoyl] pyridine-2-sulfonamide, methods for their production and their usage as herbicides and plant growth regulators
EP2103615A1 (en) 2008-03-19 2009-09-23 Bayer CropScience AG 4'4'-Dioxaspiro-spirocyclic substituted tetramates
CA2722775A1 (en) 2008-04-30 2009-11-05 Pierre Cristau Thiazol-4-carboxylic acid esters and thioesters as plant protection agents
WO2009135254A1 (en) * 2008-05-06 2009-11-12 Agriculture Victoria Services Pty Ltd Herbicide resistant barley
BRPI0913885A8 (en) 2008-06-27 2016-08-02 Bayer Cropscience Ag thiadiazolyloxyphenylamidines and their use as fungicides
EP2168434A1 (en) 2008-08-02 2010-03-31 Bayer CropScience AG Use of azols to increase resistance of plants of parts of plants to abiotic stress
CN102112629B (en) 2008-08-08 2015-05-27 拜尔作物科学公司 Methods for plant fiber characterization and identification
WO2010017902A1 (en) 2008-08-14 2010-02-18 Bayer Cropscience Aktiengesellschaft Insecticidal 4-phenyl-1h-pyrazoles
DE102008041695A1 (en) 2008-08-29 2010-03-04 Bayer Cropscience Ag Methods for improving plant growth
EP2161259A1 (en) 2008-09-03 2010-03-10 Bayer CropScience AG 4-Haloalkyl substituted Diaminopyrimidine
US8367392B2 (en) * 2008-09-05 2013-02-05 Transalgae Ltd. Genetic transformation of algal and cyanobacteria cells by microporation
PE20100269A1 (en) * 2008-09-05 2010-04-30 TransAlgae Ltd HERBICIDE RESISTANCE TO MAINTAIN AXENIC CROPS BY GENETIC MANIPULATION
GB0816880D0 (en) * 2008-09-15 2008-10-22 Syngenta Ltd Improvements in or relating to organic compounds
WO2010037479A1 (en) * 2008-10-01 2010-04-08 Bayer Cropscience Ag Heterocyclyl-substituted thiazoles as plant protection agents
PL2386203T3 (en) 2008-10-15 2014-05-30 Bayer Ip Gmbh Use of dithiin tetracarboximides for combating phytopathogenic fungi
BRPI0914500A2 (en) * 2008-10-21 2015-08-11 Basf Se "pest control method, method of increasing plant health of a cultivated plant, seed of a cultivated plant, composition, method of producing an agricultural product, use of a composition and uses of a pesticide"
AR075467A1 (en) * 2008-10-22 2011-04-06 Basf Se USE OF OXIDASE PROTOPORPHYRINOGEN INHIBITORS IN CULTIVATED PLANTS
AR075469A1 (en) * 2008-10-22 2011-04-06 Basf Se USE OF ACETOLACTATE SYNTHEASE INHIBITORS IN CULTIVATED PLANTS
WO2010046423A2 (en) * 2008-10-22 2010-04-29 Basf Se Use of sulfonylurea herbicides on cultivated plants
EP2184273A1 (en) 2008-11-05 2010-05-12 Bayer CropScience AG Halogen substituted compounds as pesticides
TW201031327A (en) 2008-11-14 2010-09-01 Bayer Cropscience Ag Active compound combinations having insecticidal and acaricidal properties
EP2201838A1 (en) 2008-12-05 2010-06-30 Bayer CropScience AG Active ingredient-beneficial organism combinations with insecticide and acaricide properties
EP2376487B1 (en) 2008-12-11 2016-01-06 Bayer Intellectual Property GmbH Thiazolyl oxime ether and hydrazones as plant protection agent
WO2010069495A1 (en) * 2008-12-18 2010-06-24 Bayer Cropscience Aktiengesellschaft Atpenins
EP2198710A1 (en) 2008-12-19 2010-06-23 Bayer CropScience AG Use of 5-pyridin-4yl-(1,3) thiazoles for combating phytopathogenic fungi
EP2198709A1 (en) 2008-12-19 2010-06-23 Bayer CropScience AG Method for treating resistant animal pests
CN102333445B (en) 2008-12-29 2014-09-03 拜尔农作物科学股份公司 Method for improved use of the production potential of genetically modified plants
EP2223602A1 (en) 2009-02-23 2010-09-01 Bayer CropScience AG Method for improved utilisation of the production potential of genetically modified plants
EP2204094A1 (en) 2008-12-29 2010-07-07 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants Introduction
EP2039771A2 (en) 2009-01-06 2009-03-25 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants
EP2039772A2 (en) 2009-01-06 2009-03-25 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants introduction
EP2039770A2 (en) 2009-01-06 2009-03-25 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants
WO2010081646A2 (en) 2009-01-15 2010-07-22 Bayer Cropscience Aktiengesellschaft Fungicidal active ingredient combinations
EP2387317A2 (en) 2009-01-15 2011-11-23 Bayer CropScience AG Fungicidal active agent compounds
CN102355820B (en) 2009-01-19 2013-10-16 拜尔农作物科学股份公司 Cyclic diones and their use as insecticides, acaricides and/or fungicides
ES2619279T3 (en) * 2009-01-22 2017-06-26 Syngenta Participations Ag. Hydroxyphenylpyruvate Dioxygenase mutant polypeptides and methods of use
EP2227951A1 (en) 2009-01-23 2010-09-15 Bayer CropScience AG Application of enaminocarbonyl compounds for combating viruses transmitted by insects
WO2010086311A1 (en) 2009-01-28 2010-08-05 Bayer Cropscience Ag Fungicide n-cycloalkyl-n-bicyclicmethylene-carboxamide derivatives
AR075126A1 (en) 2009-01-29 2011-03-09 Bayer Cropscience Ag METHOD FOR THE BEST USE OF THE TRANSGENIC PLANTS PRODUCTION POTENTIAL
EP2223917A1 (en) 2009-02-02 2010-09-01 Bayer CropScience AG Isothiazolyloxyphenylamidines and their use as fungicides
JP6121649B2 (en) 2009-02-03 2017-04-26 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Use of sulfur-containing heteroaromatic acid analogs as bactericides.
CN102317259B (en) 2009-02-17 2015-12-02 拜尔农科股份公司 Fungicidal N-(phenylcycloalkyl) carboxylic acid amides, N-(benzylic cycloalkyl group) carboxylic acid amides and thiocarboxamide derivative
EP2218717A1 (en) 2009-02-17 2010-08-18 Bayer CropScience AG Fungicidal N-((HET)Arylethyl)thiocarboxamide derivatives
ES2344185B1 (en) * 2009-02-18 2011-08-11 Consejo Superior De Investigaciones Cientificas (Csic) (95%) USE OF A NUCLEOTIDIC SEQUENCE THAT REGULATES THE MOMENT OF THE FLOWERING, PLANTS THAT EXPRESS IT AND METHOD TO PRODUCE IT.
TW201031331A (en) 2009-02-19 2010-09-01 Bayer Cropscience Ag Pesticide composition comprising a tetrazolyloxime derivative and a fungicide or an insecticide active substance
BRPI1008949B1 (en) 2009-03-11 2018-07-10 Bayer Intellectual Property Gmbh HALOALKYLMETHYLENEXY-PHENYL-SUBSTITUTED KETOENOLS AND THEIR USE, COMPOSITION, USE AND METHOD OF PRODUCTION, METHODS FOR COMBATING ANIMAL PEST AND / OR GROWTH OF UNWANTED PLANTS
DE102009001469A1 (en) 2009-03-11 2009-09-24 Bayer Cropscience Ag Improving utilization of productive potential of transgenic plant by controlling e.g. animal pest, and/or by improving plant health, comprises treating the transgenic plant with active agent composition comprising prothioconazole
DE102010000662A1 (en) 2009-03-18 2010-10-21 Bayer Cropscience Ag New thiazole compounds useful to combat e.g. plant pathogenic fungus, bacteria and algae, and as herbicides, growth regulators, agents to improve plant properties, antimycotics, insecticides, virucides and Rickettsia-like organism
DE102009001681A1 (en) 2009-03-20 2010-09-23 Bayer Cropscience Ag Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi, microorganisms and/or improving plant health, comprises treating plant with a drug composition comprising iprovalicarb
DE102009001732A1 (en) 2009-03-23 2010-09-30 Bayer Cropscience Ag Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising trifloxystrobin
DE102009001728A1 (en) 2009-03-23 2010-09-30 Bayer Cropscience Ag Improving the production potential of transgenic plant, by combating e.g. animal pests and/or microorganism, and/or increasing plant health, comprises treating the plants with active agent composition comprising fluoxastrobin
DE102009001730A1 (en) 2009-03-23 2010-09-30 Bayer Cropscience Ag Improving utilization of production potential of a transgenic plant by controlling animal pests, phytopathogenic fungi and/or microorganisms and/or the plant health, comprises treating plant with a drug composition comprising spiroxamine
EP2232995A1 (en) 2009-03-25 2010-09-29 Bayer CropScience AG Method for improved utilisation of the production potential of transgenic plants
EP2410848A1 (en) 2009-03-25 2012-02-01 Bayer CropScience AG Active ingredient combinations having insecticidal and acaricidal properties
CN102448305B (en) 2009-03-25 2015-04-01 拜尔农作物科学股份公司 Active ingredient combinations having insecticidal and acaricidal properties
UA104887C2 (en) 2009-03-25 2014-03-25 Баєр Кропсаєнс Аг Synergic combinations of active ingredients
BRPI0924436B1 (en) 2009-03-25 2017-06-06 Bayer Cropscience Ag combinations of active substances with insecticidal and acaricidal properties and their use, as well as method for pest and animal control
EP2239331A1 (en) 2009-04-07 2010-10-13 Bayer CropScience AG Method for improved utilization of the production potential of transgenic plants
CN102458125B (en) 2009-05-06 2015-04-29 拜尔农作物科学股份公司 Cyclopentanedione compounds and their use as insecticides, acaricides and/or fungicides
EP2251331A1 (en) 2009-05-15 2010-11-17 Bayer CropScience AG Fungicide pyrazole carboxamides derivatives
AR076839A1 (en) 2009-05-15 2011-07-13 Bayer Cropscience Ag FUNGICIDE DERIVATIVES OF PIRAZOL CARBOXAMIDAS
US10555527B2 (en) 2009-05-18 2020-02-11 Monsanto Technology Llc Use of glyphosate for disease suppression and yield enhancement in soybean
CN102439013B (en) 2009-05-19 2015-03-18 拜尔农作物科学股份公司 Herbicidal spiroheterocyclic tetronic acid derivatives
EP2253617A1 (en) 2009-05-20 2010-11-24 Bayer CropScience AG Halogenated compounds as pesticides
EP2255626A1 (en) 2009-05-27 2010-12-01 Bayer CropScience AG Use of succinate dehydrogenase inhibitors to increase resistance of plants or parts of plants to abiotic stress
CN102595889A (en) 2009-06-02 2012-07-18 拜耳作物科学公司 Use of succinate dehydrogenase inhibitors for controlling sclerotinia ssp.
EP2264011A1 (en) 2009-06-03 2010-12-22 Bayer CropScience AG Heteroarylamidines and their use as fungicides
EP2264010A1 (en) 2009-06-03 2010-12-22 Bayer CropScience AG Hetarylamidines
EP2264012A1 (en) 2009-06-03 2010-12-22 Bayer CropScience AG Heteroarylamidines and their use as fungicides
WO2010144058A1 (en) 2009-06-10 2010-12-16 Temasek Life Sciences Laboratory Limited Virus induced gene silencing (vigs) for functional analysis of genes in cotton.
WO2010147636A1 (en) * 2009-06-15 2010-12-23 Huttenbauer, Samuel, Jr. Herbicide resistant camelina sativa
WO2010145789A1 (en) 2009-06-18 2010-12-23 Bayer Cropscience Ag Propargyloxybenzamide derivatives
EP2272846A1 (en) 2009-06-23 2011-01-12 Bayer CropScience AG Thiazolylpiperidine derivatives as fungicide
EP2277869A1 (en) 2009-06-24 2011-01-26 Bayer CropScience AG Cycloalkylamidbenzoxa(thia)zoles as fungicides
EP2277870A1 (en) 2009-06-24 2011-01-26 Bayer CropScience AG Substituted benzoxa(thia)zoles
EP2277868A1 (en) 2009-06-24 2011-01-26 Bayer CropScience AG Phenyloxy(thio)phenylamidbenzoxa(thia)zoles
EP2451947A1 (en) 2009-07-07 2012-05-16 Linda A. Castle Crystal structure of glyphosate acetyltransferase (glyat) and methods of use
BR112012000245A8 (en) 2009-07-08 2016-06-21 Bayer Cropscience Ag PHENYL (OXY/THIO)ALKANOL DERIVATIVES.
BR112012000170A2 (en) 2009-07-08 2019-09-24 Bayer Cropscience Ag substituted phenyl (oxy / thio) alkanol derivatives
MX2012000566A (en) 2009-07-16 2012-03-06 Bayer Cropscience Ag Synergistic active substance combinations containing phenyl triazoles.
WO2011006604A1 (en) 2009-07-17 2011-01-20 Bayer Cropscience Ag Substituted aminothiazoles and use thereof as fungicides
WO2011015524A2 (en) 2009-08-03 2011-02-10 Bayer Cropscience Ag Fungicide heterocycles derivatives
US11096345B2 (en) 2009-09-01 2021-08-24 Basf Se Method for treating post-emergent rice
TW201113376A (en) * 2009-09-01 2011-04-16 Basf Agrochemical Products Bv Herbicide-tolerant plants
EP2292094A1 (en) 2009-09-02 2011-03-09 Bayer CropScience AG Active compound combinations
AR077956A1 (en) 2009-09-14 2011-10-05 Bayer Cropscience Ag COMBINATIONS OF ACTIVE COMPOUNDS
WO2011032656A1 (en) 2009-09-18 2011-03-24 Bayer Cropscience Ag 5-fluor-2-thio-substituted pyrimidine derivatives
US20110081706A1 (en) * 2009-10-02 2011-04-07 TransAlgae Ltd Method and system for efficient harvesting of microalgae and cyanobacteria
WO2011041796A1 (en) 2009-10-02 2011-04-07 Pioneer Hi-Bred International, Inc. Down-regulation of acc synthase for improved plant performance
EP2308866A1 (en) 2009-10-09 2011-04-13 Bayer CropScience AG Phenylpyri(mi)dinylpyrazoles and their use as fungicides
US8962584B2 (en) 2009-10-14 2015-02-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Compositions for controlling Varroa mites in bees
CN102548412B (en) 2009-10-15 2015-06-03 拜尔农作物科学股份公司 Active compound combinations
WO2011045259A1 (en) 2009-10-16 2011-04-21 Bayer Cropscience Ag Aminopropenoates as fungicides
WO2011051243A1 (en) 2009-10-29 2011-05-05 Bayer Cropscience Ag Active compound combinations
CN102712634B (en) 2009-10-30 2016-04-06 拜耳知识产权有限责任公司 Heteroaryl piperidine and heteroaryl bridged piperazine derivatives
WO2011051198A2 (en) 2009-10-30 2011-05-05 Bayer Cropscience Ag Pyridine derivatives as agricultural pesticides
KR20120096511A (en) 2009-11-17 2012-08-30 바이엘 크롭사이언스 아게 Active compound combinations
US8581046B2 (en) 2010-11-24 2013-11-12 Pioneer Hi-Bred International, Inc. Brassica gat event DP-073496-4 and compositions and methods for the identification and/or detection thereof
EP2343280A1 (en) 2009-12-10 2011-07-13 Bayer CropScience AG Fungicide quinoline derivatives
WO2011080044A2 (en) 2009-12-16 2011-07-07 Bayer Cropscience Ag Active compound combinations
WO2011082941A1 (en) 2009-12-16 2011-07-14 Bayer Cropscience Ag Benzyl-substituted thiadiazolyl oxyphenyl amidinium salts as fungicides
WO2011076699A1 (en) 2009-12-21 2011-06-30 Bayer Cropscience Ag Bis(difluormethyl)pyrazoles used as fungicides
AR079545A1 (en) 2009-12-21 2012-02-01 Bayer Cropscience Ag TIENILPIRI (MI) DINILAZOL
AR079883A1 (en) 2009-12-23 2012-02-29 Bayer Cropscience Ag TOLERANT PLANTS TO INHIBITING HERBICIDES OF HPPD
UY33139A (en) 2009-12-23 2011-07-29 Bayer Cropscience Ag TOLERANT PLANTS TO INHIBITING HERBICIDES OF HPPD
EP2516631B1 (en) 2009-12-23 2018-02-14 Bayer Intellectual Property GmbH Plants tolerant to hppd inhibitor herbicides
ES2659085T3 (en) 2009-12-23 2018-03-13 Bayer Intellectual Property Gmbh HPPD Inhibitor Herbicide Tolerant Plants
ES2659086T3 (en) 2009-12-23 2018-03-13 Bayer Intellectual Property Gmbh HPPD-inhibiting herbicide-tolerant plants
US9000012B2 (en) 2009-12-28 2015-04-07 Bayer Cropscience Ag Fungicide hydroximoyl-heterocycles derivatives
BR112012012340A2 (en) 2009-12-28 2015-09-08 Bayer Cropscience Ag compost, fungicidal composition and method for the control of plant pathogenic fungus
BR112012012107B1 (en) 2009-12-28 2019-08-20 Bayer Cropscience Ag Compound, fungicidal composition and method for controlling plant pathogenic fungi
BR112012018108A2 (en) 2010-01-22 2015-10-20 Bayer Ip Gmbh acaricidal and / or insecticidal combinations of active ingredients
EP2529027A1 (en) 2010-01-26 2012-12-05 Pioneer-Hi-Bred International, Inc. Hppd-inhibitor herbicide tolerance
JP6151917B2 (en) 2010-02-10 2017-06-21 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Spiroheterocyclic substituted tetramic acid derivatives
ES2700996T3 (en) 2010-02-10 2019-02-20 Bayer Cropscience Ag Cyclic ketoenols substituted with biphenyl
UA106786C2 (en) * 2010-02-19 2014-10-10 ДАУ АГРОСАЙЄНСІЗ ЕлЕлСі An herbicide/fungicide composition containing a pyridine carboxylic acid a fungicide
WO2011107445A1 (en) 2010-03-04 2011-09-09 Bayer Cropscience Ag Hydrate and anhydrous crystal form of the sodium salt of 2-iodo-n-[(4-methoxy-6-methyl-1,3,5-triazin-2-yl)carbamoyl]benzene­sulfonamide, process for preparation thereof and use thereof as herbicides and plant growth regulators
UA108638C2 (en) 2010-03-04 2015-05-25 APPLICATION OF MALEIC ACID IMTALINE SALTS FOR THE CONTROL OF PHYTOPATHOGENIC MUSHROOMS
EP2542533B1 (en) 2010-03-04 2014-09-10 Bayer Intellectual Property GmbH Fluoralkyl-substituted 2-amidobenzimidazoles and their use for increasing stress tolerance in plants
US9121022B2 (en) 2010-03-08 2015-09-01 Monsanto Technology Llc Method for controlling herbicide-resistant plants
CN102947443A (en) * 2010-03-17 2013-02-27 巴斯夫农业化学产品公司 Herbicide-tolerant plants
CN102970867A (en) 2010-03-18 2013-03-13 拜耳知识产权有限责任公司 Aryl and hetaryl sulfonamides as active agents against abiotic plant stress
WO2011117184A1 (en) 2010-03-24 2011-09-29 Bayer Cropscience Ag Fludioxonil derivates
CN102933078A (en) 2010-04-06 2013-02-13 拜耳知识产权有限责任公司 Use of 4-phenylbutyric acid and/or the salts thereof for enhancing the stress tolerance of plants
AR081810A1 (en) 2010-04-07 2012-10-24 Bayer Cropscience Ag BICYCLE PIRIDINYL PIRAZOLS
MX342482B (en) 2010-04-09 2016-09-30 Bayer Ip Gmbh Use of derivatives of the (1-cyanocyclopropyl)phenylphosphinic acid, the esters thereof and/or the salts thereof for enhancing the tolerance of plants to abiotic stress.
AU2011240060C1 (en) 2010-04-14 2015-08-27 Bayer Intellectual Property Gmbh Dithiinopyridazine-dion derivatives
PL2703397T3 (en) 2010-04-14 2015-12-31 Bayer Ip Gmbh Dithiin derivatives as fungicides
EP2377867A1 (en) 2010-04-14 2011-10-19 Bayer CropScience AG Dithiin pyridazinone derivatives
WO2011128297A2 (en) 2010-04-14 2011-10-20 Bayer Cropscience Ag Active compound combinations
JP5746752B2 (en) 2010-04-14 2015-07-08 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Thienodithiin derivatives as fungicides
MX2012011785A (en) 2010-04-14 2012-11-22 Bayer Cropscience Ag Fungicidal combinations of dithiino - tetracarboxamide derivatives and inorganic salts.
CN102971309A (en) 2010-04-28 2013-03-13 拜尔农科股份公司 Fungicide hydroximoyl-heterocycles derivatives
WO2011134913A1 (en) 2010-04-28 2011-11-03 Bayer Cropscience Ag Fungicide hydroximoyl-heterocycles derivatives
KR20130100903A (en) 2010-04-28 2013-09-12 바이엘 크롭사이언스 아게 Ketoheteroarylpiperidine and ketoheteroarylpiperazine derivatives as fungicides
WO2011134911A2 (en) 2010-04-28 2011-11-03 Bayer Cropscience Ag Fungicide hydroximoyl-tetrazole derivatives
US8815775B2 (en) 2010-05-18 2014-08-26 Bayer Cropscience Ag Bis(difluoromethyl)pyrazoles as fungicides
CN103025717B (en) 2010-05-27 2015-08-26 拜耳知识产权有限责任公司 As the heterocycle alkanol derivatives of sterilant
CN102947282B (en) 2010-05-27 2016-06-01 拜耳知识产权有限责任公司 Heterocycle alkanol derivatives as antifungal
EA201291261A1 (en) 2010-05-27 2013-06-28 Байер Интеллектуэль Проперти Гмбх Heterocyclic Derivatives of Alkanols as Fungicides
EP2576539B1 (en) 2010-05-27 2017-12-13 Bayer CropScience AG Pyridinyl carbonic acid derivatives as fungicides
CN102985414B (en) 2010-05-27 2016-05-18 拜耳知识产权有限责任公司 Heterocycle sulfo-as fungicide replaces alkanol derivatives
EA021116B1 (en) 2010-05-27 2015-04-30 Байер Интеллектуэль Проперти Гмбх Heterocyclic alkanol derivatives as fungicides
US8999956B2 (en) 2010-06-03 2015-04-07 Bayer Intellectual Property Gmbh N-[(het)arylalkyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues
US9232799B2 (en) 2010-06-03 2016-01-12 Bayer Intellectual Property Gmbh N-[(het)arylethyl)] pyrazole(thio)carboxamides and their heterosubstituted analogues
UA110703C2 (en) 2010-06-03 2016-02-10 Байєр Кропсайнс Аг Fungicidal n-[(trisubstitutedsilyl)methyl]carboxamide
CN109504700A (en) 2010-06-09 2019-03-22 拜尔作物科学公司 Plant Genome transformation in commonly on nucleotide sequence modified plant genome Method and kit for
AU2011264074B2 (en) 2010-06-09 2015-01-22 Bayer Cropscience Nv Methods and means to modify a plant genome at a nucleotide sequence commonly used in plant genome engineering
WO2011161034A1 (en) 2010-06-22 2011-12-29 Bayer Cropscience Ag 3-aryl-4-(2,6-dimethylbenzylidene)-isoxazol-5(4h)-ones as fungicides
WO2011161035A1 (en) 2010-06-22 2011-12-29 Bayer Cropscience Ag 3-aryl-4-(2-thienylmethylene)-isoxazol-5(4h)-ones as fungicides
KR20130088138A (en) 2010-06-28 2013-08-07 바이엘 인텔렉쳐 프로퍼티 게엠베하 Heteroaryl-substituted pyridine compounds for use as pesticides
WO2012010579A2 (en) 2010-07-20 2012-01-26 Bayer Cropscience Ag Benzocycloalkenes as antifungal agents
CN104365610A (en) 2010-08-05 2015-02-25 拜耳知识产权有限责任公司 Active compounds combinations comprising prothioconazole and fluxapyroxad
US20120122928A1 (en) 2010-08-11 2012-05-17 Bayer Cropscience Ag Heteroarylpiperidine and -Piperazine Derivatives as Fungicides
EP2603591A1 (en) 2010-08-13 2013-06-19 Pioneer Hi-Bred International Inc. Compositions and methods comprising sequences having hydroxyphenylpyruvate dioxygenase (hppd) activity
EP2423210A1 (en) 2010-08-25 2012-02-29 Bayer CropScience AG Heteroarylpiperidine and heteroarylpiperazine derivatives as fungicides
US8759527B2 (en) 2010-08-25 2014-06-24 Bayer Cropscience Ag Heteroarylpiperidine and -piperazine derivatives as fungicides
CN103180301B (en) 2010-08-26 2015-11-25 拜耳知识产权有限责任公司 5-iodo triazole derivative
WO2012028578A1 (en) 2010-09-03 2012-03-08 Bayer Cropscience Ag Substituted fused pyrimidinones and dihydropyrimidinones
BR112013006612A2 (en) 2010-09-22 2017-10-24 Bayer Ip Gmbh use of biological or chemical control agents for insect and nematode control in resistant crops
EP2460406A1 (en) 2010-12-01 2012-06-06 Bayer CropScience AG Use of fluopyram for controlling nematodes in nematode resistant crops
WO2012045726A2 (en) 2010-10-07 2012-04-12 Bayer Cropscience Ag 5-heteroarylimino-1,2,3-dithiazoles
EP2624699B1 (en) 2010-10-07 2018-11-21 Bayer CropScience Aktiengesellschaft Fungicide composition comprising a tetrazolyloxime derivative and a thiazolylpiperidine derivative
SI3284346T1 (en) 2010-10-15 2021-11-30 Bayer Cropscience Aktiengesellschaft Use of als inhibitor herbicides for control of unwanted vegetation in als inhibitor herbicide tolerant beta vulgaris plants
EP2630135B1 (en) 2010-10-21 2020-03-04 Bayer Intellectual Property GmbH 1-(heterocyclic carbonyl) piperidines
CA2815105A1 (en) 2010-10-21 2012-04-26 Bayer Intellectual Property Gmbh N-benzyl heterocyclic carboxamides
CA2815716C (en) 2010-10-27 2019-06-11 Bayer Intellectual Property Gmbh Heteroaryl piperidine and heteroaryl piperazine derivatives as fungicides
EP2635564B1 (en) 2010-11-02 2017-04-26 Bayer Intellectual Property GmbH N-hetarylmethyl pyrazolylcarboxamides
ES2588802T3 (en) 2010-11-10 2016-11-04 Bayer Cropscience Ag HPPD variants and usage procedures
BR112013012082A2 (en) 2010-11-15 2016-07-19 Bayer Ip Gmbh 5-halopyrazole carboxamides
CN103369962A (en) 2010-11-15 2013-10-23 拜耳知识产权有限责任公司 5-halogenopyrazole(thio)carboxamides
BR112013012080A2 (en) 2010-11-15 2016-07-19 Bayer Ip Gmbh n-aryl pyrazole (thio) carboxamides
US8575431B2 (en) 2010-11-24 2013-11-05 Pioneer Hi-Bred International, Inc. Brassica GAT event DP-061061-7 and compositions and methods for the identification and/or detection thereof
EP2460407A1 (en) 2010-12-01 2012-06-06 Bayer CropScience AG Agent combinations comprising pyridylethyl benzamides and other agents
AP3519A (en) 2010-12-01 2016-01-11 Bayer Ip Gmbh Use of fluopyram for controlling nematodes in crops and for increasing yield
JP2014502611A (en) 2010-12-29 2014-02-03 バイエル・インテレクチユアル・プロパテイー・ゲー・エム・ベー・ハー Fungicide hydroxymoyl-tetrazole derivative
EP2474542A1 (en) 2010-12-29 2012-07-11 Bayer CropScience AG Fungicide hydroximoyl-tetrazole derivatives
EP2471363A1 (en) 2010-12-30 2012-07-04 Bayer CropScience AG Use of aryl-, heteroaryl- and benzylsulfonamide carboxylic acids, -carboxylic acid esters, -carboxylic acid amides and -carbonitriles and/or its salts for increasing stress tolerance in plants
CN103429085B (en) * 2011-01-14 2015-08-12 陶氏益农公司 With the growth inhibition that penoxsuam carries out cotton
MX352307B (en) 2011-02-01 2017-11-17 Bayer Ip Gmbh Heteroaryl piperidine and heteroaryl piperazine derivatives as fungicides.
US9000026B2 (en) 2011-02-17 2015-04-07 Bayer Intellectual Property Gmbh Substituted 3-(biphenyl-3-yl)-8,8-difluoro-4-hydroxy-1-azaspiro[4.5]dec-3-en-2-ones for therapy
EP2494867A1 (en) 2011-03-01 2012-09-05 Bayer CropScience AG Halogen-substituted compounds in combination with fungicides
KR101789527B1 (en) 2011-03-01 2017-10-25 바이엘 인텔렉쳐 프로퍼티 게엠베하 2-Acyloxypyrrolin-4-ones
CA2823999C (en) 2011-03-10 2020-03-24 Bayer Intellectual Property Gmbh Use of lipochito-oligosaccharide compounds for safeguarding seed safety of treated seeds
EP2499911A1 (en) 2011-03-11 2012-09-19 Bayer Cropscience AG Active compound combinations comprising fenhexamid
BR112013023502A2 (en) 2011-03-14 2016-08-02 Bayer Ip Gmbh compound (i), fungicidal composition, method for the control of crop phytopathogenic fungi, use of the compounds of formula (i) and process for producing the compositions
DK2686303T3 (en) 2011-03-18 2016-03-29 Bayer Ip Gmbh N- (3-carbamoylphenyl) -1 H -pyrazole-5-carboxamide derivatives and their use for controlling animal pests
CN103491785A (en) 2011-03-23 2014-01-01 拜耳知识产权有限责任公司 Active compound combinations
ES2666149T3 (en) * 2011-03-25 2018-05-03 Monsanto Technology Llc Regulatory elements of plants and their uses
WO2012130686A2 (en) 2011-03-25 2012-10-04 Bayer Cropscience Ag Active compound combinations
WO2012130684A1 (en) 2011-03-25 2012-10-04 Bayer Cropscience Ag Use of n-(1,2,5-oxadiazol-3-yl)benzamides for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides
EP2688406B1 (en) 2011-03-25 2015-04-22 Bayer Intellectual Property GmbH Use of n-(tetrazol-4-yl)- or n-(triazol-3-yl)arylcarboxamides or their salts for controlling unwanted plants in areas of transgenic crop plants being tolerant to hppd inhibitor herbicides
US20140051575A1 (en) 2011-04-08 2014-02-20 Juergen Benting Fungicide hydroximoyl-tetrazole derivatives
AR085587A1 (en) 2011-04-13 2013-10-09 Bayer Cropscience Ag COMBINATIONS OF ACTIVE COMPOUNDS
AR085588A1 (en) 2011-04-13 2013-10-09 Bayer Cropscience Ag COMBINATIONS OF ACTIVE COMPOUNDS
EP2511255A1 (en) 2011-04-15 2012-10-17 Bayer CropScience AG Substituted prop-2-in-1-ol and prop-2-en-1-ol derivatives
AR090010A1 (en) 2011-04-15 2014-10-15 Bayer Cropscience Ag 5- (CICLOHEX-2-EN-1-IL) -PENTA-2,4-DIENOS AND 5- (CICLOHEX-2-EN-1-IL) -PENT-2-EN-4-INOS REPLACED AS ACTIVE PRINCIPLES AGAINST THE ABIOTIC STRESS OF PLANTS, USES AND TREATMENT METHODS
EP2510787A1 (en) 2011-04-15 2012-10-17 Bayer Cropscience AG Propenoates as fungicides
AR085568A1 (en) 2011-04-15 2013-10-09 Bayer Cropscience Ag 5- (BICYCLE [4.1.0] HEPT-3-EN-2-IL) -PENTA-2,4-DIENOS AND 5- (BICYCLE [4.1.0] HEPT-3-EN-2-IL) -PENT- 2-IN-4-INOS REPLACED AS ACTIVE PRINCIPLES AGAINST ABIOTIC STRESS OF PLANTS
AR085585A1 (en) 2011-04-15 2013-10-09 Bayer Cropscience Ag VINIL- AND ALQUINILCICLOHEXANOLES SUBSTITUTED AS ACTIVE PRINCIPLES AGAINST STRIPS ABIOTIQUE OF PLANTS
EA029682B1 (en) 2011-04-22 2018-04-30 Байер Интеллекчуал Проперти Гмбх Active compound combinations comprising a (thio)carboxamide derivative and a fungicidal compound
CA2833876A1 (en) 2011-04-29 2012-11-01 Pioneer Hi-Bred International, Inc. Down-regulation of a homeodomain-leucine zipper i-class homeobox gene for improved plant performance
EP2524600A1 (en) 2011-05-17 2012-11-21 Bayer CropScience AG Active compound combinations comprising phosphorous acid or a derivative thereof and Tebuconazole or Myclobutanil
EP2524599A1 (en) 2011-05-17 2012-11-21 Bayer CropScience AG Active compound combinations
EP2524598A1 (en) 2011-05-17 2012-11-21 Bayer CropScience AG Active compound combinations comprising dithianon
EP2524601A1 (en) 2011-05-17 2012-11-21 Bayer CropScience AG Active compound combinations comprising a phosphorous acid derivative and cyazofamid
EP2709454B1 (en) 2011-05-17 2017-08-02 Bayer Intellectual Property GmbH Active compound combinations
AU2012266597B2 (en) 2011-06-06 2016-09-22 Bayer Cropscience Nv Methods and means to modify a plant genome at a preselected site
EP2532233A1 (en) 2011-06-07 2012-12-12 Bayer CropScience AG Active compound combinations
PL2720543T3 (en) 2011-06-14 2019-03-29 Bayer Cropscience Ag Use of an enaminocarbonyl compound in combination with a biological control agent
AR086992A1 (en) 2011-06-20 2014-02-05 Bayer Ip Gmbh TIENILPIRI (MI) DINILPIRAZOLES
EP2540165A1 (en) 2011-06-30 2013-01-02 Bayer CropScience AG Use of a halogenated pesticide in combination with a biological pest control agent
WO2013004652A1 (en) 2011-07-04 2013-01-10 Bayer Intellectual Property Gmbh Use of substituted isoquinolinones, isoquinolindiones, isoquinolintriones and dihydroisoquinolinones or in each case salts thereof as active agents against abiotic stress in plants
US9303270B2 (en) 2011-07-22 2016-04-05 Ricetec Aktiengesellschaft Rice resistant to HPPD and accase inhibiting herbicides
US9265252B2 (en) 2011-08-10 2016-02-23 Bayer Intellectual Property Gmbh Active compound combinations comprising specific tetramic acid derivatives
AU2012293611B2 (en) 2011-08-11 2017-02-09 Bayer Cropscience Ag 1,2,4-triazolyl-substituted keto-enols
WO2013023992A1 (en) 2011-08-12 2013-02-21 Bayer Cropscience Nv Guard cell-specific expression of transgenes in cotton
JP2014524455A (en) 2011-08-22 2014-09-22 バイエル・インテレクチユアル・プロパテイー・ゲー・エム・ベー・ハー Fungicidal hydroxymoyl-tetrazole derivatives
BR122014004140B8 (en) 2011-08-22 2023-03-28 Bayer Cropscience Ag RECOMBINANT VECTOR OR RECOMBINANT CONSTRUCTION, AS WELL AS METHODS FOR OBTAINING AND PRODUCING A COTTON PLANT OR PLANT CELL TOLERANT TO AN HPPD INHIBITOR, AND FOR CULTIVATING A FIELD OF COTTON PLANTS
EP2561759A1 (en) 2011-08-26 2013-02-27 Bayer Cropscience AG Fluoroalkyl-substituted 2-amidobenzimidazoles and their effect on plant growth
WO2013034621A1 (en) 2011-09-09 2013-03-14 Bayer Intellectual Property Gmbh Acyl-homoserine lactone derivatives for improving plant yield
MX347562B (en) 2011-09-12 2017-05-03 Bayer Ip Gmbh Fungicidal 4-substituted-3-{phenyl[(heterocyclylmethoxy)imino]met hyl}-1,2,4-oxadizol-5(4h)-one derivatives.
BR112014005963A2 (en) 2011-09-13 2020-12-08 Monsanto Technology Llc methods of plant control, reducing expression of an als gene in a plant, identifying polynucleotides useful in modulating expression of the als gene, making a polynucleotide, compositions comprising a polynucleotide and a transfer agent or herbicide, cassette of microbial expression, as well as polynucleotide molecule
AU2012308694B2 (en) 2011-09-13 2018-06-14 Monsanto Technology Llc Methods and compositions for weed control
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
UA116090C2 (en) 2011-09-13 2018-02-12 Монсанто Текнолоджи Ллс Methods and compositions for weed control
AU2012308686B2 (en) 2011-09-13 2018-05-10 Monsanto Technology Llc Methods and compositions for weed control
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
AU2012308659B2 (en) 2011-09-13 2017-05-04 Monsanto Technology Llc Methods and compositions for weed control
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
UA114093C2 (en) 2011-09-16 2017-04-25 METHOD OF INCREASING THE USE OF CERTAIN PLANTS
CA2848620C (en) 2011-09-16 2020-03-10 Bayer Intellectual Property Gmbh Use of cyprosulfamide for inducing a growth regulating response in useful plants and increasing the yield of harvested plant organs therefrom
UA113967C2 (en) 2011-09-16 2017-04-10 APPLICATION OF 5-PHENYL OR 5-BENZYL-2-ISOXAZOLINE-3-CARBOXYLATES TO IMPROVE PLANT PRODUCTIVITY
US9226505B2 (en) 2011-09-23 2016-01-05 Bayer Intellectual Property Gmbh 4-substituted 1-phenylpyrazole-3-carboxylic acid derivatives as agents against abiotic plant stress
PL2764101T3 (en) 2011-10-04 2017-09-29 Bayer Intellectual Property Gmbh RNAi FOR THE CONTROL OF FUNGI AND OOMYCETES BY INHIBITING SACCHAROPINE DEHYDROGENASE GENE
WO2013050324A1 (en) 2011-10-06 2013-04-11 Bayer Intellectual Property Gmbh Combination, containing 4-phenylbutyric acid (4-pba) or a salt thereof (component (a)) and one or more selected additional agronomically active compounds (component(s) (b)), that reduces abiotic plant stress
UA114410C2 (en) 2011-10-06 2017-06-12 Байєр Інтеллектуал Проперті Гмбх Heterocyclylpyri(mi)dinylpyrazole
JP6042896B2 (en) 2011-10-06 2016-12-14 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Heterocyclic pyri (mi) dinylpyrazoles as fungicides
CA2856361A1 (en) 2011-11-21 2013-05-30 Bayer Intellectual Property Gmbh Fungicide n-[(trisubstitutedsilyl)methyl]-carboxamide derivatives
AR089656A1 (en) 2011-11-30 2014-09-10 Bayer Ip Gmbh DERIVATIVES OF N-BICICLOALQUIL- AND N-TRICICLOALQUIL- (TIO) -CARBOXAMIDA FUNGICIDAS
EP2606732A1 (en) 2011-12-19 2013-06-26 Bayer CropScience AG Use of an anthranilic diamide derivatives with heteroaromatic and heterocyclic substituents in combination with a biological control agent
AU2012357896B9 (en) 2011-12-19 2016-12-15 Bayer Cropscience Ag Use of anthranilic acid diamide derivatives for pest control in transgenic crops
CN104011026B (en) 2011-12-20 2016-07-20 拜耳知识产权股份有限公司 Parasite killing virtue amide
DK2921484T3 (en) 2011-12-27 2018-11-12 Bayer Cropscience Ag oxazole
JP6002242B2 (en) 2011-12-29 2016-10-05 バイエル・インテレクチュアル・プロパティ・ゲゼルシャフト・ミット・ベシュレンクテル・ハフツングBayer Intellectual Property GmbH Bactericidal 3-[(pyridin-2-ylmethoxyimino) (phenyl) methyl] -2-substituted-1,2,4-oxadiazol-5 (2H) -one derivatives
TWI558701B (en) 2011-12-29 2016-11-21 拜耳知識產權公司 Fungicidal 3-[(1,3-thiazol-4-ylmethoxyimino)(phenyl)methyl]-2-sub stituted-1,2,4-oxadiazol-5(2h)-one derivatives
US9204638B2 (en) 2011-12-30 2015-12-08 Plant Health Care, Inc. Method for increasing plant yield, and yield improving compositions
WO2013109754A1 (en) 2012-01-17 2013-07-25 Pioneer Hi-Bred International, Inc. Plant transcription factors, promoters and uses thereof
US20150011389A1 (en) 2012-01-25 2015-01-08 Bayer Intellectual Property Gmbh Active Compound Combinations Containing Fluopyram and Biological Control Agent
MX350563B (en) 2012-01-25 2017-09-11 Bayer Ip Gmbh Active compounds combination containing fluopyram bacillus and biologically control agent.
EP2622961A1 (en) 2012-02-02 2013-08-07 Bayer CropScience AG Acive compound combinations
AU2013224170B2 (en) 2012-02-22 2016-11-03 Bayer Cropscience Ag Use of succinate dehydrogenase inhibitors (SDHIs) for controlling wood diseases in grape.
PE20190342A1 (en) 2012-02-27 2019-03-07 Bayer Ip Gmbh ACTIVE COMPOUND COMBINATIONS
WO2013138309A1 (en) 2012-03-13 2013-09-19 Pioneer Hi-Bred International, Inc. Genetic reduction of male fertility in plants
MX2014011038A (en) 2012-03-13 2015-06-02 Pioneer Hi Bred Int Genetic reduction of male fertility in plants.
WO2013139949A1 (en) 2012-03-23 2013-09-26 Bayer Intellectual Property Gmbh Compositions comprising a strigolactame compound for enhanced plant growth and yield
US9357778B2 (en) 2012-04-12 2016-06-07 Bayer Cropscience Ag N-acyl-2-(cyclo)alkypyrrolidines and piperidines useful as fungicides
EP2838363A1 (en) 2012-04-20 2015-02-25 Bayer Cropscience AG N-cycloalkyl-n-[(trisubstitutedsilylphenyl)methylene]-(thio)carboxamide derivatives
EP2838893B1 (en) 2012-04-20 2019-03-13 Bayer Cropscience AG N-cycloalkyl-n-[(heterocyclylphenyl)methylene]-(thio)carboxamide derivatives
BR112014026203A2 (en) 2012-04-23 2017-07-18 Bayer Cropscience Nv plant-directed genome engineering
EP2662364A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole tetrahydronaphthyl carboxamides
EP2662361A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazol indanyl carboxamides
EP2662363A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole biphenylcarboxamides
EP2662362A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG Pyrazole indanyl carboxamides
JP6326043B2 (en) 2012-05-09 2018-05-16 バイエル・クロップサイエンス・アクチェンゲゼルシャフト 5-halogenopyrazole indanyl carboxamides
EP2662370A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole benzofuranyl carboxamides
US9249104B2 (en) 2012-05-09 2016-02-02 Bayer Cropscience Ag Pyrazole indanyl carboxamides
EP2662360A1 (en) 2012-05-09 2013-11-13 Bayer CropScience AG 5-Halogenopyrazole indanyl carboxamides
AR091104A1 (en) 2012-05-22 2015-01-14 Bayer Cropscience Ag COMBINATIONS OF ACTIVE COMPOUNDS THAT INCLUDE A LIPO-CHYTOOLIGOSACARIDE DERIVATIVE AND A NEMATICIDE, INSECTICIDE OR FUNGICIDE COMPOUND
AR091143A1 (en) 2012-05-24 2015-01-14 Seeds Ltd Ab COMPOSITIONS AND METHODS TO SILENCE GENETIC EXPRESSION
IN2014DN10220A (en) 2012-05-30 2015-08-07 Bayer Cropscience Ag
PL2854548T4 (en) 2012-05-30 2019-04-30 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide selected from metalaxyl and metalaxyl-m
PL2854547T3 (en) 2012-05-30 2019-02-28 Bayer Cropscience Ag Composition comprising a biological control agent and trifloxystrobin
ES2698061T3 (en) 2012-05-30 2019-01-30 Bayer Cropscience Ag Composition comprising a biological control agent and fluopicolida
IN2014DN08912A (en) 2012-05-30 2015-05-22 Bayer Cropscience Ag
WO2013178658A1 (en) 2012-05-30 2013-12-05 Bayer Cropscience Ag Compositions comprising a biological control agent and an insecticide
CN104507315A (en) 2012-05-30 2015-04-08 拜尔农作物科学股份公司 Compositions comprising a biological control agent and a fungicide from the group consisting of inhibitors of the respiratory chain at complex I or II.
CN104507311A (en) 2012-05-30 2015-04-08 拜尔农作物科学股份公司 Compositions comprising a biological control agent and an insecticide
WO2013188291A2 (en) 2012-06-15 2013-12-19 E. I. Du Pont De Nemours And Company Methods and compositions involving als variants with native substrate preference
WO2014009322A1 (en) 2012-07-11 2014-01-16 Bayer Cropscience Ag Use of fungicidal combinations for increasing the tolerance of a plant towards abiotic stress
US8883682B2 (en) 2012-07-24 2014-11-11 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl)pyridine-2-carboxylic acid or a derivative thereof and auxin transport inhibitors
US8912120B2 (en) 2012-07-24 2014-12-16 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and synthetic auxin herbicides
US8796177B2 (en) 2012-07-24 2014-08-05 Dow Agrosciences Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl)pyridine-2-carboxylic acid or a derivative thereof and acetyl-CoA carboxylase (ACCase) inhibitors
US8791048B2 (en) * 2012-07-24 2014-07-29 Dow Agrosciences Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and clomazone
US8912121B2 (en) 2012-07-24 2014-12-16 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl)pyridine-2-carboxylic acid or a derivative thereof and certain PS II inhibitors
US8841233B2 (en) * 2012-07-24 2014-09-23 Dow Agrosciences Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and 4-hydroxyphenyl-pyruvate dioxygenase (HPPD) inhibitors
US8809232B2 (en) * 2012-07-24 2014-08-19 Dow Agroscience Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and halosulfuron, pyrazosulfuron and esprocarb
US8889591B2 (en) 2012-07-24 2014-11-18 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl)pyridine-2-carboxylic acid or a derivative thereof and bromobutide, daimuron, oxaziclomefone or pyributicarb
US8846570B2 (en) * 2012-07-24 2014-09-30 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl)pyridine-2-carboxylic acid or a derivative thereof and microtubule inhibiting herbicides
US8895470B2 (en) 2012-07-24 2014-11-25 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and glyphosate or glufosinate
US8871681B2 (en) * 2012-07-24 2014-10-28 Dow Agrosciences Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and certain sulfonylureas
US8906826B2 (en) 2012-07-24 2014-12-09 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and imidazolinones
US8871680B2 (en) * 2012-07-24 2014-10-28 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and a di-methoxy-pyrimidine and derivatives thereof
US8906825B2 (en) 2012-07-24 2014-12-09 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and triazolopyrimidine sulfonamides
US8916499B2 (en) 2012-07-24 2014-12-23 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and a protoporphyrinogen oxidase inhibitor
US9644469B2 (en) 2012-07-24 2017-05-09 Dow Agrosciences Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and VLCFA and lipid synthesis inhibiting herbicides
US8901035B2 (en) 2012-07-24 2014-12-02 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and cellulose biosynthesis inhibitor herbicides
CN104602520A (en) 2012-07-31 2015-05-06 拜尔农作物科学股份公司 Compositions comprising a pesticidal terpene mixture and an insecticide
CA2883574A1 (en) 2012-09-05 2014-03-13 Bayer Cropscience Ag Use of substituted 2-amidobenzimidazoles, 2-amidobenzoxazoles and 2-amidobenzothiazoles or salts thereof as active substances against abiotic plant stress
WO2014043435A1 (en) 2012-09-14 2014-03-20 Bayer Cropscience Lp Hppd variants and methods of use
MX364070B (en) 2012-10-18 2019-04-10 Monsanto Technology Llc Methods and compositions for plant pest control.
DE102012219029A1 (en) 2012-10-18 2014-04-24 Bayer Cropscience Ag Use of dithiine tetracarboximide compounds for controlling Marssonina coronaria
CA2888556C (en) 2012-10-19 2020-07-07 Bayer Cropscience Ag Method of plant growth promotion using carboxamide derivatives
MX363731B (en) 2012-10-19 2019-04-01 Bayer Cropscience Ag Method for treating plants against fungi resistant to fungicides using carboxamide or thiocarboxamide derivatives.
EP2908642B1 (en) 2012-10-19 2022-02-23 Bayer Cropscience AG Method for enhancing tolerance to abiotic stress in plants by using carboxamide or thiocarboxamide derivatives
EA026839B1 (en) 2012-10-19 2017-05-31 Байер Кропсайенс Аг Active compound combinations comprising carboxamide compounds
WO2014079957A1 (en) 2012-11-23 2014-05-30 Bayer Cropscience Ag Selective inhibition of ethylene signal transduction
EP2735231A1 (en) 2012-11-23 2014-05-28 Bayer CropScience AG Active compound combinations
MX2015006327A (en) 2012-11-30 2015-10-05 Bayer Cropscience Ag Ternary fungicidal mixtures.
UA117820C2 (en) 2012-11-30 2018-10-10 Байєр Кропсайєнс Акцієнгезелльшафт Binary fungicidal or pesticidal mixture
CN104918493B (en) 2012-11-30 2018-02-06 拜尔农作物科学股份公司 Ternary fungicidal and insecticide mixtures
JP6367215B2 (en) 2012-11-30 2018-08-01 バイエル・クロップサイエンス・アクチェンゲゼルシャフト Two-component disinfectant mixture
WO2014083031A2 (en) 2012-11-30 2014-06-05 Bayer Cropscience Ag Binary pesticidal and fungicidal mixtures
US9730455B2 (en) 2012-12-03 2017-08-15 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
PT3318129T (en) 2012-12-03 2020-02-18 Bayer Cropscience Ag Method for pest control by applying a combination of paecilomyces lilacinus and fluopyram
WO2014086753A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising biological control agents
WO2014086758A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
MX2015006946A (en) 2012-12-03 2015-09-08 Bayer Cropscience Ag Composition comprising biological control agents.
MX2015006500A (en) 2012-12-03 2015-08-14 Bayer Cropsciense Ag Composition comprising a biological control agent and a fungicide.
WO2014086750A2 (en) 2012-12-03 2014-06-12 Bayer Cropscience Ag Composition comprising a biological control agent and an insecticide
MX2015006578A (en) 2012-12-03 2015-08-05 Bayer Cropscience Ag Composition comprising a biological control agent and a fungicide.
EP2740720A1 (en) 2012-12-05 2014-06-11 Bayer CropScience AG Substituted bicyclic and tricyclic pent-2-en-4-inic acid derivatives and their use for enhancing the stress tolerance in plants
EP2740356A1 (en) 2012-12-05 2014-06-11 Bayer CropScience AG Substituted (2Z)-5(1-Hydroxycyclohexyl)pent-2-en-4-inic acid derivatives
EP2928296A1 (en) 2012-12-05 2015-10-14 Bayer CropScience AG Use of substituted 1-(aryl ethynyl)-, 1-(heteroaryl ethynyl)-, 1-(heterocyclyl ethynyl)- and 1-(cyloalkenyl ethynyl)-cyclohexanols as active agents against abiotic plant stress
US9149037B2 (en) * 2012-12-12 2015-10-06 Dow Agrosciences Llc Synergistic weed control from applications of aminocyclopyrachlor and 2,4 dichlorophenoxyacetic acid (2,4-D)
WO2014090765A1 (en) 2012-12-12 2014-06-19 Bayer Cropscience Ag Use of 1-[2-fluoro-4-methyl-5-(2,2,2-trifluoroethylsulfinyl)phenyl]-5-amino-3-trifluoromethyl)-1 h-1,2,4 tfia zole for controlling nematodes in nematode-resistant crops
US20140173781A1 (en) 2012-12-13 2014-06-19 Pioneer Hi-Bred International, Inc. Methods and compositions for producing and selecting transgenic wheat plants
DK2931034T4 (en) * 2012-12-13 2022-07-18 Bayer Cropscience Ag USE OF ALS INHIBITOR HERBICIDES TO CONTROL UNDESIRABLE VEGETATION IN ALS INHIBITOR HERBICIDE TOLERANT BETA VULGARIS PLANTS
MA38254A1 (en) * 2012-12-13 2018-11-30 Sesvanderhave N V Process for the development of herbicide resistant sugar beet plants
US10412964B2 (en) 2012-12-14 2019-09-17 Dow Agrosciences Llc Synergistic weed control from applications of aminopyralid and clopyralid
NZ709447A (en) 2012-12-14 2019-09-27 Dow Agrosciences Llc Synergistic weed control from applications of aminopyralid and clopyralid
AR093996A1 (en) 2012-12-18 2015-07-01 Bayer Cropscience Ag BACTERICIDAL COMBINATIONS AND BINARY FUNGICIDES
UA118661C2 (en) 2012-12-19 2019-02-25 Монсанто Текнолоджи Ллс Plant regulatory elements and uses thereof
US9428459B2 (en) 2012-12-19 2016-08-30 Bayer Cropscience Ag Difluoromethyl-nicotinic- tetrahydronaphtyl carboxamides
US20150351390A1 (en) 2012-12-21 2015-12-10 Pioneer Hi-Bred International, Inc. Compositions and methods for auxin-analog conjugation
BR112015015975A2 (en) 2013-01-01 2018-11-06 A. B. Seeds Ltd. isolated dsrna molecules and methods of using them for silencing target molecules of interest.
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
US9247707B2 (en) * 2013-01-25 2016-02-02 Barenbrug Usa, Inc. Kentucky bluegrass variety named ‘Barvette’ selected for healthy turf
BR102013021210B1 (en) 2013-01-25 2015-12-01 Fundação Universidade Fed De São Carlos process of obtaining biopolymeric nanoparticles containing oil and azadirachta extracts indicates a. juss (neem), biopolymer nanoparticles and powder microparticles
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
NO2953942T3 (en) 2013-02-06 2018-03-24
AU2014214634A1 (en) 2013-02-11 2015-08-06 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and an insecticide
MX2015010313A (en) 2013-02-11 2015-11-18 Bayer Cropscience Lp Compositions comprising gougerotin and a biological control agent.
WO2014124369A1 (en) 2013-02-11 2014-08-14 Bayer Cropscience Lp Compositions comprising a streptomyces-based biological control agent and a fungicide
WO2014130661A1 (en) 2013-02-25 2014-08-28 Dow Agrosciences Llc Methods of weed control in pineapple
CN105705490A (en) 2013-03-07 2016-06-22 拜耳作物科学股份公司 Fungicidal 3-{phenyl[(heterocyclylmethoxy)imino]methyl}-heterocycle derivatives
JP2016516397A (en) 2013-03-07 2016-06-09 アテニックス・コーポレーションAthenix Corporaton Toxin genes and methods of use thereof
AU2014249015B2 (en) 2013-03-13 2020-04-16 Monsanto Technology Llc Methods and compositions for weed control
AU2014241045B2 (en) 2013-03-13 2017-08-31 Pioneer Hi-Bred International, Inc. Glyphosate application for weed control in brassica
UY35385A (en) 2013-03-13 2014-09-30 Monsanto Technology Llc ? METHODS AND COMPOSITIONS FOR WEED CONTROL ?.
CN105339380A (en) 2013-03-14 2016-02-17 先锋国际良种公司 Compositions and methods to control insect pests
US20140287419A1 (en) 2013-03-14 2014-09-25 Arzeda Corp. Compositions Having Dicamba Decarboxylase Activity and Methods of Use
US20160219823A1 (en) * 2013-03-14 2016-08-04 J.R. Simplot Company Turfgrass varieties having desirable looking turf when mowed infrequently
US9386755B2 (en) * 2013-03-14 2016-07-12 J.R. Simplot Company Turfgrass varieties having desirable looking turf when mowed infrequently
US20140283211A1 (en) 2013-03-14 2014-09-18 Monsanto Technology Llc Methods and Compositions for Plant Pest Control
BR112015023286A2 (en) 2013-03-14 2018-03-06 Arzeda Corp recombinant polypeptide with dicamba decarboxylase activity, polynucleotide construct, cell, method of producing a host cell comprising a heterologous polynucleotide encoding a dicamba decarboxylase activity, method for decarboxylating dicamba, a dicamba derivative or a dicamba metabolite, method for detecting a polypeptide and method for detecting the presence of a polynucleotide encoding a polypeptide having dicamba decarboxylase activity
WO2014160122A1 (en) 2013-03-14 2014-10-02 Pioneer Hi-Bred International, Inc. Maize stress related transcription factor 18 and uses thereof
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
MX360160B (en) 2013-03-15 2018-10-24 Pioneer Hi Bred Int PHI-4 POLYPEPTIDES and METHODS FOR THEIR USE.
US9730445B2 (en) 2013-03-15 2017-08-15 Dow Agrosciences Llc Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and fungicides
US8841234B1 (en) * 2013-03-15 2014-09-23 Dow Agrosciences, Llc. Herbicidal compositions comprising 4-amino-3-chloro-5-fluoro-6-(4-chloro-2-fluoro-3-methoxyphenyl) pyridine-2-carboxylic acid or a derivative thereof and fungicides
CA2903555A1 (en) 2013-03-15 2014-09-18 Pioneer Hi-Bred International, Inc. Compositions and methods of use of acc oxidase polynucleotides and polypeptides
US20160053274A1 (en) 2013-04-02 2016-02-25 Bayer Cropscience Nv Targeted genome engineering in eukaryotes
CA2909213A1 (en) 2013-04-12 2014-10-16 Bayer Cropscience Aktiengesellschaft Novel triazole derivatives
JP2016522800A (en) 2013-04-12 2016-08-04 バイエル・クロップサイエンス・アクチェンゲゼルシャフト New triazoline thione derivatives
EP2986117A1 (en) 2013-04-19 2016-02-24 Bayer CropScience Aktiengesellschaft Binary insecticidal or pesticidal mixture
CN105555135B (en) 2013-04-19 2018-06-15 拜耳作物科学股份公司 It is related to the method utilized for improvement to genetically modified plants production potential of phthaloyl amide derivatives application
TW201507722A (en) 2013-04-30 2015-03-01 Bayer Cropscience Ag N-(2-halogen-2-phenethyl)carboxamides as nematicides and endoparasiticides
WO2014177514A1 (en) 2013-04-30 2014-11-06 Bayer Cropscience Ag Nematicidal n-substituted phenethylcarboxamides
EP2801575A1 (en) 2013-05-07 2014-11-12 Bayer CropScience AG Heteroaryldihydropyridine derivatives as fungicides
WO2014206953A1 (en) 2013-06-26 2014-12-31 Bayer Cropscience Ag N-cycloalkyl-n-[(bicyclylphenyl)methylene]-(thio)carboxamide derivatives
AR096827A1 (en) 2013-07-09 2016-02-03 Bayer Cropscience Ag USE OF SELECTED PYRIDONCARBOXAMIDS OR ITS SALTS AS ACTIVE INGREDIENTS AGAINST ABIOTIC STRESS IN PLANTS
RU2703498C2 (en) 2013-07-19 2019-10-17 Монсанто Текнолоджи Ллс Compositions and methods for controlling leptinotarsa
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
EP2837287A1 (en) 2013-08-15 2015-02-18 Bayer CropScience AG Use of prothioconazole for increasing root growth of Brassicaceae
CA2920339C (en) 2013-08-16 2023-10-24 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
ES2776730T3 (en) 2013-09-13 2020-07-31 Pioneer Hi Bred Int Insecticidal proteins and methods for their use
EP3049517B1 (en) 2013-09-24 2018-04-11 Bayer CropScience NV Hetero-transglycosylase and uses thereof
EP3048887B1 (en) 2013-09-25 2020-06-03 Dow AgroSciences LLC Methods of weed control in chicory
US10602742B2 (en) * 2013-10-17 2020-03-31 Sumitomo Chemical Company, Limited Method for cultivating corn or soybean
AU2014341879B2 (en) 2013-11-04 2020-07-23 Beeologics, Inc. Compositions and methods for controlling arthropod parasite and pest infestations
CN105793243A (en) 2013-12-05 2016-07-20 拜耳作物科学股份公司 N-cycloalkyl-n-{[2-(1-substitutedcycloalkyl)phenyl]methylene}-(thio)carboxamide derivatives
TW201607929A (en) 2013-12-05 2016-03-01 拜耳作物科學公司 N-cycloalkyl-N-{[2-(1-substitutedcycloalkyl) phenyl]methylene}-(thio)carboxamide derivatives
UA119253C2 (en) 2013-12-10 2019-05-27 Біолоджикс, Інк. Compositions and methods for virus control in varroa mite and bees
US20160309708A1 (en) * 2013-12-11 2016-10-27 Oxiteno S.A. Indústria E Comércio Polycarboxylic acid ester alkyl derived from branched and straight alcohol of plant origin, and use of an alkyl ester in agrochemical formulations
TW201527312A (en) * 2013-12-31 2015-07-16 Dow Agrosciences Llc Novel maize ubiquitin promoters
TW201527314A (en) * 2013-12-31 2015-07-16 Dow Agrosciences Llc Novel maize ubiquitin promoters
TW201527313A (en) * 2013-12-31 2015-07-16 Dow Agrosciences Llc Novel maize ubiquitin promoters
AU2015206585A1 (en) 2014-01-15 2016-07-21 Monsanto Technology Llc Methods and compositions for weed control using EPSPS polynucleotides
CN106232620B (en) 2014-02-07 2022-05-13 先锋国际良种公司 Insecticidal proteins and methods of use thereof
RU2021113662A (en) 2014-02-07 2021-05-31 Пайонир Хай-Бред Интернэшнл, Инк. INSECTICIDE PROTEINS AND METHODS OF THEIR APPLICATION
EP3117003B1 (en) 2014-03-11 2019-10-30 BASF Agricultural Solutions Seed US LLC Hppd variants and methods of use
US10055700B2 (en) 2014-03-30 2018-08-21 Trimble Inc. Intelligent tool for collecting and managing data during manual harvesting of fruits and vegetables
WO2015153339A2 (en) 2014-04-01 2015-10-08 Monsanto Technology Llc Compositions and methods for controlling insect pests
WO2015160620A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and an insecticide
WO2015160619A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a fungicide
WO2015160618A1 (en) 2014-04-16 2015-10-22 Bayer Cropscience Lp Compositions comprising ningnanmycin and a biological control agent
WO2015164805A1 (en) * 2014-04-24 2015-10-29 Purdue Research Foundation Induced mutagenesis
AU2015280252A1 (en) 2014-06-23 2017-01-12 Monsanto Technology Llc Compositions and methods for regulating gene expression via RNA interference
US11807857B2 (en) 2014-06-25 2023-11-07 Monsanto Technology Llc Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression
WO2016000237A1 (en) 2014-07-03 2016-01-07 Pioneer Overseas Corporation Plants having enhanced tolerance to insect pests and related constructs and methods involving insect tolerance genes
AR101214A1 (en) 2014-07-22 2016-11-30 Bayer Cropscience Ag CIANO-CICLOALQUILPENTA-2,4-DIENOS, CIANO-CICLOALQUILPENT-2-EN-4-INAS, CIANO-HETEROCICLILPENTA-2,4-DIENOS AND CYANO-HETEROCICLILPENT-2-EN-4-INAS REPLACED AS ACTIVE PRINCIPLES PLANTS ABIOTIC
RU2021123470A (en) 2014-07-29 2021-09-06 Монсанто Текнолоджи Ллс COMPOSITIONS AND METHODS FOR COMBATING PESTS
CA2961733A1 (en) 2014-09-17 2016-03-24 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
EP3207143B1 (en) 2014-10-16 2023-11-22 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
US10266837B2 (en) 2014-10-22 2019-04-23 Temasek Life Sciences Laboratory Limited Terpene synthases from ylang ylang (Cananga odorata var. fruticosa)
AR103024A1 (en) 2014-12-18 2017-04-12 Bayer Cropscience Ag SELECTED PYRIDONCARBOXAMIDS OR ITS SALTS AS ACTIVE SUBSTANCES AGAINST ABIOTIC PLANTS STRESS
WO2016099916A1 (en) 2014-12-19 2016-06-23 E. I. Du Pont De Nemours And Company Polylactic acid compositions with accelerated degradation rate and increased heat stability
WO2016118762A1 (en) 2015-01-22 2016-07-28 Monsanto Technology Llc Compositions and methods for controlling leptinotarsa
MX2017011525A (en) 2015-03-11 2018-01-30 Pioneer Hi Bred Int Insecticidal combinations of pip-72 and methods of use.
CN107531676A (en) 2015-04-13 2018-01-02 拜耳作物科学股份公司 N cycloalkyl N (double heterocyclic radical ethylidene) (thio) carboxamide derivative
BR112017024948A2 (en) 2015-05-19 2018-07-31 Pioneer Hi Bred Int insecticide proteins and methods for their use
UY36703A (en) 2015-06-02 2016-12-30 Monsanto Technology Llc COMPOSITIONS AND METHODS FOR THE ADMINISTRATION OF A POLINUCLEOTIDE ON A PLANT
WO2016196782A1 (en) 2015-06-03 2016-12-08 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
WO2016205445A1 (en) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
JP6274161B2 (en) 2015-06-25 2018-02-07 トヨタ自動車株式会社 Drug-inducible promoter and gene expression induction method using the same
US11198709B2 (en) 2015-08-06 2021-12-14 E. I. Du Pont De Nemours And Company Plant derived insecticidal proteins and methods for their use
US10597674B2 (en) 2015-09-11 2020-03-24 Basf Agricultural Solutions Seed, Us Llc HPPD variants and methods of use
BR112018006543B1 (en) 2015-09-30 2022-04-05 Bayer Cropscience Aktiengesellschaft Use of isotianil for the control of French fries zebra
CN108575091A (en) 2015-12-18 2018-09-25 先锋国际良种公司 Insecticidal protein and its application method
US11274314B2 (en) * 2016-02-08 2022-03-15 Colorado Wheat Research Foundation, Inc. Herbicide safener combinations for acetyl co-enzyme a carboxylase herbicide resistant plants
WO2017178407A1 (en) 2016-04-13 2017-10-19 Bayer Cropscience Aktiengesellschaft Fungicidal combinations
CA3018384A1 (en) 2016-05-04 2017-11-09 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CN109312359A (en) 2016-06-16 2019-02-05 先锋国际良种公司 To prevent and treat the composition and method of insect pest
WO2018005411A1 (en) 2016-07-01 2018-01-04 Pioneer Hi-Bred International, Inc. Insecticidal proteins from plants and methods for their use
WO2018013333A1 (en) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
CA3032030A1 (en) 2016-07-29 2018-02-01 Bayer Cropscience Aktiengesellschaft Active compound combinations and methods to protect the propagation material of plants
AU2017305561B2 (en) 2016-08-05 2019-04-18 Ricetec, Inc. Methods and compositions for combinations of mutations associated with herbicide resistance/tolerance in rice
CN106148558B (en) * 2016-09-19 2019-08-02 山东农业大学 A kind of anti-sense molecule label of corn nicosulfuron and its application
CN109715621A (en) 2016-09-22 2019-05-03 拜耳作物科学股份公司 New triazole derivative
BR112019005660A2 (en) 2016-09-22 2019-06-04 Bayer Cropscience Ag new triazole derivatives and their use as fungicides
US20190225974A1 (en) 2016-09-23 2019-07-25 BASF Agricultural Solutions Seed US LLC Targeted genome optimization in plants
WO2018077711A2 (en) 2016-10-26 2018-05-03 Bayer Cropscience Aktiengesellschaft Use of pyraziflumid for controlling sclerotinia spp in seed treatment applications
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CA2985591C (en) * 2016-11-16 2023-08-01 Floratine Products Group, Inc. Method to use a colored photoluminescent composition in agricultural applications
US11091772B2 (en) 2016-11-23 2021-08-17 BASF Agricultural Solutions Seed US LLC AXMI669 and AXMI991 toxin genes and methods for their use
BR112019011616A2 (en) 2016-12-08 2019-10-22 Bayer Ag use of insecticides to control larvae
EP3332645A1 (en) 2016-12-12 2018-06-13 Bayer Cropscience AG Use of substituted pyrimidine diones or their salts as agents to combat abiotic plant stress
WO2018108627A1 (en) 2016-12-12 2018-06-21 Bayer Cropscience Aktiengesellschaft Use of substituted indolinylmethyl sulfonamides, or the salts thereof for increasing the stress tolerance of plants
CN110088123B (en) 2016-12-14 2023-10-20 先锋国际良种公司 Insecticidal proteins and methods of use thereof
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
KR20190095411A (en) 2016-12-22 2019-08-14 바스프 아그리컬쳐럴 솔루션즈 시드 유에스 엘엘씨 Use of CR14 for the control of nematode pests
US11286498B2 (en) 2017-01-18 2022-03-29 BASF Agricultural Solutions Seed US LLC Use of BP005 for the control of plant pathogens
UY37571A (en) 2017-01-18 2018-08-31 Bayer Cropscience Lp BP005 TOXIN GEN AND PROCEDURES FOR USE
BR112019016394A2 (en) 2017-02-08 2020-04-07 Pioneer Hi Bred Int DNA construct, molecular cell, breeding cell, transgenic plant or progeny thereof, composition and method for controlling an insect pest population
WO2018165091A1 (en) 2017-03-07 2018-09-13 Bayer Cropscience Lp Hppd variants and methods of use
BR112019023628A2 (en) 2017-05-11 2020-06-02 Pioneer Hi-Bred International, Inc. RECOMBINANT INSECTICIDE POLYPEPIDE, CHEMICAL INSECTICIDE PROTEIN, FUSION PROTEIN, AGRICULTURAL COMPOSITION, RECOMBINANT POLYNUCLEOTIDE, DNA BUILDING, TRANSGENIC PLANT, METHOD OF INHIBITING THE AGGREGATION OR EXERCISING AGAINST EXERCISE OR EXERCISE , METHOD TO CONTROL PEST INFESTATION AND METHOD TO IMPROVE THE PERFORMANCE OF A CULTURE
WO2019025153A1 (en) 2017-07-31 2019-02-07 Bayer Cropscience Aktiengesellschaft Use of substituted n-sulfonyl-n'-aryl diaminoalkanes and n-sulfonyl-n'-heteroaryl diaminoalkanes or salts thereof for increasing the stress tolerance in plants
AU2018335125B2 (en) 2017-09-19 2023-08-24 Bayer Aktiengesellschaft Use of Isotianil against Panama disease
WO2019083808A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to hppd inhibitors by down-regulation of putative 4-hydroxyphenylpyruvate reductases in soybean
WO2019083810A1 (en) 2017-10-24 2019-05-02 Basf Se Improvement of herbicide tolerance to 4-hydroxyphenylpyruvate dioxygenase (hppd) inhibitors by down-regulation of hppd expression in soybean
JP2021505660A (en) 2017-11-30 2021-02-18 ボラゲン,インコーポレーテッド Benzoxabolol compounds and their formulations
US20210002657A1 (en) 2018-03-02 2021-01-07 Pioneer Hi-Bred International, Inc. Plant health assay
US20210040569A1 (en) 2018-03-23 2021-02-11 Pioneer Hi-Bred International, Inc. Methods of identifying, selecting, and producing disease resistant crops
CN111988988A (en) 2018-04-18 2020-11-24 先锋国际良种公司 Method for identifying, selecting and producing bacterial blight resistant rice
WO2019233863A1 (en) 2018-06-04 2019-12-12 Bayer Aktiengesellschaft Herbicidally active bicyclic benzoylpyrazoles
MX2020013154A (en) 2018-06-06 2021-07-16 Univ Huazhong Agricultural Methods of identifying, selecting, and producing southern corn rust resistant crops.
WO2020020895A1 (en) 2018-07-26 2020-01-30 Bayer Aktiengesellschaft Use of the succinate dehydrogenase inhibitor fluopyram for controlling root rot complex and/or seedling disease complex caused by rhizoctonia solani, fusarium species and pythium species in brassicaceae species
WO2020041200A1 (en) 2018-08-18 2020-02-27 Boragen Inc. Solid forms of substituted benzoxaborole and compositions thereof
EP3844283A1 (en) 2018-08-29 2021-07-07 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CN109220774B (en) * 2018-09-12 2021-05-07 烟台市林业科学研究所 Chemical castration method for black pine
WO2020057939A1 (en) 2018-09-17 2020-03-26 Bayer Aktiengesellschaft Use of the fungicide isoflucypram for controlling claviceps purpurea and reducing sclerotia in cereals
US20220039383A1 (en) 2018-09-17 2022-02-10 Bayer Aktiengesellschaft Use of the Succinate Dehydrogenase Inhibitor Fluopyram for Controlling Claviceps Purpurea and Reducing Sclerotia in Cereals
US11109588B2 (en) 2019-02-19 2021-09-07 Gowan Company, L.L.C. Stable liquid formulations and methods of using the same
CN114341116A (en) 2019-07-22 2022-04-12 拜耳公司 5-amino-substituted pyrazoles and triazoles as pesticides
JP2022541807A (en) 2019-07-23 2022-09-27 バイエル・アクチエンゲゼルシヤフト Novel heteroaryl-triazole compounds as pesticides
AU2020317609A1 (en) 2019-07-23 2022-02-24 Bayer Aktiengesellschaft Novel heteroaryl-triazole compounds as pesticides
EP3701796A1 (en) 2019-08-08 2020-09-02 Bayer AG Active compound combinations
WO2021041077A1 (en) 2019-08-23 2021-03-04 Pioneer Hi-Bred International, Inc. Methods of identifying, selecting, and producing anthracnose stalk rot resistant crops
WO2021058659A1 (en) 2019-09-26 2021-04-01 Bayer Aktiengesellschaft Rnai-mediated pest control
WO2021064075A1 (en) 2019-10-02 2021-04-08 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
AR120176A1 (en) 2019-10-09 2022-02-02 Bayer Ag HETEROARYL-TRIAZOLE COMPOUNDS AS PESTICIDES
CN114867529A (en) 2019-10-09 2022-08-05 拜耳公司 Novel heteroaryl triazole compounds as pesticides
CN110656114B (en) * 2019-10-18 2022-07-01 云南中烟工业有限责任公司 Tobacco pigment synthesis related gene and application thereof
WO2021089673A1 (en) 2019-11-07 2021-05-14 Bayer Aktiengesellschaft Substituted sulfonyl amides for controlling animal pests
WO2021097162A1 (en) 2019-11-13 2021-05-20 Bayer Cropscience Lp Beneficial combinations with paenibacillus
WO2021099271A1 (en) 2019-11-18 2021-05-27 Bayer Aktiengesellschaft Active compound combinations comprising fatty acids
TW202134226A (en) 2019-11-18 2021-09-16 德商拜耳廠股份有限公司 Novel heteroaryl-triazole compounds as pesticides
TW202136248A (en) 2019-11-25 2021-10-01 德商拜耳廠股份有限公司 Novel heteroaryl-triazole compounds as pesticides
CN111153974A (en) 2020-01-15 2020-05-15 华中农业大学 Corn disease-resistant gene and molecular marker and application thereof
UY39058A (en) 2020-01-31 2021-08-31 Pairwise Plants Services Inc SUPPRESSION OF THE SHADOW EVASION RESPONSE IN PLANTS
CN111154748B (en) * 2020-02-06 2022-06-10 江南大学 Acetohydroxy acid synthase mutant for improving L-isoleucine synthesis purity
EP4107151A1 (en) 2020-02-18 2022-12-28 Bayer Aktiengesellschaft Heteroaryl-triazole compounds as pesticides
EP3708565A1 (en) 2020-03-04 2020-09-16 Bayer AG Pyrimidinyloxyphenylamidines and the use thereof as fungicides
BR112022020714A2 (en) 2020-04-15 2022-12-20 Pioneer Hi Bred Int IDENTIFICATION OF PLANT PATHOGEN EFFECTOR GENE AND DISEASE RESISTANCE, COMPOSITIONS AND USE METHODS
WO2021209490A1 (en) 2020-04-16 2021-10-21 Bayer Aktiengesellschaft Cyclaminephenylaminoquinolines as fungicides
CN115697045A (en) 2020-04-16 2023-02-03 成对植物服务股份有限公司 Method for controlling meristem size to improve crop plants
AU2021260029A1 (en) 2020-04-21 2022-11-24 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocyclic derivatives as pest control agents
JP2023538713A (en) 2020-05-06 2023-09-11 バイエル、アクチエンゲゼルシャフト Pyridine(thio)amide as a fungicidal compound
TW202208347A (en) 2020-05-06 2022-03-01 德商拜耳廠股份有限公司 Novel heteroaryl-triazole compounds as pesticides
US20230180756A1 (en) 2020-05-12 2023-06-15 Bayer Aktiengesellschaft Triazine and pyrimidine (thio)amides as fungicidal compounds
BR112022023550A2 (en) 2020-05-19 2023-01-03 Bayer Cropscience Ag AZABICYCLIC (THIO)AMIDES AS FUNGICIDAL COMPOUNDS
CN116096230A (en) 2020-06-02 2023-05-09 成对植物服务股份有限公司 Method for controlling meristem size to improve crops
WO2021245087A1 (en) 2020-06-04 2021-12-09 Bayer Aktiengesellschaft Heterocyclyl pyrimidines and triazines as novel fungicides
BR112022024413A2 (en) 2020-06-10 2023-02-07 Bayer Ag HETEROCYCLES SUBSTITUTED WITH AZABICYCLYL AS INNOVATIVE FUNGICIDES
UY39278A (en) 2020-06-17 2022-01-31 Pairwise Plants Services Inc MERISTEM SIZE CONTROL METHODS FOR CROP IMPROVEMENT
CN116157017A (en) 2020-06-18 2023-05-23 拜耳公司 3- (pyridazin-4-yl) -5, 6-dihydro-4H-1, 2, 4-oxadiazine derivatives as fungicides for crop protection
BR112022025344A2 (en) 2020-06-18 2023-01-03 Bayer Ag COMPOSITION FOR USE IN AGRICULTURE
WO2021255089A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazole pyrimidines and 1,3,4-oxadiazole pyridines as fungicides
UY39276A (en) 2020-06-19 2022-01-31 Bayer Ag USE OF 1,3,4-OXADIAZOL-2-ILPYRIMIDINE COMPOUNDS TO CONTROL PHYTOPATHOGENIC MICROORGANISMS, METHODS OF USE AND COMPOSITIONS.
UY39275A (en) 2020-06-19 2022-01-31 Bayer Ag 1,3,4-OXADIAZOLE PYRIMIDINES AS FUNGICIDES, PROCESSES AND INTERMEDIARIES FOR THEIR PREPARATION, METHODS OF USE AND USES OF THE SAME
WO2021255091A1 (en) 2020-06-19 2021-12-23 Bayer Aktiengesellschaft 1,3,4-oxadiazoles and their derivatives as fungicides
EP3929189A1 (en) 2020-06-25 2021-12-29 Bayer Animal Health GmbH Novel heteroaryl-substituted pyrazine derivatives as pesticides
BR112022026904A2 (en) 2020-07-02 2023-01-24 Bayer Ag HETEROCYCLENE DERIVATIVES AS PEST CONTROL AGENTS
US20230235352A1 (en) 2020-07-14 2023-07-27 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2022033991A1 (en) 2020-08-13 2022-02-17 Bayer Aktiengesellschaft 5-amino substituted triazoles as pest control agents
WO2022040510A1 (en) 2020-08-21 2022-02-24 Bayer Cropscience Lp Combinations of trichoderma and bradyrhizobium
WO2022053453A1 (en) 2020-09-09 2022-03-17 Bayer Aktiengesellschaft Azole carboxamide as pest control agents
WO2022058327A1 (en) 2020-09-15 2022-03-24 Bayer Aktiengesellschaft Substituted ureas and derivatives as new antifungal agents
EP3974414A1 (en) 2020-09-25 2022-03-30 Bayer AG 5-amino substituted pyrazoles and triazoles as pesticides
EP3915971A1 (en) 2020-12-16 2021-12-01 Bayer Aktiengesellschaft Phenyl-s(o)n-phenylamidines and the use thereof as fungicides
WO2022129190A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft (hetero)aryl substituted 1,2,4-oxadiazoles as fungicides
WO2022129196A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft Heterobicycle substituted 1,2,4-oxadiazoles as fungicides
JP2023554063A (en) 2020-12-18 2023-12-26 バイエル・アクチエンゲゼルシヤフト Use of DHODH inhibitors to control resistant phytopathogenic fungi in crops
WO2022129188A1 (en) 2020-12-18 2022-06-23 Bayer Aktiengesellschaft 1,2,4-oxadiazol-3-yl pyrimidines as fungicides
EP4036083A1 (en) 2021-02-02 2022-08-03 Bayer Aktiengesellschaft 5-oxy substituted heterocycles as pesticides
US20220259612A1 (en) 2021-02-11 2022-08-18 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin oxidase levels in plants
WO2022182834A1 (en) 2021-02-25 2022-09-01 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture in plants
WO2022207494A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2022207496A1 (en) 2021-03-30 2022-10-06 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
CN115216554A (en) 2021-04-16 2022-10-21 华中农业大学 Plant pathogen effector and disease resistance gene identification, compositions, and methods of use
KR20240005019A (en) 2021-05-06 2024-01-11 바이엘 악티엔게젤샤프트 Alkylamide substituted, cyclic imidazoles and their use as pesticides
WO2022238391A1 (en) 2021-05-12 2022-11-17 Bayer Aktiengesellschaft 2-(het)aryl-substituted condensed heterocycle derivatives as pest control agents
US20220411813A1 (en) 2021-06-17 2022-12-29 Pairwise Plants Services, Inc. Modification of growth regulating factor family transcription factors in soybean
KR102307187B1 (en) * 2021-06-17 2021-10-01 주식회사 명주산업 Eco-friendly herbicide composition having sterilization and insecticidal effect and weed removal method using same
UY39827A (en) 2021-06-24 2023-01-31 Pairwise Plants Services Inc MODIFICATION OF UBIQUITIN LIGASE E3 HECT GENES TO IMPROVE PERFORMANCE TRAITS
WO2023278651A1 (en) 2021-07-01 2023-01-05 Pairwise Plants Services, Inc. Methods and compositions for enhancing root system development
WO2023012342A1 (en) 2021-08-06 2023-02-09 Kws Vegetables B.V. Durable downy mildew resistance in spinach
US20230078990A1 (en) 2021-08-12 2023-03-16 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
KR20240039209A (en) 2021-08-13 2024-03-26 바이엘 악티엔게젤샤프트 Active compound combinations and fungicide compositions comprising the same
US20230063927A1 (en) 2021-08-17 2023-03-02 Pairwise Plants Services, Inc. Methods and compositions for modifying cytokinin receptor histidine kinase genes in plants
IL310966A (en) 2021-08-25 2024-04-01 Bayer Ag Novel pyrazinyl-triazole compounds as pesticides
CA3230167A1 (en) 2021-08-30 2023-03-09 Pairwise Plants Services, Inc. Modification of ubiquitin binding peptidase genes in plants for yield trait improvement
AR126938A1 (en) 2021-09-02 2023-11-29 Pairwise Plants Services Inc METHODS AND COMPOSITIONS TO IMPROVE PLANT ARCHITECTURE AND PERFORMANCE TRAITS
EP4144739A1 (en) 2021-09-02 2023-03-08 Bayer Aktiengesellschaft Anellated pyrazoles as parasiticides
WO2023049720A1 (en) 2021-09-21 2023-03-30 Pairwise Plants Services, Inc. Methods and compositions for reducing pod shatter in canola
US20230108968A1 (en) 2021-10-04 2023-04-06 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
WO2023060152A2 (en) 2021-10-07 2023-04-13 Pairwise Plants Services, Inc. Methods for improving floret fertility and seed yield
WO2023078915A1 (en) 2021-11-03 2023-05-11 Bayer Aktiengesellschaft Bis(hetero)aryl thioether (thio)amides as fungicidal compounds
WO2023099445A1 (en) 2021-11-30 2023-06-08 Bayer Aktiengesellschaft Bis(hetero)aryl thioether oxadiazines as fungicidal compounds
AR127904A1 (en) 2021-12-09 2024-03-06 Pairwise Plants Services Inc METHODS TO IMPROVE FLOWER FERTILITY AND SEED YIELD
WO2023147526A1 (en) 2022-01-31 2023-08-03 Pairwise Plants Services, Inc. Suppression of shade avoidance response in plants
WO2023148035A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in rice
WO2023148028A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests
WO2023148036A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in soybean
WO2023148031A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in cotton
WO2023148029A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in cereals
WO2023148030A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in corn
WO2023148033A1 (en) 2022-02-01 2023-08-10 Globachem Nv Methods and compositions for controlling pests in oilseed rape
WO2023168217A1 (en) 2022-03-02 2023-09-07 Pairwise Plants Services, Inc. Modification of brassinosteroid receptor genes to improve yield traits
WO2023192838A1 (en) 2022-03-31 2023-10-05 Pairwise Plants Services, Inc. Early flowering rosaceae plants with improved characteristics
WO2023196886A1 (en) 2022-04-07 2023-10-12 Pairwise Plants Services, Inc. Methods and compositions for improving resistance to fusarium head blight
WO2023205714A1 (en) 2022-04-21 2023-10-26 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
US20230348922A1 (en) 2022-05-02 2023-11-02 Pairwise Plants Services, Inc. Methods and compositions for enhancing yield and disease resistance
WO2023213670A1 (en) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Crystalline forms of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine
WO2023213626A1 (en) 2022-05-03 2023-11-09 Bayer Aktiengesellschaft Use of (5s)-3-[3-(3-chloro-2-fluorophenoxy)-6-methylpyridazin-4-yl]-5-(2-chloro-4-methylbenzyl)-5,6-dihydro-4h-1,2,4-oxadiazine for controlling unwanted microorganisms
WO2023215809A1 (en) 2022-05-05 2023-11-09 Pairwise Plants Services, Inc. Methods and compositions for modifying root architecture and/or improving plant yield traits
US20230416771A1 (en) 2022-06-27 2023-12-28 Pairwise Plants Services, Inc. Methods and compositions for modifying shade avoidance in plants
US20240002873A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024006791A1 (en) 2022-06-29 2024-01-04 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
WO2024030984A1 (en) 2022-08-04 2024-02-08 Pairwise Plants Services, Inc. Methods and compositions for improving yield traits
WO2024036240A1 (en) 2022-08-11 2024-02-15 Pairwise Plants Services, Inc. Methods and compositions for controlling meristem size for crop improvement
US20240090466A1 (en) 2022-09-08 2024-03-21 Pairwise Plants Services, Inc. Methods and compositions for improving yield characteristics in plants
WO2024068517A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
EP4295688A1 (en) 2022-09-28 2023-12-27 Bayer Aktiengesellschaft Active compound combination
WO2024068518A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-heteroaryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068520A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide
WO2024068519A1 (en) 2022-09-28 2024-04-04 Bayer Aktiengesellschaft 3-(hetero)aryl-5-chlorodifluoromethyl-1,2,4-oxadiazole as fungicide

Family Cites Families (113)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4535060A (en) * 1983-01-05 1985-08-13 Calgene, Inc. Inhibition resistant 5-enolpyruvyl-3-phosphoshikimate synthetase, production and use
US4658093A (en) * 1983-07-11 1987-04-14 Hellman Martin E Software distribution system
EP0189707B1 (en) * 1984-12-28 1993-08-25 Plant Genetic Systems N.V. Recombinant dna which can be introduced into plant cells
US4685131A (en) * 1985-03-11 1987-08-04 General Instrument Corp. Program blocking method for use in direct broadcast satellite system
US4940835A (en) * 1985-10-29 1990-07-10 Monsanto Company Glyphosate-resistant plants
DE3687682T2 (en) 1985-08-07 1993-08-19 Monsanto Co GLYPHOSATE RESISTANT PLANTS.
US4822146A (en) * 1986-04-07 1989-04-18 Canon Kabushiki Kaisha Optical modulation element
IL83348A (en) * 1986-08-26 1995-12-08 Du Pont Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
US5378824A (en) * 1986-08-26 1995-01-03 E. I. Du Pont De Nemours And Company Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
US5605011A (en) * 1986-08-26 1997-02-25 E. I. Du Pont De Nemours And Company Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
US5013659A (en) * 1987-07-27 1991-05-07 E. I. Du Pont De Nemours And Company Nucleic acid fragment encoding herbicide resistant plant acetolactate synthase
US5010571A (en) * 1986-09-10 1991-04-23 Titan Linkabit Corporation Metering retrieval of encrypted data stored in customer data retrieval terminal
US4971908A (en) * 1987-05-26 1990-11-20 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5312910A (en) * 1987-05-26 1994-05-17 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthase
US5145783A (en) 1987-05-26 1992-09-08 Monsanto Company Glyphosate-tolerant 5-endolpyruvyl-3-phosphoshikimate synthase
US4999806A (en) * 1987-09-04 1991-03-12 Fred Chernow Software distribution system
US4868877A (en) * 1988-02-12 1989-09-19 Fischer Addison M Public key/signature cryptosystem with enhanced digital signature certification
US5084082A (en) * 1988-09-22 1992-01-28 E. I. Du Pont De Nemours And Company Soybean plants with dominant selectable trait for herbicide resistance
US5310667A (en) 1989-07-17 1994-05-10 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5097025A (en) 1989-08-01 1992-03-17 The Rockefeller University Plant promoters
US5138712A (en) * 1989-10-02 1992-08-11 Sun Microsystems, Inc. Apparatus and method for licensing software on a network of computers
DE3938937A1 (en) * 1989-11-24 1991-05-29 Wacker Chemitronic METHOD AND DEVICE FOR PRODUCING SILICON RODS WITH A HIGH OXYGEN CONTENT BY PULLING ZONE-FREE, THROUGH AVAILABLE SILICON RODS AND THE SILICONE DISC MADE THEREOF
AU655197B2 (en) * 1990-06-25 1994-12-08 Monsanto Technology Llc Glyphosate tolerant plants
US5058162A (en) * 1990-08-09 1991-10-15 Hewlett-Packard Company Method of distributing computer data files
US5633435A (en) 1990-08-31 1997-05-27 Monsanto Company Glyphosate-tolerant 5-enolpyruvylshikimate-3-phosphate synthases
US5866775A (en) 1990-09-28 1999-02-02 Monsanto Company Glyphosate-tolerant 5-enolpyruvyl-3-phosphoshikimate synthases
US5599769A (en) * 1990-11-13 1997-02-04 Hoechst Aktiengesellschaft Synergistic herbicidal compositions comprising glyphosate or glufosinate in combination with a sulfonylurea herbicide
JPH0799497B2 (en) * 1990-12-14 1995-10-25 インターナショナル・ビジネス・マシーンズ・コーポレイション Device and method for controlling the use of software
FR2673642B1 (en) * 1991-03-05 1994-08-12 Rhone Poulenc Agrochimie CHIMERIC GENE COMPRISING A PROMOTER CAPABLE OF GIVING INCREASED TOLERANCE TO GLYPHOSATE.
FR2673643B1 (en) * 1991-03-05 1993-05-21 Rhone Poulenc Agrochimie TRANSIT PEPTIDE FOR THE INSERTION OF A FOREIGN GENE INTO A PLANT GENE AND PLANTS TRANSFORMED USING THIS PEPTIDE.
US5237614A (en) * 1991-06-07 1993-08-17 Security Dynamics Technologies, Inc. Integrated network security system
US5731180A (en) 1991-07-31 1998-03-24 American Cyanamid Company Imidazolinone resistant AHAS mutants
NZ243778A (en) * 1991-08-02 1994-02-25 Monsanto Co Herbicidal composition comprising glyphosate, an alkyl polyglycoside and
US5521815A (en) * 1992-01-31 1996-05-28 K.L.E. Irrevocable Trust Uniform system for verifying and tracking articles of value
US5276735A (en) * 1992-04-17 1994-01-04 Secure Computing Corporation Data enclave and trusted path system
US5235642A (en) * 1992-07-21 1993-08-10 Digital Equipment Corporation Access control subsystem and method for distributed computer system using locally cached authentication credentials
AU687961B2 (en) * 1993-11-19 1998-03-05 Biotechnology Research And Development Corporation Chimeric regulatory regions and gene cassettes for expression of genes in plants
EP0734556B1 (en) * 1993-12-16 2002-09-04 Open Market, Inc. Network based payment system and method for using such system
EP0736203A1 (en) * 1993-12-23 1996-10-09 Diacom Technologies, Inc. Method and apparatus for implementing user feedback
US5608147A (en) * 1994-01-11 1997-03-04 Kaphammer; Bryan J. tfdA gene selectable markers in plants and the use thereof
US5509074A (en) * 1994-01-27 1996-04-16 At&T Corp. Method of protecting electronically published materials using cryptographic protocols
US5505461A (en) * 1994-04-19 1996-04-09 Caesars World, Inc. Method for meeting IRS reporting requirements related to an electronic gaming machine
US5563946A (en) * 1994-04-25 1996-10-08 International Business Machines Corporation Method and apparatus for enabling trial period use of software products: method and apparatus for passing encrypted files between data processing systems
JP3638309B2 (en) * 1994-06-23 2005-04-13 株式会社シマノ Bicycle hub brake
CZ11597A3 (en) * 1994-07-19 1997-09-17 Bankers Trust Co Method of safe use of digital designation in a commercial coding system
DE69534757T2 (en) * 1994-09-15 2006-08-31 International Business Machines Corp. System and method for secure storage and distribution of data using digital signatures
US5717923A (en) * 1994-11-03 1998-02-10 Intel Corporation Method and apparatus for dynamically customizing electronic information to individual end users
US5630131A (en) * 1994-11-14 1997-05-13 Object Technology Licensing Corp. Method and apparatus for importing and exporting archive files for a graphical user interface
JPH08263438A (en) * 1994-11-23 1996-10-11 Xerox Corp Distribution and use control system of digital work and access control method to digital work
US5629980A (en) * 1994-11-23 1997-05-13 Xerox Corporation System for controlling the distribution and use of digital works
US6367013B1 (en) * 1995-01-17 2002-04-02 Eoriginal Inc. System and method for electronic transmission, storage, and retrieval of authenticated electronic original documents
US5677955A (en) * 1995-04-07 1997-10-14 Financial Services Technology Consortium Electronic funds transfer instruments
NZ305278A (en) 1995-04-10 1999-02-25 Monsanto Co Herbicidal compositions comprising glyphosate and an etheramine surfactant
ZA964248B (en) * 1995-06-23 1997-11-27 Du Pont Uniform mixtures of pesticidal granules.
FR2736926B1 (en) 1995-07-19 1997-08-22 Rhone Poulenc Agrochimie 5-ENOL PYRUVYLSHIKIMATE-3-PHOSPHATE SYNTHASE MUTEE, CODING GENE FOR THIS PROTEIN AND PROCESSED PLANTS CONTAINING THIS GENE
JP2000503154A (en) * 1996-01-11 2000-03-14 エムアールジェイ インコーポレイテッド System for controlling access and distribution of digital ownership
UA50765C2 (en) * 1996-03-29 2002-11-15 Монсанто Ероп С.А. Method of raising yield of agricultural crops resistant to glyphosate
US6072050A (en) 1996-06-11 2000-06-06 Pioneer Hi-Bred International, Inc. Synthetic promoters
US5727920A (en) * 1996-07-19 1998-03-17 Hull, Deceased; Harold Lawrence Vertical lift towing dolly including variable, attachable platforms
US5821195A (en) * 1996-08-16 1998-10-13 Monsanto Company Sequential application method for enhancing glyphosate herbicidal effectiveness with reduced antagonism
CN1233934A (en) 1996-08-16 1999-11-03 孟山都公司 Sequential application method for treating plants with exogenous chemicals
HUP9903889A3 (en) * 1996-10-25 2004-07-28 Monsanto Technology Llc St Louis Composition and method for treating plants with exogenous chemicals
US20030041357A1 (en) * 1996-11-07 2003-02-27 Zeneca Limited Herbicide resistant plants
US6376754B1 (en) * 1997-03-07 2002-04-23 Asgrow Seed Company Plants having resistance to multiple herbicides and its use
US7022896B1 (en) * 1997-04-04 2006-04-04 Board Of Regents Of University Of Nebraska Methods and materials for making and using transgenic dicamba-degrading organisms
AU746589B2 (en) 1997-07-30 2002-05-02 Monsanto Company Process and compositions promoting biological effectiveness of exogenous chemical substances in plants
DE19754929A1 (en) * 1997-12-10 1999-06-17 Hoechst Schering Agrevo Gmbh Process for the production of transgenic plants with modified 5-aminolevulinic acid biosynthesis and process for the identification of effectors of 5-aminolevulinic acid synthesis
AU759037B2 (en) * 1998-03-06 2003-04-03 Syngenta Mogen Bv Method for the induction of pathogen resistance in plants
DE69908313T2 (en) 1998-03-09 2004-04-29 Monsanto Technology Llc. MIXTURES FOR WEED CONTROL IN GLYPHOSATE TOLERANT SOYBEANS
US5914451A (en) * 1998-04-06 1999-06-22 Monsanto Company Efficiency soybean transformation protocol
BR9910174A (en) 1998-05-01 2001-03-06 Maxygen Inc Process for obtaining an optimized recombinant gene for pest resistance, library, and process for obtaining an organism that is pathogenic to a vegetable pest
CN101176453B (en) 1998-06-16 2015-05-27 巴斯福股份公司 Synergistically acting herbicidal mixtures
JP2002520818A (en) * 1998-07-02 2002-07-09 アストロパワー Silicon thin film, integrated solar cell, module, and method of manufacturing the same
AU5482299A (en) 1998-08-12 2000-03-06 Maxygen, Inc. Dna shuffling to produce herbicide selective crops
US6333449B1 (en) 1998-11-03 2001-12-25 Plant Genetic Systems, N.V. Glufosinate tolerant rice
WO2000029596A1 (en) * 1998-11-17 2000-05-25 Monsanto Company Phosphonate metabolizing plants
ATE285680T1 (en) * 1998-11-30 2005-01-15 Flamel Tech Sa PROMOTION OF THE BIOLOGICAL EFFECTIVENESS OF EXOGENEOUS CHEMICAL SUBSTANCES IN PLANTS
RU2235778C2 (en) 1999-04-29 2004-09-10 Синджента Лимитед Isolated polynucleotide able to confer to plant resistance or tolerance to glyfosate herbicide, vector, method for preparing plants with tolerance or resistance to glyfosate herbicide, method for regeneration of transformed plant and method for selective control of weeds
ATE330015T1 (en) 1999-04-29 2006-07-15 Syngenta Ltd HERBICIDE RESISTANT PLANTS
CZ20013859A3 (en) 1999-04-29 2002-04-17 Syngenta Ltd. Plants resistant to herbicides
JP2003523173A (en) 1999-04-29 2003-08-05 シンジェンタ リミテッド Herbicide-tolerant plants
US6369001B1 (en) * 1999-08-11 2002-04-09 Monsanto Technology, Llc Microemulsion coformulation of a graminicide and a water-soluble herbicide
US6908882B1 (en) * 1999-09-09 2005-06-21 Monsanto Company Enhanced method of killing weeds with glyphosate herbicide
US6842863B1 (en) * 1999-11-23 2005-01-11 Microsoft Corporation Certificate reissuance for checking the status of a certificate in financial transactions
CA2401093A1 (en) 2000-03-09 2001-09-13 Monsanto Technology Llc Methods for making plants tolerant to glyphosate and compositions thereof
EP2266390A3 (en) * 2000-03-09 2011-04-20 E. I. du Pont de Nemours and Company Sulfonylurea-tolerant sunflower plants
US6943280B2 (en) * 2000-05-10 2005-09-13 Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College Resistance to acetohydroxycid synthase-inhibiting herbicides
DE10022989A1 (en) * 2000-05-11 2001-11-22 Aventis Cropscience Gmbh Use of enveloped agrochemical, especially herbicide, safener, growth regulator, insecticide or fungicide, for suppression of antagonistic interactions in agrochemical mixtures
BRPI0100752B1 (en) * 2000-06-22 2015-10-13 Monsanto Co DNA Molecules and Pairs of Molecules, Processes for Detecting DNA Molecules and for Creating a Glyphosate Tolerant Trait in Corn Plants, as well as DNA Detection Kit
AU2001293798B2 (en) 2000-09-09 2006-12-21 Basf Plant Science Gmbh Modified tet-inducible system for regulation of gene expression in plants
EP1355931A2 (en) 2000-10-06 2003-10-29 Novozymes Biotech, Inc. Methods for monitoring multiple gene expression
JP2004534505A (en) * 2000-10-30 2004-11-18 マキシジェン, インコーポレイテッド Novel glyphosate N-acetyltransferase (GAT) gene
US20090011938A1 (en) * 2000-10-30 2009-01-08 Pioneer Hi--Bred International, Inc. Novel glyphosate-n-acetyltransferase (gat) genes
US7462481B2 (en) * 2000-10-30 2008-12-09 Verdia, Inc. Glyphosate N-acetyltransferase (GAT) genes
PT1347056E (en) * 2000-11-29 2008-09-15 Kumiai Chemical Industry Co Gene encoding acetolactate synthase
US7356690B2 (en) * 2000-12-11 2008-04-08 International Business Machines Corporation Method and system for managing a distributed trust path locator for public key certificates relating to the trust path of an X.509 attribute certificate
US7687434B2 (en) * 2000-12-22 2010-03-30 Monsanto Technology, Llc Method of improving yield and vigor of plants
US7395430B2 (en) * 2001-08-28 2008-07-01 International Business Machines Corporation Secure authentication using digital certificates
US20020144108A1 (en) * 2001-03-29 2002-10-03 International Business Machines Corporation Method and system for public-key-based secure authentication to distributed legacy applications
WO2002092856A1 (en) 2001-05-15 2002-11-21 Monsanto Technology Llc A method of selecting dna constructs for herbicide tolerance in plants
AU2003224032A1 (en) * 2002-04-03 2003-10-13 Syngenta Participations Ag Herbicidal composition comprising phenylpropynyloxypyridine compounds
AU2003234328A1 (en) 2002-04-30 2003-11-17 Pioneer Hi-Bred International, Inc. Novel glyphosate-n-acetyltransferase (gat) genes
US20040023802A1 (en) * 2002-05-16 2004-02-05 Monsanto Technology, L.L.C. Increasing plant yield and/or vigor by seed treatment with a neonicotinoid compound
BRPI0409816B8 (en) 2003-04-29 2022-12-06 Pioneer Hi Bred Int GLYPHOSATE-N-ACETYLTRANSFERASE (GAT) GENES, CONSTRUCTS COMPRISING THEM, BACTERIAL CELL, POLYPEPTIDE HAVING GAT ACTIVITY, AS WELL AS METHOD FOR PRODUCING A TRANSGENIC PLANT RESISTANT TO GLYPHOSATE AND METHODS FOR CONTROLLING WEEDS IN A FIELD CONTAINING A CROP
BRPI0416159A (en) 2003-11-03 2007-01-16 Bayer Cropscience Gmbh herbicidal efficacy agent
WO2005069986A2 (en) * 2004-01-20 2005-08-04 Monsanto Technology Llc Chimeric promoters for use in plants
US7405074B2 (en) * 2004-04-29 2008-07-29 Pioneer Hi-Bred International, Inc. Glyphosate-N-acetyltransferase (GAT) genes
SI2308977T2 (en) 2004-04-30 2017-07-31 Dow Agrosciences Llc Novel herbicide resistance gene
EP2230247B1 (en) * 2004-07-02 2013-05-29 Pioneer-Hi-Bred International, Inc. Antifungal polypeptides
US7496887B2 (en) * 2005-03-01 2009-02-24 International Business Machines Corporation Integration of data management operations into a workflow system
WO2007024782A2 (en) * 2005-08-24 2007-03-01 Pioneer Hi-Bred International, Inc. Compositions providing tolerance to multiple herbicides and methods of use thereof
CN1313614C (en) 2005-10-17 2007-05-02 中国农业科学院生物技术研究所 Glyphosate acetyl transferase gene and its application
US7928296B2 (en) 2006-10-30 2011-04-19 Pioneer Hi-Bred International, Inc. Maize event DP-098140-6 and compositions and methods for the identification and/or detection thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7803992B2 (en) 2005-08-24 2010-09-28 Pioneer Hi-Bred International, Inc. Methods and compositions for expressing an herbicide-tolerant polynucleotide
US10329578B2 (en) 2013-10-18 2019-06-25 Pioneer Hi-Bred International, Inc. Glyphosate-N-acetyltransferase (GLYAT) sequences and methods of use
US11236354B2 (en) 2013-10-18 2022-02-01 Pioneer Hi-Bred International, Inc. Glyphosate-n-acetyltransferase (GLYAT) sequences and methods of use
EP3090046A4 (en) * 2013-12-31 2017-06-21 Dow AgroSciences LLC Novel maize ubiquitin promoters

Also Published As

Publication number Publication date
RS20080076A (en) 2009-07-15
CA2625371C (en) 2012-06-26
EP1931791A2 (en) 2008-06-18
KR20080052606A (en) 2008-06-11
CA2620002C (en) 2012-04-10
BRPI0615087A2 (en) 2011-05-03
WO2007024866A3 (en) 2007-06-21
MX2008002615A (en) 2008-03-14
AR055128A1 (en) 2007-08-08
CA2625371A1 (en) 2007-03-01
US20070130641A1 (en) 2007-06-07
ATE544861T1 (en) 2012-02-15
US20070074303A1 (en) 2007-03-29
US7973218B2 (en) 2011-07-05
UY29761A1 (en) 2007-03-30
JP2009505654A (en) 2009-02-12
EP1917360A2 (en) 2008-05-07
TW200730625A (en) 2007-08-16
EA201000757A1 (en) 2010-12-30
MA29777B1 (en) 2008-09-01
US20130288898A1 (en) 2013-10-31
CA2620002A1 (en) 2007-03-01
CR9757A (en) 2008-05-09
US20080234130A1 (en) 2008-09-25
CL2009001635A1 (en) 2009-12-11
WO2007024782A3 (en) 2007-08-09
US20070061917A1 (en) 2007-03-15
ECSP088304A (en) 2008-04-28
EA200800622A1 (en) 2008-08-29
AU2006283504A1 (en) 2007-03-01
AU2006283504B2 (en) 2011-08-25
NZ568867A (en) 2010-12-24
US20070079393A1 (en) 2007-04-05
US20120157308A1 (en) 2012-06-21
US7803992B2 (en) 2010-09-28
MX2008002616A (en) 2008-03-14
US8203033B2 (en) 2012-06-19
BRPI0615088A2 (en) 2009-07-14
US20090264290A1 (en) 2009-10-22
AR057091A1 (en) 2007-11-14
US7622641B2 (en) 2009-11-24
WO2007024782A2 (en) 2007-03-01
AP2008004392A0 (en) 2008-04-30
MEP3508A (en) 2010-02-10
EP1931791B1 (en) 2012-02-08

Similar Documents

Publication Publication Date Title
CA2620002C (en) Methods and compositions for the expression of a polynucleotide of interest
US11512321B2 (en) Methods and compositions for the introduction and regulated expression of genes in plants
US8058509B2 (en) Methods and compositions for in planta production of inverted repeats
US7868224B2 (en) Compositions and methods for increasing plant tolerance to high population density
US9163233B2 (en) Compositions and methods for modulating expression of gene products
CN101410524A (en) Methods and compositions for expressing an herbicide-tolerant polynucleotide
US7714187B2 (en) Phytate polynucleotides and methods of use
CA2832639A1 (en) Methods and compositions for silencing gene families using artificial micrornas
WO2009000848A1 (en) Yield enhancement in plants by modulation of zmago1
EP2148927A1 (en) Yield enhancement in plants by modulation of zmpkt
MXPA02007049A (en) Novel plant promoters and methods of use.
US20130111634A1 (en) Methods and compositions for silencing genes using artificial micrornas
WO2008135603A2 (en) Over-expression of maize cox viia subunit for enhanced yield
WO2008148896A1 (en) Yield enhancement in plants by modulation of maize mads box transcription factor silky1
US20110078826A1 (en) Yield enhancement in plants by modulation of a zm-eref-ts protein
WO2010123667A1 (en) Yield enhancement in plants by modulation of a maize transcription coactivator p15 (pc4) protein

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200680039195.4

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 543/KOLNP/2008

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2620002

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/a/2008/002615

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2006836107

Country of ref document: EP

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 06836107

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: PI0615087

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20080225