WO2007070482A2 - Microarray-based preimplantation genetic diagnosis of chromosomal abnormalities - Google Patents

Abstract

This invention describes a method to analyze chromosomal abnormalities in a single cell or a few cells for preimplantation genetic research and diagnosis. The method also applies to other applications using single cells such as stem cell and transformed cell research and diagnosis and cancer diagnosis. The invention uses genome amplification along with genome labeling and/or specific gene labeling techniques. The amplified genetic material is detected on microarray platforms in various formats. The invention features multiplexing assays and detection of multiple types of chromosomal abnormalities.

Description

XIA -OOlPCT

METHOD OF DETECTING CHROMOSOMAL ABNORMALITIES USING MICROARRAYS FOR PREIMPLANTATION GENETIC DIAGNOSIS

Technical Field

[0001] The present invention relates generally to methods of detecting and analyzing chromosomal abnormalities in a single cell or a few cells using microarray technology for preimplantation genetic diagnosis (PGD) and cancer diagnostics, and kits are provided.

Background

[0002] Since the first birth resulting from in vitro fertilization (IVF) occurred nearly 25 years ago, preimplantation genetic diagnosis (PGD) technology for IVF has provided significant benefits for those whose pregnancies failed due to advanced maternal age, recurrent implantation failure, recurrent miscarriage, and severe genetic disorders.

[0003] The major cause of reduced implantation is poor embryo quality. Most embryonic wastage and loss are caused by aneuploidies (chromosome number abnormalities) that are lethal and occur in approximately 60% of all spontaneous abortions and still births.

[0004] Chromosomal abnormalities include chromosomal aneuploidy, amplification, translocation, insertion/deletion, inversion, short tandem repeat polymorphisms, microsatellite polymorphisms, single nucleotide polymorphisms (SNPs), and other structural abnormalities. Chromosomal abnormalities can cause many phenotypic diseases and some are even lethal. If chromosomal abnormalities occur in embryos, many types of prenatal conditions and congenital diseases are likely to develop. Screening these abnormalities for preimplantation genetic diagnosis (PGD) is very important to ensure a structurally normal embryo selection and viable implantation.

[0005] Current technologies using fluorescence in situ hybridization (FISH) and metaphase-based comparative genomic hybridization (metaphase CGH) have many limitations. Array-based CGH has already shown some technological advantages. However, these arrays employ large chromosomal segment arrays such as BAC, PAC, YAC, MAC, plasmids, recombinant viruses, phagemids, cosmids, and the like. These arrays can only provide information on very large chromosomal structural abnormalities. Existing arrays cannot detect fine points of chromosomal abnormalities. XIA - OOlPCT

[0006] Chromosomal translocations are the commonest form of structural abnormality in chromosomes and occur about once in every 500 live births. For any chromosomal rearrangement, genetically unbalanced gametes are likely to be produced during oocyte meiosis. For reciprocal translocations, the prevalence of these unbalanced gametes is estimated to be between 50% and 70%. The genetically unbalanced gametes produced by some translocations are incompatible with a viable pregnancy.

[0007] Beyond chromosome copy number and structural changes, many genetic disorders are caused by mutations commonly seen in a single nucleotide or several nucleotides in a row within a single gene or multiple genes. For example, several single nucleotide polymorphisms (SNP) in multiple loci are involved in cystic fibrosis. In some cases, even one single nucleotide mutation can cause disease, such as the substitution of A for T (A>T) at codon 7 in the beta-globin gene for sickle-cell anemia. Short tandem repeat (STR) polymorphisms contribute to Huntington disease.

[0008] PGD technology has played an important role in improving clinical outcome. However, PDG largely depends on chromosomal smears and other cytogenetic techniques. Development of new technology to improve embryo selection and transfer is highly desirable.

[0009] Moreover, in numerous forms of cancer, there have been found increasing numbers of chromosomal aberrations similar to those described above, some of which are related to prognosis. Two important translocations are t(4;l 1) for MLL and AF4 genes and t(l:19) for E2A and PBX genes. The mixed-lineage leukemia (MLL) gene found in some lymphoblastic leukemia cells may predict early relapse after chemotherapy (Armstrong et al, Nature Genetics 2002; 30:41-47). The multi-lineage gene is a chromosomal translocation located on segment 1 Iq23. The AF-4 gene (located at 4q21) has been implicated in myeloid/lymphoid leukemia translation. Another example is Pbxl which is a proto-oncogene which is translocated in pre-B acute lymphoblastoid leukemias. The chromosomal translocation involves chromosomes 1 and 19 and results in a fusion protein in which the N-terminal portion of E2A is fused to Pbxl, converting a nontranscriptional activator into a transcriptional activator (E2A-Pbxl). These translocations are usually determined by fluorescent labeling of in situ chromosomes (FISH), which requires the efforts of a trained cytotechnician and depends on the talent of that individual. XIA - OOlPCT

[0010] Microarrays, also referred to as arrays or biochips, have been widely used for gene expression and other genomic research. The features of high density, flexible design, uniform hybridization efficiency, and massively parallel detection are but a few of their superior characteristics. Microarray-based comparative genomic hybridization (CGH) has the potential to be more flexible, cost-effective, and efficient than traditional CGH methods that depend on metaphase chromosomes, as in most PDG protocols. From published genomic information, probes can be flexibly designed at any position along chromosomes for specific disorders and applications. Oligonucleotide DNA or RNA probes are readily manufactured at high quality. Carefully selected and designed probes printed on microarray chips can detect chromosome copy number, chromosome arrangement, and other abnormalities. These features provide technical advantages over the traditional bacterial artificial chromosome (BAC) array CGH and others like it. Introduction of advanced technologies and improvement of IVF implantation rate would greatly improve the societal and economic benefits of IVF. Similarly, better diagnosis of leukemias would permit the development of more specific and potentially more successful therapies for those difficult-to-treat diseases.

Summary of the Invention

[0011] The inventions described herein provide objective methods for determining chromosomal abnormalities, which up to now have mainly been subjective observations by trained cytogenetic technicians reporting on chromosomal spreads or limited FISH display of one or more chromosomes. These embodiments feature methods and a kit to analyze chromosomal abnormalities for preimplantation genetic diagnosis (PGD) using microarrays. The method is able to analyze all kinds of chromosomal abnormalities including aneuploidy, gene amplification, translocation, insertion, deletion, reversion, short tandem repeats, and single nucleotide polymorphisms.

[0012] In one embodiment, there is provided a comprehensive microarray for detecting major and minor chromosomal abnormalities for preimplantation genetic diagnosis (PGD) research and clinical application comprising pre-in vitro fertilization (FVF). The microarray has a) a surface for adhering oligonucleotide probes; b) the oligonucleotide probes on the surface said probes designed to hybridize to selected known abnormal amplified and labeled XIA - OOlPCT

genomic DNA; and c) the oligonucleotides probes being capable of detecting at least three of aneuploidy, translocation, gene/locus amplification, insertions, deletions, reversions, short tandem repeat (STR) polymorphisms, mycrosatellite polymorphisms, single nucleotide polymorphisms (SNPs), single genetic mutations of selected inherited diseases, or a combination thereof.

[0013] In another embodiment, there is provided a method of analyzing with a microarray chromosomal abnormalities for preimplantation genetic diagnosis (PGD) research and clinical applications comprising in vitro fertilization (IVF). This method has the steps of a) providing a suitable PDG microarray coated with oligonucleotide probes designed to hybridize with chromosomal abnormalities; b) providing a small sample comprising a single cell, a few cells, body fluids or a small piece of tissue; c) lysing at least one cell in the small sample to free the genomic DNA; d) amplifying the DNA to produce a nucleotide sample; e) labeling the amplified DNA to produce a labeled nucleotide sample; f) incubating the labeled nucleotide sample with the PDG microarray to permit the labeled nucleotides to hybridize to the PDG microarray; g) exposing the hybridized PDG microarray to a scanner to obtain data on hybridization of the labeled nucleotides to the oligonucleotide probes; and h) subjecting the scanned data to analysis for hybridization to probes for chromosomal abnormalities. Optionally, steps d and e are performed as one step, in that labeling occurs as the sequences are amplified. In this method, the chromosomal abnormalities include aneuploidy; translocation; gene/locus amplification; insertion/deletion; reversion; short tandem repeat (STR) polymorphisms, microsatellite polymorphisms; single nucleotide polymorphisms (SNPs) or a combination thereof. These chromosomal abnormalities associated with at least Down syndrome, DeGeorge syndrome, phenylketonuria (PKU), sickle cell anemia, G6PD deficiency, Huntington disease, and Alzheimer's disease.

[0014] In yet another embodiment, there is disclosed a kit for analyzing chromosomal abnormalities in single cells. The kit has at least the following: a) reagents for preimplantation genetic diagnosis, said reagents comprising nucleotide sequences capable of hybridizing with known chromosomal abnormalities; and b) at least one slide with a microarray designed to hybridize with a plurality of chromosomal abnormalities, said microarray comprising a plurality of spots, each containing the same oligonucleotides; and the oligonucleotides in a spot having been designed to hybridize with a single chromosomal XlA - OOlPCT

abnormality, corresponding normal sequence, or flanking sequences neighboring the chromosomal abnormality.

[0015] In yet another embodiment, there is disclosed a process of analyzing chromosomal abnormalities in cancer using microarray technology. This process has at least the following steps: a) providing a suitable microarray comprising oligonucleotide probes designed for the detection of selected known cancer cell chromosomal abnormalities; b) providing a small sample comprising a single cell, a few cells, body fluid or a small piece of tissue; c) lysing at least one cell in the small sample to release genomic DNA; d) amplifying the genomic DNA to produce a nucleotide sample; e) labeling the nucleotide sample; f) incubating the labeled nucleotide sample with the microarray to permit the labeled nucleotides to hybridize with the oligonucleotide probes; and g) exposing the hybridized microarray to a scanner equipped with software to transform the scanned data into an indication of the presence or absence of a variety of chromosome abnormalities.

[0016] In another embodiment there is disclosed a method of analyzing chromosomal aberrations associated with excess or missing chromosomes. This method has at least the following steps: a) providing a microarray comprising oligonucleotide probes for individual chromosomes; b) providing a normal control and a small sample comprising a single cell, a few cells, body fluid or a small piece of tissue in separate containers; c) lysing the control and small samples to free genomic DNA; d) priming the genomic DNA with oligos comprising RNA promoter sequences; e) amplifying the genomic DNA in the control and small samples to produce amplified nucleotides; f) labeling the amplified nucleotides in the control sample with one color of dye and in the small sample with another color of dye; g) mixing the labeled control and small samples so that the labeled nucleotides are in approximately equal quantities; h) adding mixed or non-mixed labeled sample to at least one microarray reaction chamber and incubating the samples therein to permit hybridization on the microarray; and i) scanning the hybridized microarray with at least one color laser; collecting the data therefrom and comparing the light scatter from the different lasers to determine if certain chromosomes of the test sample are present at significantly greater or lesser number than in the control sample; whereby the significantly different number of chromosomes in the test sample are interpreted as hyperploidy or trisomy and the lesser numbers of chromosomes are interpreted as hypoploidy. Optionally the steps of e and fare combined to perform amplification and labeling in a single step. In this method, a primer with RNA promoter sequences is selected XIA - OOlPCT

from T7 or T3 promoters. In this method the promoter is specific for the polymerase, and an RNA polymerase is selected from T7 RNA polymerase and T3 RNA polymerase. In this method the type of detectable label is a fluorescent dye or a radioactive moiety.

10017] In yet another embodiment, there is disclosed a method of designing and manufacturing a microarray suitable for diagnosis of chromosomal abnormalities. This method includes at least the following steps: a) designing sequences for oligonucleotides suitable for arraying with steps comprising i. selecting known chromosomal sequences associated with chromosomal abnormalities, such as gene mutations associated with inherited diseases, chromosomal breaks, chromosomal translocations, chromosomal or gene amplification, insertions, reversions, short tandem repeats (STR) polymorphisms, microsatellite polymorphisms, single nucleotide polymorphisms (SNPs) and combinations thereof; ii. selecting chromosomal sequences that flank the abnormality, cross the chromosomal sequence where the abnormality occurs, cross the sequence which comprises a known insertion, reversion, STR, SNP or a combination thereof; iii. selecting locations on selected or all chromosomes to be able to compare chromosomal amplifications thereof with normal samples; iv. designing a set of probes capable of hybridizing with the selected chromosomal sequences; v. testing the designed probes against known sequences in a public gene database to avoid cross-hybridization with unwanted natural nucleotides; vύ adjusting the G-C of the designed sequences for similar reaction under the same temperature, pressure and timing as the other sequences in the set; b) synthesizing the designed oligonucleoβtides as DNA, RNA, PNA, LNA or other modified molecules, and p5oviding each synthesized oligonucleotide in the set in a different container; c) providing a treated slide or beads capable of reacting with one end of the designed probes; and d) printing each probe of the set onto a unique location on the slide or beads.

[0018] In yet another embodiment, there is disclosed a method of linear amplification of genomic DNA having the steps of a) obtaining genomic DNA; b) priming genomic DNA with degenerate oligonucleotide primers (DOP) with a T7 RNA promoter sequence at the 5' end of the primers; c) reacting the DOP-primed DNA with DNA polymerase for at least one cycle to amplify by PCR; d) amplifying the PCR product with T7 RNA polymerase; and e) labeling the amplified product with a detectable moiety. In this method T7 RNA promoter can be replaced with T3 promoter and T7 RNA polymerase can be replaced with T3 RNA XIA - OOlPCT

polymerase. In this method steps d and e are combined for labeling during the amplification of the PCR product.

[0019] Ways of diagnosing aneuploidy and translocation have been specifically described in this invention since they are the most common chromosomal abnormalities. However, the inventive method can be used for additional types of abnormalities. The oligonucleotide microarrays used for this invention have advantages as to flexibility of design and coverage from fine points of polymorphism to the whole genome, which gives more advantages than other currently used detection methods used for this application such as FISH (fluorescence in situ hybridization) and metaphase comparative genome hybridization.

[0020] Since genetic material is limited for the PGD and only one cell is available in most cases, a method that amplifies and labels genetic material in a single cell was developed and is described below. The single cell was Iysed in a tube with lysis buffer. Genome amplification takes place in the same tube using degenerate oligonucleotide primers with the T7 RNA promoter sequences. Other methods were also described. The amplified genome was then labeled using fluorescence dyes by in vjtro transcription. The labeled test sample can be mixed with a reference sample labeled with a different dye for array hybridization. That way a direct comparison can be made between a control (positive or negative) and the clinical sample. Alternatively during the same time, aliquots of amplified genome can be further amplified using specific primers for specific genetic diagnosis by uniplexing or multiplexing PCR (polymerase chain reaction). With oligonucleotide microarray, the method was able to achieve high sensitivity, accuracy, and broad genome coverage.

[0021] This method applies not only to PGD, but also other applications using single cells, such as stem cells, differentiated cells, and transformed cells for culture, tissue, and body fluid.

Brief Description of the Drawings

[0022] Figures Ia- Id are schematic diagrams for aneuploidy detection. Fig Ia shows a chromosome which can be detected by a probe. Fig Ib shows equal numbers of test and reference pairs of chromosomes, or a normal number of copies for the test sample. Fig Ic shows hyperhaploid test cells, compared to the normal number of reference chromosomes, for a ratio of 3:2. Fig Id illustrates hypoploidy (condition of having only one or a few chromosomes fewer than normal), in which fewer or no test DNA signals should be seen for XIA -OOlPCT

the detected chromosome or arm. If diploid cell lines are used, the ratio between test and reference for a trisomy is expected to be 3:2, or 1.5, and for monosomy 1:2, or 0.67, theoretically.

[0023] Figure 2 is a graph of the representation of all the chromosomes of cell lines having trisomy 13 (47, XX, +13), 18 (47, XX, +18), and 21 (47, XX, +21). The average ratio greater than 1.33 was obtained for trisomy, which was significant (p<0.05) compared to ratio range of 0.86 - 1.16 for normal chromosome pairs.

[0024] Figures 3a-3d are schematic figures showing the rationale for translocation detection. Fig 3a shows the regimen for probe design of the normal chromosome. Probes flanking and spanning the breakpoints of translocation are labeled 1, 2, 3. Fig 3b illustrates the types of translocations. The normal chromosome is labeled A. Two types of translocations occur: unbalanced translocation or deletion is shown for chromosome B, and balanced translocation or reciprocal translocation is shown between chromosomes C (open) and D (diagonal lines). Fig 3c shows an inventive biochip layout. The numbered probes (see Fig 3a) are spotted on biochips. Fig 3d shows hybridization results. In A, there are hybridization signals on all 1, 2, and 3 probes for the normal chromosome; for a deletion, only probe 1 has a signal because no target for probe 3 was amplified and shorter targets for probe 2 washed off after hybridization; probe 1 and 3 but not probe 2 show signals for both chromosomes C and D. Probe 1 and 3 hybridized with the full target sequences. Half portion of targets that are homologous to probe 2 hybridizes to the probe (chiramic targets due to translocations) and targets are washed away.

[0025] Figures 4a-4c show microarray design and results for translocations of chromosomes 1 1 and 16. Fig 4a illustrates the probe layout on a chip of probes designed as shown in Fig 3a. In addition, because portions of chromosomes 11 and 16 translocated and formed a new fused gene, an additional probe spanning the fused portion of the new gene is shown as fused-2. Fig 4b shows signals only for normal chromosomal probes for the reference samples. Fig 4c shows no signals on breakpoint probes, but do show a signal on the fused probe for test samples.

Figures 5a-5c illustrate multiplex PCR for. translocation. Fig 5a shows spots in triplicate on an array for probes for four genes from different chromosomes as well as XIA-OOlPCT

positive and negative probes. Fig 5b shows t(4;l 1) translocation, and Fig 5c shows the other t(l;19) translocation. These translocations were also confirmed by uniplex PCR.

Detailed Description

[0026] Microarrays disclosed herein employ smaller oligonucleotides have designed to assess not only the whole chromosomal structure but also the finer chromosomal changes including aneuploidies, translocations, insertion/deletion, reversion, local amplification, even single nucleotide polymorphisms..

10027] This invention provides a method to detect chromosomal abnormalities in a single cell, a few cells or small tissues on oHgonucleotide-based microarrays. One specific technical platform used herein was the microarray (or biochip or chip), because microarrays afford a powerful system for massive and parallel detection of hundreds to thousands to even millions of chromosomal segments at one time on one sample, providing maximal genomic information for cells. Whole genome information and chromosomal abnormalities can be detected and studied.

[0028] The other technical aspect of this invention is genomic amplification and labeling. Limited initial genetic material from only a few cells poses a major analytical challenge. The invention provides a method to amplify the whole genome from a single cell or a few cells, then to label them for the hybridization.

[0029] Unless otherwise noted, the terms used herein are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0030] In addition to the definitions of terms provided below, definitions of common terms in molecular biology may also be found in Rieger et ah, 1991 GLOSSARY OF GENETICS: CLASSICAL AND MOLECULAR, 5^th Ed., Berlin: Springer- Verlag; and in CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, F.M. Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1998 Supplement).

[0031] It is to be understood that as used in the specification and in the claims, "a" or "an" can mean one or more, depending upon the context in which it is used. Thus, for example, reference to "a cell" means at least one cell. λJA - ϋϋiPCT

[0032] The present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the invention and the Examples included herein. However, hefore the present compounds, compositions, and methods are disclosed and described, it is to be understood that this invention is not limited to specific nucleic acids, specific polypeptides, specific cell types, specific host cells, specific conditions, or specific methods, etc., as such may, of course, vary, and the numerous modifications and variations therein will be apparent to those skilled in the art. It is also to be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0033] Standard techniques for cloning, DNA isolation, amplification and purification, for enzymatic reactions involving DNA Iigase, DNA polymerase, restriction endonucleases and the like, and various separation techniques are those known and commonly employed by those skilled in the art. A number of standard techniques are described in Sambrook et al., 1989 MOLECULAR CLONING, Second Edition, Cold Spring Harbor Laboratory, Ptainview, New York; Maniatis et al, 1982 MOLECULAR CLONING, Cold Spring Harbor Laboratory, Plainview, New York; Wu (Ed.) 1993 Meth. Enzymol. 218, Part I; Wu (Ed.) 1979 Meth Enzymol. 68; Wu et al., (Eds.) 1983 Meth. Enzymol. 100 and 101; Grossman and Moldave (Eds.) 1980 Meth. Enzymol. 65; Milter (ed.) 1972 EXPERIMENTS IN MOLECULAR GENETICS, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Old and Primrose, 1994 PRINCIPLES OF GENE MANIPULATION, 5^th ed.₅ University of California Press, Berkeley; Schleif and Wensink, 1982 Practical Methods in Molecular Biology; Glover (Ed.) 1985 DNA CLONING: VOLS. I AND II, IRL Press, Oxford, UK; Hames and Higgins (Eds.) 1985 NUCLEIC ACID HYBRIDIZATION, IRL Press, Oxford, UK; and Setlow and Hollaender 1979 GENETIC ENGINEERING: PRINCIPLES AND METHODS, VOIS. 1-4, Plenum Press, New York City.

[0034] Useful for producing samples with the inventive microarrays, many amplification methods are well known, including polymerase chain reaction (PCR) (PCR protocols, a guide to methods and applications, ed. Innis, Academic Press, N. Y. 1990), Iigase chain reaction (LCR) (Landegren Science 1988; 241:1077;), transcription amplification (Kwoh Proc. Natl. Acad. Sci. USA 1989; 86:1173); self-sustained sequence replication (Guatelli Proc. Natl. Acad. Sci. USA 1990; 87:1874); Q Beta replicase amplification (Smith J. CHn. Microbiol. 1997; 35:1477-1491), and other RNA polymerase mediated techniques such as nucleic acid XIA- OOlPCT

sequence based amplification, or NASBA (Sambrook; Ausubel; U.S. Pat. Nos. 4,683,195 and 4,683,202).

[0035] Abbreviations and nomenclature, where employed, are deemed standard in the field and commonly used in professional journals such as those cited herein. For the convenience of the reader, the following list is included:

Abbreviations

■ AF4 - A Gene

■ A or a - Adenine

^■ AD - Alzheimer's Disease or Alzheimer's Dementia

■ BAC - Bacterial Artificial Chromosome; A Chromosomal Segment Array

■ BLAST - Basic Local Alignment Search Tool; A Computer Program That Identifies Homologous Genes in Different Organisms

■ C - Cytosine

■ "C - Degrees Centigrade or Celsius

■ CGH - Comparative Genomic Hybridization

■ C Y3 - Cyanine, A Fluorescent Dye Use as a Label

■ CY5 - Cyanine A Fluorescent Dye Use as a Label

■ DNA - Deoxyribonucleic Acid, Composed of Adenine (A), Cytosine (C), Guanine (G) and Thymine (T)

■ DOP - Degenerated Oligonucleotide Primer • DTT - Dithiothreitol; A Reagent

■ E2A - A Gene Implicated in Myeloid/Lymphoid Leukemia

■ FISH - Fluorescence In Situ Hybridization; a Cytogenetic Technique

■ G - Guanine

■ G6PD Deficiency - Glucose-6-Phosphate Dehydrogenase Deficiency

■ HPLC - High Pressure Liquid Chromatography

■ IVF - In Vitro Fertilization

■ IVT - In Vitro. Transcription

■ LCR - Ligase Chain Reaction; Method for Amplification of Annealed Genomic DNA XIA-OOlPCT

■ LNA - An Oligonucleotide Probe

■ JiI - Microliter

■ HiL - Milliliter

■ MAC - A Chromosomal Segment Array

■ MLL - A Gene

■ mM - Millimolar

■ NASBA - Method for Isothertnic Nucleic Acid Sequence-Based Amplification • NCBI - National Center for Biotechnology Information

■ nT or nt - Nucleotide(s)

■ NTP - Nucleoside 5 '-Triphosphate; A Reagent

■ PAC - A Chromosomal Segment Array

■ PBX - A Gene

■ PCR - Polymerase Chain Reaction; Method for Amplification of Annealed Genomic DNA

■ PKU - Phenylketonuria

■ PGD - Preimplantation Genetic Diagnosis

■ PNA - An Oligonucleotide Probe

■ RNA - Ribonucleic Acid

■ SSC - Side Scatter

■ SN-I - A Leukemic Cell Line with Translocation t(l 1 ; 16)(q23;p 13)

■ SNP - Single Nucleotide Polymorphism « STR - Short Tandem Repeats

■ T or t -Temperature; Translocation: e.g., t(l 1 ; 16)(q23;p 13)

■ T3 - RNA Promoter and DNA-dependent phage polymerase which is highly specific for the T3 promoter

■ T7 - RNA Promoter and DNA-dependent phage polymerase which is highly specific for the T7 promoter

^■ Taq - Thermus aquaticus DNA Polymerase; Thermostable Enzyme Used For Thermal DNA Amplification

■ T7-DOP PCR - T7 RNA Promoter Sequence with Degenerated Oligonucleotide Primer for use in Polymerase Chain Reaction for DNA Amplification

^■ T_n, - Melting Temperature XIA - OOlPCT

^■ Tris - Tris(hydroxymethyl)aminomethane; Tromethamine; Liquid Buffer for Neutralization

■ X - X Chromosome (Sex Chromosome)

■ Y - Y Chromosome (Sex Chromosome)

■ YAC - Yeast Artificial Chromosome

■ Adenine (A or a) - 6-Aminopurine; A Nitrogenous Base, One Member of the Base Pair AT (Adenine-thymine); One of the Two Major Purines (the Other Being Guanine) Found in Both RNA and DNA

^■ AF4 - A Gene that participates in translocation in myeloid/lymphoid leukemia

^■ AF4-Reverse - A Probe Sequence

^■ Alzheimer's Disease - AD. Adult-onset Dementia Characterized by Disorientation and Impaired Memory, Judgment, and Intellect Due to Pathological Changes in the Brain

^■ Amplification - An Increase in the Number of Copies of a Specific Fragment of DNA, Accomplished Via Such Methods As PCR

■ Aneuploid - Abnormality of the Number of Chromosomes; Not an Exact Multiple of the Haploid Number of Chromosomes

■ Annealed - Induced Combination with Complementary Strands

^■ Array - A Two- or three-dimensional Configuration to Screen For or Identify Specific Genes or Genomic Regions of Interest (Biochip)

^■ Bacterial Artificial Chromosome (BAC) - A DNA Construct or Vector Often Used in Genomic Cloning or Sequencing Experiments

^■ Beta-globulin Gene - The Gene Associated with Sickle Cell Trait and Anemia, Also Known as the HBB Gene

^■ Biochip — A Two-dimensional Configuration to Screen For or Identify Specific Genes or Genomic Regions of Interest by Chemical Reactions (Array; Microarray)

■ Centromere - A Specialized, Central Chromosomal Region Involved in Cell Division (Site for Attachment of Spindle Fibers)

^■ Chimera - An Organism That Contains Cells or Tissues with Different Genotypes

^■ Chromosome - The Self-replicating Genetic Structure of Cells That Contains Cellular DNA and Bears the Portions of the Genetic Code

^■ Clone - An Exact Copy of Biological Material, Such as DNA XIA - OOlPCT

■ Codon - Triplet. A Sequence of Three Nucleotides in a Strand of DNA or RNA That Provides The Genetic Information to Incorporate Specific Amino Acids in a Protein

■ Cosmid - Vector Host for Recombinant Clones; Artificially Constructed Cloning Vector.

■ Cystic Fibrosis - A Common Hereditary Disease Caused by a Mutation in a Gene (i.e., the Cystic Fibrosis Transmembrane Conductance Regulator) That Affects the Entire Body, Causing Chronic Pulmonary Disease, Progressive Disability, and Premature Death

■ Cytosine - 4-Amino-2(lH)-Pyrimidinone; A Pyrimidine Found in Nucleic Acids

■ DeGeorge (DiGeorge) Syndrome - A Rare Congenital Disease, Caused by a Large Deletion from Chromosome 22 Affecting Multiple Genes, Characterized by Variable Signs and Symptoms That Commonly Include Recurrent Infection, Heart Defects, and Abnormal Facial Features.

■ Deletion - A Loss of a DNA Fragment from a Chromosome

■ Deoxyribonucleic Acid - DNA. The Molecule That Encodes Genetic Information. The Auto-reproducing Component of Chromosomes. DNA Is a Double-stranded Molecule Held Together by Weak Bonds Between Base Pairs of Nucleotides. The Four Nucleotides in DNA Contain the Bases Adenine (A or a), Cytosine (C or c), Guanine (G or g), and Thymine (T or t). Naturally-occurring Base Pairs Only Form Between A and T and G and C

■ Diploid -A Full Set of Genetic Material Consisting of Paired Chromosomes. The Human Genome Consists of 46 Chromosomes (23 Pairs)

■ Down (Down's) Syndrome - Trisomy 21. A Genetic Disorder Caused by the Presence of All or Part of an Extra 21^st Chromosome. The Condition is Characterized by a Combination of Major and Minor Differences in Body Structure and Appearance, Including the Face, and Is Associated with Impairment of Cognitive Function, Frank Mental Retardation, and Altered Physical Growth

■ E2A - A Gene associated with leukemia

■ EA2-Forward - A Probe Sequence

■ Formamide - Methanamide, an Amide Derived from Formic Acid, Used for Cryopreservation of Tissues and as an RNA Stabiliser

■ Gamete - A Mature Male or Female Reproductive Cell (i.e., sperm or ovum) with a Haploid Set of Chromosomes (23 Pairs for Humans)

■ GenBank - Public Genomic Database from NCBI XIA - OOlPCT

^■ Gene — An Ordered Sequence of Nucleotides Located in a Particular Position on a Chromosome That Encodes a Specific Function or Product (e.g., a Protein). The Functional Unit of Heredity

■ GENEPIX - Software for Image and Data Analysis

■ Genome - The Diploid Human Genome Consists of 23 Pairs of Chromosomes (A Total of 46 Chromosomes): 22 Pairs of Autosomes, and One Pair of Sex Chromosomes (X and Y Chromosomes). The Entire Chromosomal Genetic Material of an Organism.

■ G6PD Deficiency - An X Chromosome-linked Heritable Disorder of Carbohydrate Metabolism, Manifested by Reactions to Certain Chemicals and Drugs, Leading to Hemolytic Anemia

^■ Haploid - A Single Set of Chromosomes (i.e., One-half of the Full Set of Chromosomes) Present in an Ovum or Sperm

^■ Homology - Similarity in DNA or Protein Sequences Between Individuals of the Same Species or Among Different Species

^■ Huntington's (Huntington) Disease - HD. A Rare Inherited Neurological Disorder, Previously Known as Huntington's Chorea and Chorea Major, is caused by a trinucleotide Repeat Expansion in the Huntington (Htt) Gene and is Characterized by Abnormal Body Movements Called Chorea, Lack of Coordination, and Abnormalities of Cognitive Function and Behavior.

^■ Hybridization - The Process of Combining Two Complementary Strands of DNA (or One Each of DNA and RNA) to Form a Double-stranded Molecule. Crossbreeding

■ Hyperhyploidy - The Presence of One or More Extra Chromosomes

■ Hy polyploidy - The Absence of One or More Chromosomes

■ Insertion - The Addition of a DNA Fragment to a Chromosome

^■ In Vitro Fertilization - Fertilization of an Ovum by a Sperm Outside of the Body

■ Leukemia - Acute or Chronic, Malignant Proliferation of Abnormal Leukocytes or White Blood Cells, Classified by the Dominant Cell Type and Disease Duration, and Characterized by Abnormal White Blood Cell Counts, Infections, Anemia, and Enlargement of Lymph Nodes, the Spleen, and the Liver

■ Ligase - An Enzyme That Catalyzes the Combination of Two Molecules Accompanied by the Breakdown of a Pyrophosphate Bond in ADP or a Similar Compound

^■ Locus - A Specific Site of Location.

^■ Lymphocytes - Immunologically Important White Blood Cells Formed in Lymphatic Tissue Throughout the Body, (e.g., lymph nodes, the spleen, and the thymus) XIA -OOlPCT

■ Lysis - Destruction, Disintegration, or Dissolution of Cells, Bacteria, or Other Structures

■ Metaphase - A Stage in Mitosis and Meiosis in which the Chromosomes Align in a specific Configuration During Cellular Division

■ Microarray - A Small, Miniaturized, Two- or three-dimensional Configuration to Screen For or Identify Specific Genes or Genomic Regions of Interest by Chemical Reactions (Array; Biochip; Chip; beads, etc.)

■ MLL-Forward - A Probe Sequence

■ MLL - A Gene

■ Monosomy - Absence of One Chromosome of a Pair of Homologous Chromosomes. A Chromosomal Deletion

^■ Multiplexing - A Laboratory Methodology That Simultaneously Performs Multiple Sets of Reactions in Parallel, Thereby Improving Speed and Throughput

■ Nucleic Acid - A Macromolecule Composed of Nucleotide Sub units.

■ Nucleoside - A Compound Composed of a Sugar, Usually Ribose or Deoxyribose, with a Purine or Pyrimidine Base by Way of an 2V~glycosyl link

^■ Nucleotide - A Subunit of DNA or RNA Consisting of a Nitrogenous Base (i.e., Adenine, Cytosine, Guanine, or Thymine in DNA, and Adenine, Cytosine, Guanine, or Uracil in RNA)₅ a Phosphate Moiety, and a Sugar Molecule (i.e., Deoxyribose in DNA and Ribose in RNA)

■ Oocyte - Ovocyte. Immature Ovum or Female Sex Cell

■ Oligonucleotides - A Molecule Composed of about 100 or Fewer Nucleotides, Used as a DNA Synthesis Primer; "Oligo" for short

■ PBX - A Gene which participates in translocation in leukemia

■ PBX-Reverse - A Probe Sequence

■ Phage - A Virus for which the Natural Host is a Bacterium. Vector Host for Recombinant Clones

■ Phagemids - Vectors Based on Hybrids Between Phages and Plasmids That Are Used in DNA Cloning and Sequencing

■ Phenotype - The Physical Characteristics of an Organism or the Presence of a Disease That May or May Not Be Genetic

^■ Plasmid - Autonomously Replicating Extra-chromosomal Circular DNA Molecules That Are Nonessential for Cell Survival, May Integrate into the Host's Genome, and May Be Artificially Constructed for Use as Cloning Vectors XIA - OOlPCT

^■ Polymerase (DNA or RNA) - An Enzyme That Catalyzes the Synthesis of Nucleic Acids on Existing Nucleic Acid Templates, Thereby Assembling DNA from Deoxyribonucleotides or RNA from Ribonucleotides

■ Polymorphism - Pleomorphism. Difference in DNA Sequence Among Individuals That Mat Result in Differing Morphologic Expression

■ Polypeptides - A Protein, Part of a Protein, or a Peptide Composed of a Sequence of Multiple, Often Large Numbers of, Amino Acids Joined by a Peptide Bonds (i.e., --NH-CO-)

■ Polymerase Chain Reaction - PCR. A Highly-specific Method for Amplifying a Specific DNA Base Sequence Using a Heat-stable Polymerase, Primers, and Complementary DNA Strands or for Detecting the Existence of a Defined DNA Sequence in a Test Sample

■ Primer - A Short Pre-existing Polynucleotide Chain to which New deoxyribonucleotides Can Be Added by DNA Polymerase

^■ Restriction Endonuclease - An Enzyme That Recognizes Specific, Short Nucleotide Sequences and Cuts the DNA at Those Specific Loci

^■ Reversion - Return to the Original Phenotype by Reinstatement of the Original Genotype (i.e., True Reversion) of by a Mutation at Another Locus That Offsets or Cancels the Effect of the Original Gene (i.e., Suppressor Mutation)

■ Ribonucleic Acid - RNA. A Macromolecule Found in All Cells, Both in the Nucleus and the Cytoplasm That Is Composed of Ribonucleosides and Is Similar in Structure to DNA. RNA Plays an Important Role in Protein Synthesis and Other Chemical Activities Within the Cell. RNA is Divided into Several Classes with Different Functions, Including Messenger RNA and Transfer RNA

■ Satellite — A Chromosomal Segment That Branches Off from the Rest of the Chromosome But Remains Attached by a Thin Filament

■ Sequence Replication - Reproduction, Replication or Amplification of a Genomic Sequence

^■ Short Tandem Repeat - STR. In DNA, A Class of Polymorphisms That Occurs When a Pattern of Two or More Nucleotides Are Repeated and the Repeated Sequences Are Directly Adjacent to One Another

■ Sickle-cell Anemia - Sickle-cell Anemia or Disease Is an Inherited Disorder of the Hemoglobin in Red Blood Cells That Is Characterized by Abnormally Shaped Red Blood Cells and by Anemia and Painful Sickle-cell Crises, Especially Prevalent in African Americans XIA - OOlPCT

^■ Single Nucleotide Polymorphism - SNP. An Inherited DNA sequence variation occurring when a single nucleotide (i.e., A, T, C₅ or G) in the genome differs between members of a species or between paired chromosomes in an individual (e.g., AAGCCTA Compared to AAGCTTA). SNPs make up 90% of all human genetic variations and can affect how humans develop diseases, respond to pathogens, chemicals, drugs, etc.

^■ SSC Fluorescence - Measurement of Side Scatter (90° Scatter or Right Angle Scatter) of Fluorescent Signal

■ Telomere - The End of a Chromosome That Is a Specialized Structure Involved in the Replication and Stability of linear DNA

^■ Translocation - Transposition of Two Segments Between nonhomologous Chromosomes As a Result of Abnormal Chromosomal Breakage and Refusion of Reciprocal Segments: e.g., t(l l;16)(q23;pl3)

^■ Trisomy - Three Copies of a Particular Chromosome Rather Than the Normal Two Copies: e.g., Trisomy 13 (47, XX, +13) and Trisomy 21 (Down's Syndrome)

^■ X Chromosome - One of the Two Sex Chromosomes (XX Sex Chromosomes Are Found in Females)

^■ Y Chromosome - One of the Two Sex Chromosomes (XY Sex Chromosomes Are Found in Males)

Molecular Biology Techniques

[0036] Standard molecular biology techniques known in the art and not specifically described are generally followed as in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, NY (1989, 1992), and in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, MD (1989). Polymerase chain reaction (PCR) methodology is generally employed as specified as in Jam et al., PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, CA (1999). Reactions and manipulations involving other nucleic acid techniques, unless stated otherwise, are performed as generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory Press, and methodology as set forth in United States Patents Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659; and 5,272,057, and incorporated herein by reference. In situ PCR in combination with flow cytometry can be used for detection of cells containing specific DNA and mRNA sequences (e.g., Testoni et al., 1996, Blood, 87:3822). XIA -OOlPCT

[0037] Standard methods in immunology known in the art and not specifically described herein are generally followed as set forth in Stites et al (Eds.), BASIC AND CLINICAL IMMUNOLOGY, 8* Ed., Appieton & Lange, Norwalk, CT (1994); and Mishell and Shigi (Eds.), SELECTED METHODS IN CELLULAR IMMUNOLOGY, W.H. Freeman and Co., New York (1980).

[0038] Nucleic acid samples disclosed herein also comprise a detectable composition referred to herein as a label. The label can be biological molecule, such as a nucleic acid. This nucleic acid samples can have detectable labeled bases incorporated into the nucleic acid by, for example, nick translation, random primer extension, amplification with degenerate primers, and the like. The label can be detectable by any means, including but not limited to, visual, spectroscopic, photochemical, biochemical, immunochemical, physical or chemical means. Non-limiting examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; a non-Hmiting example of a luminescent material includes luminol; non-limiting examples of bioluminescent materials include luciferase, luciferin, and aequorin.

GENERAL PROCEDURES

Biochip design:

[00391 Human genome information is available from many public genomic databases, such as GenBank from the National Center of Biological Institute (NCBI). The probes for rnicroarrays were designed based on that information. The genome information for this study was obtained from GenBank. Novel probes hybridizing thereto were designed using in-house developed primer design software and synthesized using an ABI 394 DNA synthesizer. The average length of probes was 40 nucleotides (nt) and their GC content, melting temperature T_m, and hairpin looping tendency were calculated and adjusted to meet the chip design criteria.

[0040] For aneuploidy, about three loci per chromosomal arm were chosen, based on the most likely reproductions. As described above, oligonucleotide probes were designed to hybridize with those loci. The designed probe sequences were subjected to a BLAST (Basic XIA - OOlPCT

Local Alignment Search Tool) search against all GenBank nucleotide sequences to ensure their specificity for only the selected chromosomal loci. Exemplary probes were used in the following experiments that feature trisomy 13 (47, XX, +13), 18 (47, XX, +18), and 21 (47, XX, +21). Cell lines displaying those aberrations were used and are disclosed below. Those skilled in the art will realize that the density of probes (number of probes for each chromosome) can be increased to monitor local chromosome amplification and the finer points of structural abnormalities. The probe design principles and hybridization data are shown in Fig. 1 and Fig. 2.

[0041] For gene aneuploidy (or even regional chromosomal amplification), a large number of probes were designed to cover each chromosome. Theoretically, the higher coverage the probes spanning the chromosomes; and the more detailed information will be provided for the detection of amplified genes. [0039] For translocation, specific probes were designed based on known locus-specific sequence information. A general probe design rule is described in Fig 3. In the cell line SN-I for the reciprocal translocation t(l I;16)(q23;pl3) selected as an example for testing, the genomic abnormalities showed that Ilq23 was fused to 16pl3 and formed a new gene, multi-lineage leukemia (MLL-CBP). Probes were designed to detect the intact breaking points of genes 11 and 16 (1 Iq23 and 16pl3, respectively), flanking regions around the breaking points, and the fused point of new MLL-CBP gene. According to the terminology in Fig 3, probes across the breaking points were designated 11- 2 and 16-2 for chromosomes 11 and 16, respectively. Upstream and downstream probes were designed for the flanking regions 11-1 and 11-3, and 16-1 and 16-3, respectively. The fused probe was designed across the fusion point of the new gene and was named fused-2.

Probe sequences are shown below.

Probe 11-1: ctttatattcccatagctctttgtttataccactcttagg (SEQ ID NO: 1),

11-2: ttctatttccactggtattagggctataatgttgatgttt (SEQ ID NO: 2),

11-3: gaagtaacatgtttatgttgatagaaggctggtgatagta (SEQ ID NO: 3),

16-1 : ctgtaacacaaacggaatgaatgtttagcataataacaac (SEQ ID NO: 4),

16-2: tttcatttgacagtctcccaggggaccatcttgaagagta (SEQ ID NO: 5),

16-3: ttaagtgattatgttatgctaggaacatcatagagtagtt (SEQ ID NO: 6), XIA - OOIPCT

fiised-2: ttctatttccactggtattaggggaccatcttgaagagta (SEQ ED NO: 7)

[0043] The probe design can be readily adapted to detect more abnormalities including aneuploidies, translocations, single nucleotide polymorphisms (SNPs), single nucleotide mutations (such as the substitution of A>T at codon 7 in the beta-globin gene for sickle-cell anemia) and short repeat polymorphisms (e.g., Huntington's disease).

[0044] One of the major advantages of oligo probes is their flexibility. The probes can be designed based on the any specific chromosomal or genetic information, instead of mere selection of whole-genome cloned probes orlibraries (such as BACs or YACs), thus maximally reducing cost and being more practical. The other advantage from the use of oligo probes is to be able to provide the detailed information of fine structural abnormalities of chromosomes. For specific, small chromosomal abnormalities, multiple oligo probes can be designed for those fine locations to provide the most detailed structural information available. The oligo probes can be DNA or RNA oligonucleotides, PNA, LNA or modified DNA or RNA or other types of analogs to meet the required specificity and product stability.

Biochip fabrication:

[0045] DNA oligo probes were used in this study. Biochips were manufactured in a class 100 clean room. DNA oligo probes were synthesized with a 5' amine group for chip attachment and were purified by HPLC. Their concentration was normalized at 20 mM per chemical probe. The probes were dissolved in 50 mM phosphate buffer pH 8.3. The probes were spotted on the microarray surface in triplicate. After post-printing processes, the biochips were stored at 4° C in a desiccator's container and can be used for hybridization.

Cell Line selection:

[0046] Several cell lines were selected for aneuploidy and translocation studies from the Coriell Cell Repository (Camden, NJ), including trisomy 47XX + 21 (Catalog #AG13429), 47XX + 13 (AG10292), 47XX + IS (AG07167). SN-I cells for MLL translocation were obtained (Zhang Y et al, Gene Chromos Cancer 2004;41:257-65; Hayashi Y et al, Cancer XIA - OOlPCT

Research 2000;60: 1139-45). Lymphocytes were also obtained from peripheral blood of a normal female (46, XX).

Cell lysis and genome amplification:

[0047] Single cells were isolated as described (Hussey et al, MoI Hum Reprod 1999;5: 1089-94). Lysis of single cells was carried out by the addition of 5 μl of lysis buffer (200 mM KOH, 50 mM DTT) and incubation at 65 ⁰C for 10 min followed by neutralization using 5μl of neutralization solution (300 mM KCl, 900 mM Tris-HCl, pH 8.3, 200 mM HCl) (Cui et al. Proc Natl Acad Sci USA 1989; 86:9389-93). To prime whole genome amplification, degenerated oligonucleotide primers (DOPs) with T7 RNA promoter sequences at the 5' end (T7-sequence-CTGACTCGACNNNNNNATGTGG) (SEQ ID NO: 8) were synthesized. The degenerated oligonucleotide primed-PCR (DOP-PCR) reaction was conducted in a volume of 50μl with a final concentration of 50 mM KCl, 100 mM Tris-HCI, pH 8.3, 0.1 mg/ml gelatin, 2.5 mM MgCl₂, 200 μM of each dNTP, 2μM T7-DOP, and 5 IU of Taq polymerase (Perkin Elmer, Wellesley, MA).

[0048] For annealing and amplification, eight cycles at 94⁰C for 1 min, 30⁰C for 1.5 min, 72 ⁰C for 3 min with an annealing ramp of 2 ⁰C per cycle, and twenty-five cycles at 94 ⁰C for 1 min, 62 ⁰C for 1 min, 72⁰C for 3 min were performed, respectively and consecutively. The PCR products were purified with a PCR purification kit (Qiagen, Valencia, CA), following the manufacturer's directions. The purified products were either stored at or below — 20⁰C, or were directly used in the next step.

In vitro transcription (TVT) and labeling:

[0049] IVT was carried out in a volume of 40 μl with a final concentration of Ix IVT buffer (Ambion, Austin, TX), 5 mM each NTP, 1.25 mM UTP-Cy5 or -Cy3 (Amersham), 4 μl enzyme mix (Ambion), and 16.9 μl amplified genome products (see above for preferred method). The mix was incubated at 37°C for 14 hours.

PCR using specific primers: XIA - OOlPCT

[0050] Aliquots of amplified genetic material obtained by the DOP-PCR procedure disclosed above were further amplified using specific primers for specific diseases by uniplexing or multiplexing PCR.

[0051] Multiplex PCR was performed in a 50 μl reaction containing 5 μl of the amplified genomes, 11 mM Tris-HCl (pH8.3)₅ 55 mM KCl, 1.5 mM MgCl₂, 0.2 mM each of dNTPs, a mixture of Cy5-labeled primers (0.2 μM each), and 1.5 units of ArnpliTaq Gold polymerase (Perkin-Elmer). For the normal control, the same mixture was employed, except for the use of Cy3-labeled primers. Thirty cycles were performed: 94°C for 1 min, 56°C for 1 min, and 72°C for 1 min, followed by extension at 72°C for 5 min. The primers used were specific for translocation t(4;l 1) for MLL and AF4 genes and t(l;19) for E2A and PBX genes. Primer sequences were:

MLL-Forward: ccgcctcagccacctactac (SEQ ID NO: 9)

AF4-reverse: ttggttttgggttacagaactgac (SEQ ID NO: 10)

E2A-Forward: ccggggatgccctcggcaaag (SEQ ID NO: 11)

PBX-reverse: acagcatgttgtccagccgc (SEQ ID NO: 12)

Probe sequences on the arrays were:

MLL: aaagcagcctccaccaccagaatcaggtccagagcagagc (SEQ ID NO: 13)

AF4: ctttccctacaaaggactctcagcatgtcagttctgtaac (SEQ ID NO: 14)

E2A: gacgaggccatccacgtgctccgcagccacgccgtgggca (SEQ ID NO: 15)

PBX: cgaggagcccaggaggaggaacccacagacccccagctga (SEQ ID NO: 16)

Purification and quantification of labeled targets:

[0052] . The IVT products were purified (Qiagen Rneasy Mini kit) and then quantified using Beckman DU800 LJV spectrophotometry (Beckman Coulter, Fullerton, CA). XIA - OOlPCT

Hybridization:

[0053] The hybridization chamber volume was 140 μl (Genomic Solutions, Inc., Ann Arbor, MI). Ten micrograms of each labeled target was added into the hybridization chambers at the final buffer concentration 6xSSPE and 50% formamide. Hybridization was performed at 37 ⁰C for 15-20 hours with constant agitation.

Post-hybridization processes:

[0054] The chips were washed twice in washing buffers containing 2x SSC/2% SDS at 37 ⁰C for 15 min, then twice in 0.2x SSC/0.2% SDS at 37 ⁰C for 15 min, then once in O.lx SSC at room temperature for 15 min, followed by three brief rinses in deionized H₂O. After drying, the chips were scanned by the Axon scanner 4000B (Axon Instrument/Molecular Devices, Sunnyvale, CA) at different laser channels for Cy5 and Cy3 dyes.

Data analysis:

[0055] The images and data were analyzed by the GENEPIX software 5.0 (Axon Instrument/Molecular Devices). The ratio of Cy5 to Cy3 at various chip loci was calculated.

Example 1

[0056] This experiment tested the model for detecting aneuploidies using the inventive array-based CGH. Microarrays were designed as described in Fig 1. Three trisomy cell lines (see above), for trisomy 13 (47, XX, +13), 18 (47, XX, +18) and 21 (47, XX, +21), were selected along with normal lymphocyte (46, XX) reference cells.

[0057] Genomic DNA was isolated and amplified with T7-DOP PCR as described above. The PCR products were then further amplified and labeled with Cy5 and Cy3 fluorescent dyes for the test and reference samples, respectively, by the in vitro transcription method described above. The test and reference samples with the differently labeled RNA were then mixed and added to the biochip chambers for hybridization. After post-hybridization washes, XIA - OOlPCT

the chips were scanned and data was analyzed. The ratio of Cy3 to Cy 5 signal intensity for both samples was taken and is shown in Fig 2.

Example 2

[0058] The SN-I cell line was selected to demonstrate translocation detection. Chips were designed to delineate the different possible types of translocations and are summarized in Fig 3. The experimental method was described as above. The chip images for the translocation t(l I;16)(q23;pl3) detection are displayed in Fig 4.

[0059] The genomic information on the sequences around the translocation was obtained from NCBI₅ and probes were designed for the intact break point, flanking sequences and for the fused sequence, utilizing the in-house developed software. The probes were synthesized using an ABI 394 DNA synthesizer with the DNA oligonucleotides of 40 nt length. The probes were dissolved in lOμl of 5OmM sodium phosphate buffer at pH 8.3 for a final concentration of 20 mM. The microarrays were spotted using an OmniGrid Arrayer (Genomic Solutions) with the layout pattern shown in Fig 4.a, with triplicate spots for each probe. The printed arrays were incubated overnight in a 70% humidity chamber. After blocking and repeated washes, the arrays were dried and used for hybridization assays.

[0060] Single cells from aneuploidy cell lines (see above) and from a normal lymphocyte reference were isolated and lysed. Their genomic DNA was amplified using T7-DOP PCR₅ as described above. The PCR products were then further amplified and labeled by IVT with Cy5 and Cy3, respectively. Twenty microliters of labeled RNA from each reaction for both test and reference tubes were pipetted out and mixed in a single PCR tube. Forty microliters of mixed solution were used for hybridization on the microarray chips. Hybridization was at 37 ⁰C for 15—20 hours. After post-hybridization washes, slides were dried and scanned.

[0061] An Axon scanner 4000B was used for scanning the slide at different laser channels for Cy5 and Cy3. Data analysis was performed by the GenePix Pro 5.0 software. Ratios of Cy5 and Cy3 were determined.

[0062] For trisomy cells, ratio data for all chromosomes were collected from three different cell lines, and the data are presented in Fig 2. Ratios greater than 1.33 (on average) were obtained for the extra chromosome known to be in trisomy, which is significant (p<0.05) compared to the ratio range of 0.86 - 1.16 for normal chromosome pairs.

[0063] The array design and experimental methods for translocation were described in Fig 3 and above. For translocation, the cell line SN-I was selected. This cell line has a reciprocal translocation t(l I;16)(q23;pl3), where Ilq23 was fused to 16pl3 to form a new gene. As indicated in Fig 3a, probes were designed for the breakpoint and flanking regions. Probes crossing the breakpoints were designed 11-2 and 16-2 for chromosomes 11 and 16, respectively. Upstream and downstream probes were designed in the flanking regions 11-1 and 11-3, and 16-1 and 16-3, respectively. A fused probe (fused-2) was also designed across the fusion point of the two chromosomes. Chip layout for these triple-printed probes is displayed in Fig 4a. Hybridization signals were scanned and reproduced in Figs 4b and 4c).

[0064] SN-I cells (Fig 4c) showed signals at probes -1, -3 and fused-2, but no signals at probe —2, suggesting that breaking chromosomes occurred at the position corresponding to probe —2 and that a new fused sequence had formed. In contrast, the normal reference cells (Fig 4b) presented the expected hybridization signals on all normal chromosomal probes, but not on the fused-2 probes.

Example 3

[0065] Probes for four genes (see above) on different chromosomes were designed and printed on the arrays in the formation shown in Fig 5.a. Positive and negative controls were also included. Probes were printed in triplicate.

[0066] Single lymphocytes were selected from leukemia patients. Cells were lysed, and first round genomic amplification was performed. Five microliters of amplified genetic material was transferred to a new PCR tube containing multiplex primers designed for specific translocation tests. Because four genes, MLL and AF4, and PBX and E2A from four different chromosomes were believed to be involved in translocation, four primers were designed, one based on each gene (see above). When the four primers were pooled together, they generated products for the fused genes if translocation(s) were present. Multiplex PCR was performed and the PCR products were hybridized to the microarray probes. Positive hybridization signals were observed, but negative samples did not show signals (Fig 5). Fig XIA - OOlPCT

5b shows a t(4;ll) translocation. Fig 5c shows a t(l;19) translocation. These results were also confirmed by individual uniplex PCR tests (not shown).

[0067] This invention has been described in an illustrative manner, and it is to be understood that the terminology used is intended to be in the nature of description, rather than limitation. Obviously, many modifications and variations of the present invention are possible in light of the above teachings and one of ordinary skill in the art, in light of this teaching, can generate additional embodiments and modifications without departing from the spirit of or exceeding the scope of the claims of this invention. Therefore, it is to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described. Accordingly, it is to be understood that the drawings and descriptions herein are proffered by way of example to facilitate comprehension of the invention and should not be construed to limit the scope thereof.

Claims

XIA - OOlPCTClaims

1. A comprehensive microarray for detecting major and minor chromosomal abnormalities for preimplantation genetic diagnosis (PGD) research and clinical application comprising pre-in vitro fertilization (FVF), the microarray comprising a) a surface for adhering oligonucleotide probes; b) the oligonucleotide probes on the surface said probes designed to hybridize to selected known abnormal amplified and labeled genomic DNA; and c) the oligonucleotides probes being capable of detecting at least three of aneuploidy, translocation, gene/locus amplification, insertions, deletions, reversions, short tandem repeat (STR) polymorphisms, microsatellite polymorphisms, single nucleotide polymorphisms (SNPs), single genetic mutations of selected inherited diseases, or a combination thereof.

2. A method of analyzing with a microarray chromosomal abnormalities for preimplantation genetic diagnosis (PGD) research and clinical applications comprising in vitro fertilization (IVF), the method comprising the steps of a) providing a suitable PDG microarray coated with oligonucleotide probes designed to hybridize with chromosomal abnormalities; b) providing a small sample comprising a single cell, a few cells, body fluids or a small piece of tissue; c) lysing at least one cell in the small sample to free the genomic DNA; d) amplifying the DNA to produce a nucleotide sample; e) labeling the amplified DNA to produce a labeled nucleotide sample; f) incubating the labeled nucleotide sample with the PDG microarray to permit the labeled nucleotides to hybridize to the PDG microarray g) exposing the hybridized PDG microarray to a scanner to obtain data on hybridization of the labeled nucleotides to the oligonucleotide probes; and h) subjecting the scanned data to analysis for hybridization to probes for chromosomal abnormalities.

3. The method of claim 2 wherein stepd d and e are performed as one step, in that labeling occurs as the sequences are amplified.

4. The method of claim 1, in which the microarray carries oligonucleotide probes for the detection of aneuploidy; translocation; gene/locus amplification; insertion/deletion; reversion; XIA - OOlPCT

short tandem repeat (STR) polymorphisms, microsatellite polymorphisms; single nucleotide polymorphisms (SNPs) or a combination thereof.

5. The method of claim 4, permitting the diagnosis of chromosomal abnormalities associated with at least Down syndrome, DeGeorge syndrome, phenylketonuria (PKU), sickle cell anemia, G6PD deficiency, Huntington disease, and Alzheimer's disease.

6. A kit for analyzing chromosomal abnormalities in single cells comprising a) reagents for preimplantation genetic diagnosis, said reagents comprising nucleotide sequences capable of hybridizing with known chromosomal abnormalities; and b) at least one slide with a microarray designed to hybridize with a plurality of chromosomal abnormalities, said microarray comprising a plurality of spots, each containing the same oligonucleotides; and the oligonucleotides in a spot having been designed to hybridize with a single chromosomal abnormality, corresponding normal sequence, or flanking sequences neighboring the chromosomal abnormality.

7. A process of analyzing chromosomal abnormalities in cancer using microarray technology, the process comprising a) providing a suitable microarray comprising oligonucleotide probes designed for the detection of selected known cancer cell chromosomal abnormalities; b) providing a small sample comprising a single cell, a few cells, body fluid or a small piece of tissue; c) lysing at least one cell in the small sample to release genomic DNA; d) amplifying the genomic DNA to produce a nucleotide sample; e) labeling the nucleotide sample; f) incubating the labeled nucleotide sample with the microarray to permit the labeled nucleotides to hybridize with the oligonucleotide probes; and g) exposing the hybridized microarray to a scanner equipped with software to transform the scanned data into an indication of the presence or absence of a variety of chromosome abnormalities.

8. A method of analyzing chromosomal aberrations associated with excess or missing chromosomes, the method comprising ΛiA - υυ IJfU i

a) providing a microarray comprising oligonucleotide probes for individual chromosomes; b) providing a normal control and a small sample comprising a single cell, a few cells, body fluid or a small piece of tissue in separate containers; c) lysing the control and small samples to free genomic DNA; d) priming the genomic DNA with oligos comprising RNA promoter sequences; e) amplifying the genomic DNA in the control and small samples to produce amplified nucleotides; f) labeling the amplified nucleotides in the control sample with one color of dye and in the small sample with another color of dye; g) mixing the labeled control and small samples so that the labeled nucleotides are in approximately equal quantities; h) adding mixed or non-mixed labeled sample to at least one microarray reaction chamber and incubating the samples therein to permit hybridization on the microarray; and i) scanning the hybridized microarray with at least one color laser; collecting the data therefrom and comparing the light scatter from the different lasers to determine if certain chromosomes of the test sample are present at significantly greater or lesser number than in the control sample; whereby the significantly different number of chromosomes in the test sample are interpreted as hyperploidy or trisomy and the lesser numbers of chromosomes are interpreted as hypoploidy.

9. The method of claim 8 wherein steps e and fare combined to perform amplification and labeling in a single step.

10. The method of claim 8 wherein the primer with RNA promoter sequences is selected from T7 or T3 promoters.

11. The method of claim 10 wherein an RNA polymerase is selected from T7 RNA polymerase and T3 RNA polymerase.

12. The method of claim 8, wherein the type of detectable label is a fluorescent dye or a radioactive moiety. XIA - OOlPCT

13. A method of designing and manufacturing a microarray suitable for diagnosis of chromosomal abnormalities, the method comprising a) designing sequences for oligonucleotides suitable for arraying with steps . comprising i. selecting known chromosomal sequences associated with chromosomal abnormalities, such as gene mutations associated with inherited diseases, chromosomal breaks, chromosomal trnaslocations. chromosomal or gene amplification, insertions, reversions, short tandem repeats (STR) polymorphisms, microsatellite polymorphisms, single nucleotide polymorphisms (SNPs) and combinations thereof; ii. selecting chromosomal sequences that flank the abnormality, cross the chromosomal sequence where the abnormality occurs, cross the sequence which comprises a known insertion, reversion, STR, SNP or a combination thereof; iii. selecting locations on selected or all chromosomes to be able to compare chromosomal amplifications thereof with normal samples; iv. designing a set of probes capable of hybridizing with the selected chromosomal sequences; v. testing the designed probes against known sequences in a public gene database to avoid cross-hybridization with unwanted natural nucleotides; vi. adjusting the G-C of the designed sequences for similar reaction under the same temperature, pressure and timing as the other sequences in the set; b) synthesizing the designed oligonucleoόtides as DNA, RNA, PNA, LNA or other modified molecules, and p5oviding each synthesized oligonucleotide in the set in a different container; c) providing a treated slide or beads capable of reacting with one end of the designed probes; and d) printing each probe of the set onto a unique location on the slide or beads.

14. A method of linear amplification of genomic DNA, the method comprising a) obtaining genomic DNA; b) priming genomic DNA with degenerate oligonucleotide primers (DOP) with a T7 RNA promoter sequence at the 5' end of the primers; c) reacting the DOP-primed DNA with DNA polymerase for at least one cycle to amplify by PCR; d) amplifying the PCR product with T7 RNA polymerase; and XIA - OOlPCT

e) labeling the amplified product with a detectable moiety.

15. The method of claim 14, in which T7 RNA promoter is replaced with T3 promoter and T7 RNA polymerase is replaced with T3 RNA polymerase.

16. The method of claim 14, in which steps d and e are combined for labeling during the amplification of the PCR product.