WO2011030091A1

WO2011030091A1 - Assay for candida species

Info

Publication number: WO2011030091A1
Application number: PCT/GB2010/001677
Authority: WO
Inventors: Daniel Scott Tuckwell; Deborah Ireland
Original assignee: Myconostica Limited
Priority date: 2009-09-11
Filing date: 2010-09-03
Publication date: 2011-03-17

Abstract

The invention relates to detecting six or more species of Candida in a sample. In particular, the invention relates to the rapid testing of the presence or absence of six or more species of Candida at the same time. Methods and kits are provided for testing for the presence or absence of the six or more species of Candida.

Description

ASSAY FOR CANDIDA SPECIES

Field of the Invention

fOOOlJ The invention relates to detecting six or more species of Candida in a sample. In particular, the invention relates to the rapid testing of the presence or absence of six or more species of Candida at the same time. Methods and kits are provided for testing for the presence or absence of the six or more species of Candida.

Background of the Invention

[0002] Candidaemia is a serious infection, occurring primarily in hospitalised patients, with a mortality of 35-55%. The most common infecting species is C. albicans, followed by C. glabrata, C. parapsilosis, C. tropicalis and C. krusei. These five species together cause ~99% of all human cases (Pfaller MA & Diekema DJ. Epidemiology of invasive candidiasis: a persistent public health problem. Clin Microbiol Rev 2007;20:133-63). However, several other fungi can also cause fungaemia, including other Candida species as well as Cryptococcus spp.,

Saccharomyces cerevisiae, Histoplasma capsulatum and Rhodatorula spp (e.g., Pfaller et al., 2007. Results from the ARTEMIS DISK global antifungal surveillance study, 1997-2005. J. Clin. Microbiol. 45, 1735-1745). Identification of the fungus or fungi responsible for the infection is important for the selection of antifungal therapy, as species differ in their

susceptibility to antifungals; for example Candida krusei is fluconazole resistant and

Rhodatorula spp., Histoplasma capsulatum and Cryptococcus spp. are echinocandin resistant. Differentiation of Candida and other yeast species is also important for reasons other than treatment choice, as some species are more commonly associated with contaminated IV fluids and poor aseptic technique {i.e. C. parapsilosis), probably because of carriage on healthcare workers' hands.

[0003] It has been established that a decrease in the time before diagnosis of fungal infection improves patient outcome. For example, Garey et al. showed that an patients for whom fluconazole therapy commenced on the same day that yeast was identified in their blood sample had a 15% mortality rate, whereas patients for whom there was a three day or more lag between identification and the start of therapy showed a 41 % mortality rate (Garey et al. , 2006, Time to initiation of fluconazole therapy impacts mortality in patients with candidemia: a multi- institutional study. Clin Infect Dis. 43:25-31 ; see also Aisner et al, Treatment of invasive aspergillosis: relation of early diagnosis and treatment to response. Ann Intern Med

1977;86:539-43; Caillot et al, Improved management of invasive pulmonary aspergillosis in neutropenic patients using early thoracic computed tomographic scan and surgery. J Clin Oncol. 1997 Jan; 15(1 ): 139-47; Morrell et al., Delaying the empiric treatment of Candida bloodstream infection until positive blood culture results are obtained: a potential risk factor for hospital mortality. Antimicrob Agents Chemother 2005;49:3640-5; von Eiff et al., Pulmonary aspergillosis: early diagnosis improves survival. Respiration 1995;62:341 -7).

[0004] The ability to rapidly identify a wide range of fungal species, and in particular Candida species, is therefore important for improved patient treatment and survival. A number of procedures are currently available for the identification of yeast species. These include a germ tube test that allows differentiation of C. albicans (and C. dubliniensis) from all other yeasts and the plating of positive blood cultures on to ChromAgar or other chxomogenic media which yields a presumptive identification, based primarily on colony colour, after 24 hours (Ellepola & Morrison . Laboratory diagnosis of invasive candidiasis. J Microbiol 2005; 43:65-84). Specific methods to formally identify Candida species and other yeasts include the API32C system, the VITEK system and PNA FISH system. Most of these identification methods rely on growth and therefore take a minimum of 24 hours, but typically 48 hours. Although PNA FISH is a rapid system, employing fluorescent detection, only five species are identified, and of these C.

glabrata and C. krusei are indistinguishable, as are C. albicans and C. parapsilosis. Thus a rapid test for the identification of a wide range of Candida species is still not available.

Summary of the Invention

[0005] The inventors have shown that the presence or absence of six or more species of Candida can be rapidly and reliably.determined using DNA analysis. The presence or absence of the six or more species of Candida can be determined at the same time. In other words, the inventors have shown that the presence or absence of six or more species of Candida can be determined simultaneously in a multiplex reaction.

[0006] The inventors have also shown that the presence or absence of one or more non- Candida microorganisms can be determined at the same time as the six or more species of Candida. The inventors have further developed novel probes and primers that can be used to detect the presence or absence of six or more species of Candida simultaneously in a multiplex reaction.

[0007] The inventors have developed new probes for panfungal detection. These allow the presence or absence of any fungus in a sample to be rapidly and reliably determined using DNA analysis. The inventors have also developed new probes and primers for an internal PCR amplification control. [0008] Accordingly, the invention provides a method of determining the presence or absence of six or more species of Candida in a sample, comprising:

(a) contacting the sample with primers that are capable of amplifying the Internal Transcribed Spacer 2 (ITS2) region, preferably including flanking 5.8S rRNA, of all the species of Candida under conditions that promote amplification;

(b) contacting the sample with probes which specifically hybridize to the ITS2 region of each of the six or more Candida species and at least one probe which hybridizes to the ITS2 and/or 5.8S rRNA region of all fungi and is selected from (1) probes comprising the sequences shown in SEQ ID NOs: 38 to 40 or (2) SEQ ID NOs: 38 to 40 themselves; and

(c) determining whether the probes have hybridized to an ITS2 region and thereby determining the presence or absence of each of the six or more Candida species in the sample. The invention also provides:

a kit for testing for the presence or absence of six or more species of Candida in a sample comprising probes which specifically hybridize to the ITS2 region of each of the six or more Candida species and at least one probe which hybridizes to the ITS2 and/or 5.8S rRNA region of all fungi and is selected from (1) probes comprising the sequences shown in SEQ ID NOs: 38 to 40 or (2) SEQ ID NOs: 38 to 40 themselves;

a support for testing for the presence or absence of six or more species of Candida in a sample having immobilsed thereon probes which specifically hybridize to the ITS2 region of each of the six or more Candida species and at least one probe which hybridizes to the ITS2 and/or 5.8S rRNA region of all fungi and is selected from (2) probes comprising the sequences shown in SEQ ID NOs: 38 to 40 or (2) SEQ ID NOs: 38 to 40 themselves;

a single vessel comprising the support of the invention;

a pair of primers for amplifying the ITS2 region, preferably including flanking 5.8S rRNA, of any species of Candida comprising the sequences shown in SEQ ID NOs: 42 and 43; a pair of internal control primers comprising the sequences shown in SEQ ID NOs: 44 and 45;

a probe for testing for the presence or absence of a species of Candida in a sample comprising a sequence shown in any one of SEQ ID NOs: 1 to 16 and 19 to 31 ;

a probe for testing for the presence or absence of any fungus in a sample comprising a sequence shown in any one of SEQ ID NOs: 38 to 40; and

an internal control probe comprising a sequence shown in shown in SEQ ID NO: 41. Description of the Figures

[0009] Figure 1 shows the layout of the Array showing (A) the location of spots in the array grid; and (B) the relationship between species, spot IDs and oligo names. In A, the grey squares indicate the metal markers on the array which are used for registration during image analysis.

[0010] Figure 2 shows the results from DNA purified from a blood bottle inoculated with C. albicans: A strong signal is seen with the C. albicans probe MA040 (marked with a star), though the other C. albicans probes did not give a signal.

[0011] Figure 3 shows the results from DNA purified from a blood bottle inoculated with C. glabrata: A strong signal is seen with the C. glabrata probes (marked with stars).

[0012] Figure 4 shows the results from DNA purified from a blood bottle inoculated with C. krusei: A strong signal is seen with the C. kr sei probes (marked with stars).

[0013] Figure 5 shows the results from DNA purified from a blood bottle inoculated with C. parapsilosis: A strong signal is seen with the C. parapsilosis probes (marked with a star). Note that a weak signal is also seen with the adjacent C. metapsilosis probe, and a strong signal with the C. parapsilosis group probe, as expected.

[0014] Figure 6 shows the results from DNA purified from a blood bottle inoculated with C. tropicalis: A strong signal is seen with the five C. tropicalis probes (marked with a star).

[0015] Figure 7 shows the results from A. fumigatus DNA: No signal is seen with any of the species-specific probes. A signal is seen with the 5.8S probe MA015 as this sequence is very similar in Candida species and Aspergilli.

[0016] Figure 8 shows the results from H. sapiens DNA: No signal is seen with any of the species-specific probes.

[0017] Figure 9 shows the results from E. coli DNA: No signal is seen with any of the species-specific probes.

Description of the Sequences

[0018] SEQ ID NOs: 1 to 41 shows the probes used in the Examples.

[0019] SEQ ID NOs: 1 to 3 are the probes for Candida albicans used in the Examples.

[0020] SEQ ID NOs: 4 and 5 are the probes for Candida dubliniensis used in the Examples.

[0021] SEQ ID NOs: 6 and 7 are the probes for Candida famata used in the Examples.

[0022] SEQ ID NOs: 8 to 10 are the probes for Candida glabrata used in the Examples. [0023] SEQ ID NOs: 1 1 and 12 are the probes for Candida guilliermondii used in the Examples.

[0024] SEQ ID NOs: 1 3 and 14 are the probes for Candida keyfr used in the Examples.

[0025] SEQ ID NOs: 15 and 16 are the probes for Candida krusei used in the

Examples.

[0026] SEQ ID NOs: 17 and 18 are the probes for Cryptococcus neoformans used in the Examples.

[0027] SEQ ID NO: 19 is the probe for Candida parapsilosis used in the Examples.

[0028] SEQ ID NO: 20 is the probe for Candida metapsilosis used in the Examples.

[0029] SEQ ID NO: 21 is the probe for Candida parapsilosis group used in the Examples.

[0030] SEQ ID NOs: 22 and 23 are the probes for Candida pelliculosa used in the Examples.

[0031] SEQ ID NO: 24 is the probe for Candida rugosa used in the Examples.

[0032] SEQ ID NOs: 25 to 29 are the probes for Candida tropicalis used in the Examples.

[0033] SEQ ID NOs: 30 and 31 are the probes for Candida utilis used in the Examples.

[0034] SEQ ID NO: 32 is the probe for Histoplasma capsulation used in the Examples.

[0035] SEQ ID NOs: 33 to 35 are the probes for Rhodotorula mucliaginosa used in the Examples.

[0036] SEQ ID NOs: 36 and 37 are the probes for Saccharomyces sensu stricto used in the Examples.

[0037] SEQ ID NO: 38 to 40 are the pan-fungal probes used in the Examples.

[0038] SEQ ID NO: 41 is the internal control probe used in the Examples.

[0039] SEQ ID NOs: 42 and 43 are the ITS3 and ITS4 primers used in the Examples.

[0040] SEQ ID NOs: 44 and 45 are the internal control primers used in the Examples.

Detailed Description of the Invention

[0041] It is to be understood that different applications of the disclosed methods may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.

[0042] In addition as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a method" includes "methods", reference to "a probe" includes two or more such probes, reference to "a label" includes two or more such labels, reference to "a primer" includes two or more primers, and the like.

[0043] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0044] The invention generally concerns the rapid detection and identification of six or more species of Candida in a sample. The invention allows the presence or absence of each of the six or more species of Candida or all of the six or more species to be determined or tested for at the same time. The invention therefore concerns a multiplex reaction. The invention provides a rapid indication of whether or not the sample contains each of the six or more species of Candida. A clear positive (i.e. presence) or negative (i.e. absence) result is simultaneously achieved for each species. The method makes it possible to quickly identify which species, if any, of Candida are present in a sample. The ITS2 region of all of the species of Candida present in the sample are preferably amplified at the same time (i.e. simultaneously). This preferably involves the use of a single set of primers. The sample is preferably contacted with all the probes at the same time (i.e. simultaneously). Similarly, all hybridization events are preferably detected at the same time (i.e. simultaneously). In a preferred embodiment, step (b) is carried out in a single vessel. In another preferred embodiment, steps (b) and (c) are carried out in a single vessel. In the most preferred embodiment, all of steps (a) to (c) are carried out in a single vessel.

[0045] Different species of Candida comprise different ITS2 regions. The presence of the specific ITS2 region of a species of Candida is indicative of the presence of that species in the sample. The absence of the specific ITS2 region of a species of Candida from the sample is indicative of the absence of that species from the sample. The method therefore involves detecting the presence or absence of at least six different ITS2 regions at the same time (i.e. simultaneously). One or more specifically-designed probes are used to determine the presence or absence of the ITS2 region of each of the six or more species of Candida. The method therefore involves the use of six or more probes.

[0046] If a particular probe undergoes hybridization, it indicates the presence of the specific ITS2 region against which the probe has been designed and hence the presence of the species of Candida comprising that ITS2 region. If a particular probe fails to undergo hybridization, it indicates the absence of the specific ITS2 region against which the probe has been designed and hence the absence of the species of Candida comprising that ITS2 region. [0047J As demonstrated in the Examples, the method of the invention can be carried out in about 4 hours (excluding an extraction of DNA or RNA). Hence, the method of the invention takes considerably less time than previous methods, which take a minimum of 24 hours, but typically 48 hours. The ability to rapidly identify the presence or absence of a number of different species of Candida in a sample from a patient is important for improved patient treatment and survival. Identification of the fungus or fungi responsible for an infection allows the antifungal therapy to be tailored to the needs of the patient. The rapid nature of the method of the invention is advantageous because the delaying of treatment of patients infected with Candida severely increases their mortality rate.

Species of Candida

[0048] The method of the invention comprises determining the presence or absence of six or more species of Candida in a sample. The method may involve determining the presence or absence of any number of species, such as 10, 15 or 20 or more species. The method preferably involves determining the presence or absence of 14 species of Candida.

[0049] The six or more species of Candida are of course different from one another. The species differ in their ITS2 regions. There are sufficient differences between the sequences of the ITS2 regions of different species of Candida to allow probes to be designed that specifically hybridize to the ITS2 region of one species. This allows the presence or absence of a particular species to be determined in accordance with the invention.

[0050] The six or more species of Candida may be selected from any of the species of Candida. The six or more species of Candida can be selected from Candida albicans, Candida catenulata (also known as Candida brumptii and Candida ravautii), Candida ciferrii, Candida dubliniensis, Candida famata, Candida glabrata, Candida guilliermondii, Candida haemulonii, Candida inconspicua, Candida keyfyr, Candida krusei, Candida lusitaniae, Candida lipolytica, Candida metapsilosis, Candida norvegensis, Candida norvegica, Candida orthopsilosis, Candida parapsilosis, Candida pelliculosa, Candida pseudotropicalis, Candida rugosa, Candida tropicalis, Candida utilis, Candida viswanathii, Candida norvegensis, and Candida zeylanoides.

[0051] The six or more species of Candida are preferably selected from the following fourteen species: Candida albicans, Candida dubliniensis, Candida famata, Candida glabrata, Candida guilliermondii, Candida kefyr, Candida krusei, Candida parapsilosis, Candida metapsilosis, Candida orthopsilosis, Candida pelliculosa, Candida rugosa, Candida tropicalis and Candida utilis. The six or more species of Candida are most preferably those fourteen species. ITS2 and its amplification

[00521 The method of the invention comprises the step of contacting the sample with primers that are capable of amplifying the ITS2 region, and preferably flanking 5.8S rRNA, of any Candida species under conditions that promote amplification. This will of course result in the amplification of the ITS2 region of any Candida species present in the sample.

[0053] The ITS2 region is a component of the ribosomal DNA region; this encodes the 28S, 18S and 5.8S ribosomal RNAs which are components of the ribosomes. The three ribosomal RNAs are separated by two non-coding regions, ITS1 , between 18S and 5.8S, and ITS2, between 5.8S and 28S. Initially the whole ribosomal region is transcribed, after which the ITS regions are spliced out. The ribosomal DNA region is present as multiple identical concatenated repeats (Huang et al., Ribosomal chromatin organisation, Biochem Cell Biol. 2006, 84, 444-449)

[0054] Conditions that promote amplification by primers are well-known to a person skilled in the art. For instance, suitable conditions are disclosed in the Examples.

[0055] In one embodiment, the ITS2 region, and preferably flanking 5.8S rRNA, itself is amplified and detected using at least one probe. In another embodiment, RNA transcribed from the ITS2 region is amplified and detected using at least one probe. The presence in the sample of RNA transcribed from a specific ITS2 region is itself indicative of the presence of the specific ITS2 and hence the specific species in the sample.

[0056] All or part of the ITS2 region or RNA transcribed from the ITS2 region can be amplified. If part is amplified, at least 20, at least 25, at least 30 or at least 50 contiguous nucleotides are amplified to allow the ITS2 regions of the different species to be distinguished from one another in accordance with the invention. For instance, 10, 20, 30 or 40 or more contiguous nucleotides may be amplified.

[0057] In one embodiment, only the ITS2 region or a part thereof is amplified. In other embodiments, the ITS2 region to is amplified as part of a much larger length of fungal DNA or RNA. Sequences of DNA or RNA having at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400 , at least 500 , at least 600 , at least 700 , at least 800 , at least 900 or at least 1000 nucleotides and comprising the region to be detected can be amplified. For example, sequences having from 10 to 2000, from 20 to 1500, from 50 to 1000 or from 100 to 500 nucleotides can be amplified. [0058] The ITS2 region or the RNA transcribed therefrom is typically extracted from fungal cells present in the sample before it is detected. The ITS2 region can be extracted using routine methods known in the art. For instance, suitable methods for extracting fungal DNA are disclosed in Fredricks et al., J. Clin. Microbiol., 2005; 43(1): 5122-5128, US Patent Application No. 2002/01 15077, and US Patent No. 6,605,439. Suitable methods of extracting fungal RNA are disclosed in the art, such as the lithium chloride purification method disclosed in Sambrook et al., 2001 , Molecular Cloning: a laboratory manual, 3^rd edition, Cold Spring Harbour

Laboratory Press. Kits for the extraction of fungal RNA, such as the RNeasy mini kit (Qiagen), are also commercially available.

[0059] The ITS2 region is typically amplified in step (a) before its presence is detected in steps (b) and (c). However, the region may detected in real time as it is amplified. Real-time methods have been described in the art. Such methods are described in, for example, U.S. Patent 5,487,972 and Afonia et al. (Biotechniques, 2002; 32: 946-9).

[0060] The DNA or RNA of the ITS2 region can be amplified using routine methods that are known in the art. The amplification of fungal DNA is preferably carried out using polymerase chain reaction (PCR) or nucleic acid sequence based analysis (NASBA). Suitable methods for PCR are disclosed in, for example, US Patent No. 6,605,439, EP-B-0979312 and Buchheidt et al. (British Journal of Haematology, 2002; 1 16: 8030811).

[0061] A suitable method for the amplification of fungal DNA by NASBA is described in Widjojoatmodjo et al., J. Microbiol. Methods, 1999; 38(1-2): 81-90.

[0062] Fungal RNA can be amplified using routine methods in the art, such as reverse transcription-PCR.

[0063] The method of the invention relies of hybridization of the probes to the specific ITS2 regions of each species of Candida. If DNA is being amplified, it is preferred that only one strand of the DNA is amplified. This results in the production of single-strand DNA that can easily hybridize to the probes. Suitable methods for amplifying single strands of DNA are known in the art. The method preferably involves asymmetric PCR. One way of performing asymmetric PCR is disclosed in the Examples. Other suitable methods for asymmetric PCR are also disclosed in Gyllensten & Erlich, Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus (1988) Proc. Natl. Acad. Sci. USA 85, 7652-7656.

[0064] A person skilled in the art will be able to design specific primers to amplify the ITS2 region or RNA transcribed therefrom. Primers are normally designed to be complementary to sequences at either end of the sequence to be amplified but not complementary to any other sequences. Primer design is discussed in, for example, Sambrook et al., 2001, supra.

[0065] Primers that can amplify the ITS2 region of various species of Candida are disclosed in, for example, White et al., 1990 in "Innis et ai, PCR Protocols " Academic Press ", pages315-322; Bouchara et al., 2009, Development of an oligonucleotide array for direct detection of fungi in sputum samples frompatients with cystic fibrosis. J. Clin. Microbiol. 47, 142-152..

[0066] In a preferred embodiment, step (a) is carried out using a single set of primers that are capable of amplifying the ITS2 region of all the species of Candida. In other words, the amplification step is preferably carried out using just two primers that are capable of amplifying the ITS2 region of all the species of Candida. Most preferably, the primers are capable of amplifying the ITS2 region of all known species of Candida. As discussed below, internal control primers may be used in addition to the primers that are capable of amplifying the ITS2 region of all the species of Candida.

[0067] The sample is most preferably contacted with the primers shown in SEQ ID NOs: 42 and 43 or a pair of primers, one of which comprises the sequence shown in SEQ ID NO: 42 and the other of which comprises the sequence shown in SEQ ID NO: 43.

Probes

[0068] Any ITS2 region that is amplified in the method of the invention is detected using one or more probes that specifically hybridizes to the ITS2 region. Hence, for each species of Candida that needs to be detected in accordance with the invention, at least one probe which specifically hybridizes to the ITS2 region of that species is contacted with the sample. This means that the sample is contacted with at least six probes.

[0069] For each species of Candida that needs to be detected in accordance with the invention, more than one probe, such as 2, 3 or 4 probes, which specifically hybridize to the 1TS2 region of that species may be contacted with the sample. This means that the sample can be contacted with more than six probes. The method may involve contacting the sample with any number of probes, such as 10, 20, 30, 40, 50 or more probes. The increased number of probes per species increases the sensitivity of the method. Multiple probes per species is particularly helpful when trying to distinguish between species with very similar ITS2 regions.

[0070] The method comprises contacting the probes with the sample under conditions in which the probes specifically hybridize to their respective ITS2 regions, if present, and determining the presence or absence of the hybridization products. The presence of a hybridization product indicates the presence of the ITS2 region and hence the corresponding species of Candida. Conversely, the absence of a hybridization product indicates the absence of the ITS2 region and hence the corresponding species of Candida.

[0071] The probe is typically a nucleic acid, such as DNA, RNA, PNA or a synthetic nucleic acid. A probe specifically hybridizes to the ITS2 region of a species of Candida if it preferentially or selectively hybridizes to the ITS2 region of that species but does not hybridize to the ITS2 region of another species of Candida being tested in the method. Some promiscuity between different species of Candida is allowed in accordance with the invention. However, if probes are promiscuous between different species of Candida, those species cannot be distinguished from one another using the invention. Under those circumstances, the method simply indicates whether or not any of those species are present. For instance, as discussed in the Examples, SEQ ID NOs: 1 1 and 12, which were designed for Candida guilliermondii, are also likely to hybridize to Candida fermentatii, Candida fukuyamensis and Candida smithsonii. Hence, a method of the invention using SEQ ID NOs: 1 1 and 12 can indicate whether or not one of those four species are present, but cannot indicate which ones are present. The use of at least five additional probes that are specific for different species will of course allow the presence or absence of six or more different species to be determined.

[0072] Preferably, a probe specifically hybridizes to the ITS2 region of a species of Candida if it preferentially or selectively hybridizes to the ITS2 region of that species but does not hybridize to the ITS2 region of any other species of Candida. More preferably, the probe does not hybridize to any other DNA or RNA sequences.

[0073] The probe preferably specifically hybridizes to the ITS2 region of a species of Candida under stringent conditions. Conditions that permit the hybridization are well-known in the art (for example, Sambrook et al. , 2001, Molecular Cloning: a laboratory manual, 3^rd edition, Cold Spring Harbour Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al, Eds., Greene Publishing and Wiley-lnterscience, New York (1995)). Step (b) of the method of the invention can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaCl and 1 % SDS (sodium dodecyl sulfate) at 37°C followed by a wash in from IX (0.1650 M Na⁺) to 2X (0.33 M Na⁺) SSC (standard sodium citrate) at 50°C. Step (b) of the method of the invention can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaCl, and 1 % SDS at 37°C, followed by a wash in from 0.5X (0.0825 M Na⁺) to IX (0.1650 M Na⁺) SSC at 55°C. Step (b) of the method of the invention can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 M NaCl, 1% SDS at 37°C, followed by a wash in 0.1X (0.0165 M Na⁺) SSC at 60°C. Step (b) is preferably carried out using QIHyb Hybridisation Buffer for 60 minutes at 58°C (as in the Examples).

{0074] The probe can be the same length as, shorter than or longer than the ITS2 region. The probe is typically at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 45, at least 50, at least 75 or at least 100 nucleotides in length. For example, the probe can be from 5 to 200, from 7 to 100, from 10 to 50 nucleotides in length. The probe is preferably 5, 10, 15, 20, 25, 30, 35 or 40 . nucleotides in length. The probe preferably includes a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% homology identity based on sequence identity with the ITS2 region.

[0075] Those skilled in the art will appreciate that sequence heterogeneity is observed within species of Candida and that different species show different degrees of heterogeneity for different sequences. However, the following Genbank entries are provided as examples of ITS2 sequences: C. albicans DQ347484; C. glabrata AY669333; C. krusei EF568017; C. parapsilosis EF568035; C. tropicalis EF568042.

[0076] Standard methods in the art may be used to determine homology. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al, Nucleic Acids Research, 1984; 12: 387- 395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul J ol Evol, 1993; 36: 290-300; Altschul, et al (J Mol Biol, 1990; 215: 403-10). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information

(http : //www . ncbi .nlm .nih. gov/) .

[0077] The probes can be detectably-labelled. The detectable label allows the presence or absence of the hybridization product formed by specific hybridization between the probes and the corresponding ITS2 regions (and thereby the presence or absence of the species) to be determined. Any label can be used. Suitable labels include, but are not limited to, fluorescent molecules, radioisotopes, e.g. ^I251, ³⁵S, enzymes, antibodies and linkers such as biotin.

[0078] The probe can be a scorpion probe, which is a probe linked to primer. The primer part of the probe can be designed to amplify the region of ITS2 to be detected and the probe part can designed to detect the amplified region. Scorpion probes are well-known in the art. They are described in, for example, Whitcombe et al. (Nat. Biotechnol., 1999; 17: 804-807). [0079] The probe can be a molecular beacon probe. Molecular beacon probes comprise a fluroescent label at one end and a quenching molecule at the other. In the absence of the region to be detected, the probe forms a hairpin loop and the quenching molecule is brought into close proximity with the fluorescent label so that no signal can be detected. Upon hybridization of the probe to the region to be detected, the loop unzips and the fluorescent molecule is separated from the quencher such that a signal can be detected. Suitable fluorescent molecule and quencher combinations for use in molecular beacons are known in the art. Such combinations include, but are not limited to, carboxyfluorsecein (FAM) and dabcyl.

[0080] The ITS2 region can be detected using TaqMan PCR. This technique is well- known in the art.

[0081] The probes are preferably immobilised on a support using any technology which is known in the art. Suitable solid supports are well-known in the art and include plates, such as multi well plates, filters, membranes, beads, chips, pins, dipsticks and porous carriers. The probes may be immobilised on a support using any technology which is known in the art. The probes are most preferably immobilsed on a support in a single vessel. This allows one or more of the steps of the multiplex method to be carried out in a single vessel. Suitable supports include Clondiag's ArrayTube system®, which comprise a chip within a vial. Hybridization is detected using colorimetirc staining technology. The probes are preferably immobilised on the support in fixed and known positions.

[0082] The method of the invention is preferably carried out using probes comprising any of the sequences shown in SEQ ID NOs: 1 to 16 and 1 to 31. The method of the invention is more preferably carried out using any of the probes shown in SEQ ID NOs: 1 to 16 and 19 to 31.

[0083] If one of the six or more species is Candida albicans, the method preferably comprises contacting the sample with 1, 2 or 3 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 1 , 2 and 3 or (2) SEQ ID NOs: 1, 2 and 3 themselves.

[0084] If one of the six or more species is Candida dubliniensis, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 4 and 5 or (2) SEQ ID NOs: 4 and 5 themselves.

[0085] If one of the six or more species is Candida famata, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 6 and 7 or (2) SEQ ID NOs: 6 and 7 themselves. [0086] If one of the six or more species is Candida glabrata, the method preferably comprises contacting the sample with 1, 2 or 3 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 8 to 10 or (2) SEQ ID NOs: 8 to 10 themselves.

[0087] If one of the six or more species Candida guilliermondii, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 11 and 12 or (2) SEQ ID NOs: 1 1 and 12 themselves.

[0088] If one of the six or more species is Candida keyr, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1 ) probes comprising the sequences shown in SEQ ID NOs: 13 and 14 or (2) SEQ ID NOs 13 and 14 themselves.

[0089] If one of the six or more species Candida krusei, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1 ) probes comprising the sequences shown in SEQ ID NOs: 15 and 16 or (2) SEQ ID NOs: 15 and 16 themselves.

[0090] If one of the six or more species is Candida parapsilosis, the method preferably comprises contacting the sample with a probe comprising SEQ ID NO: 19 or SEQ ID NO; 19 itself.

[0091] If one of the six or more species is Candida metapsilosis, the method preferably comprises contacting the sample with a probe comprising SEQ ID NO: 20 or SEQ ID NO: 20 itself.

[0092] If one of the six or more species is Candida orthopsilosis, the method preferably comprises contacting the sample with probes comprising SEQ ID NOs: 19 and 20.

[0093] If one of the six or more species is Candida parapsilosis, Candida metapsilosis or Candida orthopsilosis, the sample with a probe comprising SEQ ID NO: 21 or SEQ ID NO: 20 itself. This probe will detect all three species and will not distinguish between them.

[0094] If one of the six or more species is Candida pelliculosa, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 22 and 23 or (2) SEQ ID NOs: 22 and 23 themselves.

[0095] If one of the six or more species is Candida rugosa, the method preferably comprises contacting the sample with a probe comprising SEQ ID NO: 24 or SEQ ID NO: 24 itself.

[0096] If one of the six or more species is Candida tropicalis, the method preferably comprises contacting the sample with 1, 2, 3 or 4 probes selected from (1 ) probes comprising the sequences shown in SEQ ID NOs: 25 to 29 or (2) SEQ ID NOs: 25 to 29 themselves. [0097] If one of the six or more species is Candida utilis, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 30 and 31 or (2) SEQ ID NOs: 30 and 31 themselves.

[0098] Any combinations of probes comprising the sequence shown in SEQ ID NOs: 1 to 16 and 19 to 31 and/or the probes shown in SEQ ID NOs: 1 to 16 and 19 to 31 may be used in accordance with the invention. The method of the invention preferably involves determining the presence or absence in a sample of Candida albicans, Candida dubliniensis, Candida famata, Candida glabrata, Candida guilliermondii, Candida kefyr, Candida krusei, Candida

parapsilosis, Candida metapsilosis, Candida orthopsilosis, Candida pelliculosa, Candida rugosa, Candida tropicalis and Candida utilis and comprises contacting the sample with 29 probes comprising the sequences shown in SEQ ID NOs: 1 to 16 and 19 to 31 or SEQ ID NOs: 1 to 16 and 19 to 31 themselves. The method of the invention most preferably involves determining the presence or absence in a sample of Candida albicans, Candida dubliniensis, Candida famata, Candida glabrata, Candida guilliermondii, Candida kefyr, Candida krusei, Candida parapsilosis, Candida metapsilosis, Candida orthopsilosis, Candida pelliculosa, Candida rugosa, Candida tropicalis and Candida utilis and comprises contacting the sample with 41 probes comprising the sequences shown in SEQ ID NOs: 1 to 41 or SEQ ID NOs: 1 to 41 themselves. This latter embodiment includes panfungal detection and an internal control as discussed below.

Determining hybridization

[0099] The method of the invention involves deteremining whether the probes have hybridized to an ITS2 region. The method relies on being able to simultaneously detect at least six hybridization events (i.e. at least one hybridization event for each of the species of Candida being detected). Methods for doing this are known in the art. The most common method is colorimetric detection. Such detection may use cyanine dyes or other fluorescent molecules, or streptaviding peroxidase and a colourimetric stubstrate such as TMB or Seramun Griin®. One preferred method of simultaneously detecting multiple hybridization events is disclosed in the Examples.

[0100] In a preferred embodiment, the probes are immobilised on a solid support, such as a chip, in fixed positions. Since the position of a particular probe is known, it will be possible to tell whether or not that probe has undergone hybridization and hence whether or not the corresponding species of Candida is present. This embodiment is particularly helpful if each hybridization event is detected in the same way, for instance by colorimetric detection or using a detectable label. Immobilisation of the probes is discussed in more detail above.

Panfungal probes

[0101] If the method of the invention indicates the absence of any of the six of more species of Candida, it will of course be helpful to know if any other genera or species of fungus are present in the sample. Hence, the method further comprises in step (b) contacting the sample with at least one probe, such as 2 or 3 probes, which hybridize to the ITS2 and/or 5.8S rRNA region of all fungi. The method comprises contacting the sample with at least one probe, such as 2 or 3 probes, selected from (1) probes comprising the sequences shown in SEQ ID NOs: 38 to 40 or (2) SEQ ID NOs: 38 to 40 themselves.

Internal control

[0102] The ITS 2 region or RNA transcribed therefrom is extracted from fungal cells and or clinical samples and so may be contaminated with one or more factors that interfere with the amplification and/or detection steps. For this reason, the ITS2 region is typically detected in the presence of an internal PCR amplification control. This ensures that any DNA present in the sample is amplified correctly. The internal PCR amplification control preferably comprises a non-fungal sequence. The ITS2 region is preferably detected in the presence of a cloned or synthesized tRNA-LEU intron region added to the amplification mixture in a predetermined amount to rule out the presence of inhibitors or other defective amplification steps. The tRNA- LEU intron region preferably comprises a portion of the Maize (Zea mayis) tRNA-LEU intron region is known in the art and is disclosed as SEQ ID NO: 9 in International Application No. PCT US2007/023043 (published as WO 2008/063370). The sequence of the Maize {Zea mayis) tRNA-LEU intron region lacks homology with any sequence present in humans or pathogenic fungal species. The internal PCR amplification control preferably involves carrying out the amplification step in the presence of the primers comprising the sequences shown in SEQ ID NOs: 44 and 45 or SEQ ID NOs 44 and 45 themselves. The detection step is preferably carried out in the presence of a probe comprising the sequence shown in SEQ ID NO: 41 or SEQ ID NO: 41 itself.

Sample [0103] The method of the invention gives an indication of the fungus-containing status of the sample. The method indicates that one or more of the species of Candida are present or none of the species of Candida are present.

(0104) The method can be carried out on any sample. In one embodiment, the sample is a non-biological sample. Specific types of sample are discussed in more detail below. The method is typically carried out on a sample whose Cimd ifa-containing status is not known. In other words, the method is typically carried out when it is not known whether or not a sample contains a Candida. The method is preferably carried out on a sample that is suspected of containing a species of Candida. The method can be carried out on a sample that is known to contain a fungus or Candida to confirm the presence of a specific species of Candida.

[0105] Samples may be obtained from biological or non-biological sources. For example the biological source samples can include, but are not limited to, a biological fluid, tissue, or a combination of any two or more thereof. Non-biological sources may include, but are not limited to samples obtained from the environment. For example, some non-biological sources may include an air sample, a water sample, a soil sample, or combinations thereof. Non- biological sources may also include a piece of a vehicle, watercraft, aircraft, building, or dwelling.

[0106] The sample used in the invention may be any suitable sample. The invention is typically carried out on a biological sample. The invention is preferably carried out in vitro on a biological sample. The biological sample can be obtained from or extracted from any organism. The organism is typically eukaryotic and can belong the plantae kingdom or the animalia kingdom. The sample can be a colony of fungus.

[0107] The sample is preferably a fluid sample. The sample typically comprises a body fluid. The sample may be urine, lymph, saliva, cerebrospinal fluid, peritoneal fluid, pericardial fluid, vitreous or other ocular sample, plural fluid, vaginal fluid, mucus, pus or amniotic fluid but is preferably blood, plasma or serum. The sample can be a cell or tissue sample, such as lung, brain, liver, skin or nails.

[0108] Typically, the sample is human in origin, but alternatively it may be non-human. For instance, the sample can be from animals such as from commercially farmed animals such as horses, cattle, sheep or pigs or may alternatively be pets such as cats or dogs. The sample can also be from other organisms, such as insects. The sample can be from a human or non-human animal undergoing treatment with an anti-fungal agent.

[0109] The invention can also be carried out on a non-biological sample. The non- biological sample can be a fluid or a solid. Examples of a non-biological sample include surgical fluids, air, water such as drinking water, reagents for laboratory tests and household containers. The sample may also be a particle collection device containing air, water, another liquid or a material.

[110] The sample may be a blood culture in which the presence of a fungus is suspected. The blood culture may be manual or automated.

[0111] The sample is typically processed prior to being used in the invention, for example by centrifugation or by passage through a membrane that filters out unwanted molecules or cells, such as red blood cells. The sample may have undergone polymerase chain reaction before being used in the invention. The sample may be measured immediately upon being taken. The sample may also be stored prior to assay, preferably below -70°C.

Non-Candida microorganisms

[0112] In addition to the six or more species of Candida, it may also be helpful to determine if the sample contains other microorganisms. For instance, an infection in a patient may be caused by a non-Candida microorganism, such as Saccharomyces spp. The method of the invention preferably further comprises testing the presence or absence of one or more non- Candida microorganisms. Any number of microorganisms can be investigated, such 2, 3, 4, 5, 10 or more.

[0113] In such embodiments, the primers are capable of amplifying the ITS2 region of the microorganism(s). In addition, the detection step further comprises contacting the sample with probes which specifically hybridize to the ITS2 region of each of the non-Candida

microorganisms. The same principles discussed above with reference to the species of Candida equally apply to the non-Candida microorganisms.

[0114] In a preferred embodiment, the one or more non-Candida microorganisms are selected from Cryptococcus neoformans, Histoplasma capsulatum, Rhodotorula mucliaginosa and Saccharomyces sensu stricto. In such instances, the method of the invention preferably uses probes comprising any of the sequences shown in SEQ ID NOs: 17, 18 and 32 to 37 or more preferably using any of the probes shown in SEQ ID NOs: 17, 18 and 32 to 37.

[0115] If the non-Candida microorganism is Cryptococcus neoformans, the method preferably comprises contacting the sample with 1 or 2 probes selected from (1 ) probes comprising the sequences shown in SEQ ID NOs: 17 and 18 or (2) SEQ ID NOs 1 and 18 themselves. [0116] If the non-Candida microorganism is Histoplasma capsulatum, the method preferably comprises contacting the sample with a probe comprising the sequence shown in SEQ ID NO: 32 or SEQ ID NO: 32 itself.

[0117] If the non-Candida microorganism is Rhodotorula mucliaginosa, the method preferably comprises contacting the sample with 1 , 2, or 3 probes selected from (1 ) probes comprising the sequences shown in SEQ ID NOs: 33, 34 and 35 or (2) SEQ ID NOs: 33, 34 and 35 themselves.

[0118] If the non-Candida microorganism is Saccharomyces stricto sensu, the method preferably comprises contacting the sample the sample with 1 or 2 probes selected from (1) probes comprising the sequences shown in SEQ ID NOs: 36 and 37 or (2) SEQ ID NOs 36 and 37 themselves.

Products

[0119] The invention also provides various products for carrying out the methods of the invention. In particular, the invention provides:

a kit for testing for the presence or absence of six or more species of Candida in a sample comprising probes which specifically hybridize to the ITS2 region of each of the six or more Candida species;

a support for testing for the presence or absence of six or more species of Candida in a sample having immobilsed thereon probes which specifically hybridize to the ITS2 region of each of the six or more Candida species;

a single vessel comprising the support of the invention;

a pair of primers for amplifying the ITS2 region of any species of Candida comprising the sequences shown in SEQ ID NOs: 42 and 43;

a pair of internal control primers comprising the sequences shown in SEQ ID NOs: 44 and 45;

a probe for testing for the presence or absence of a species of Candida in a sample comprising the sequence shown in any one of SEQ ID NOs: 1 to 16 and 19 to 31 ;

a probe for testing for the presence or absence of any fungus in a sample comprising the sequence shown in any one of SEQ ID NOs: 38 to 40; and

an internal control probe comprising the sequence shown in shown in SEQ ID NO: 41.

[0120] Any of the embodiments discussed above with reference to the method of the invention are equally applicable to the products of the invention . [0121] The kits of the invention preferably further comprise reagents for extracting fungal DNA or RNA from a sample and/or primers that can be used to amplify the region of fungal DNA and/or an internal control for the amplification and detection stages. The internal control preferably comprises the portion of the Maize (Zea mayis) tRNA-LEU intron region discussed above, the pair of oligonucleotides primers shown in SEQ ID NOs: 44 and 45 and the probe shown in SEQ ID NO: 46.. The kit may additionally comprise one or more other reagents or instruments which enable the method of the invention as described above to be carried out. Such reagents or instruments include one or more of the following: suitable buffer(s) (aqueous solutions), means to obtain a sample from the subject (such as a vessel or an instrument comprising a needle) or a support comprising wells on which reactions can be done. Reagants may be present in the kit in a dry state such that a fluid sample resuspends the reagents. The kit may, optionally, comprise instructions to enable the kit to be used in a method of the invention.

Uses of the Invention

[0122] The invention concerns the detection and identification of six or more species of Candida in a sample. The invention can therefore be used for the diagnosis of a fungal infection in a patient or the identification of a fungus in a patient sample where the presence of a fungus is suspected. The invention can also be used to determine the presence of a fungus in or on any non-biological product and hence the likelihood that the product will cause a fungal infection. There are many situations in which it is important to ensure that a non-biological sample is fungus free. Examples include drinking water and liquids used in laboratories. In particular, the invention may be used to pretest the components in a fungal diagnostic kit to ensure the components are free from fungal nucleic acid (i.e. a quality control step). Other uses of the invention are clear to a person skilled in the art.

[0123] It is understood that the present invention is not limited to the preferred embodiments and examples presented herein, which serve only to illustrate certain aspects of the invention to one of ordinary skill in the art. Other embodiments of the invention, which would be apparent to those of ordinary skill, are considered to fall within the scope and spirit of the invention. Examples

Example 1 - Design of oligonucleotide probes and primers

[0124] The Array Tubes comprise a glass surface ("chip") printed with DNA probes, located in the bottom of a 1.5 ml tube. Labelled sample DNA can be hybridized to the chip, and bound samples detected using a colourimetric step. The first stage in the development of the array is therefore the design of probes to specifically identify the chosen organisms. The Array Tube technology typically tolerates only one base mismatch between probes and templates, although this would be dependent on hybridization conditions. Probes were therefore designed to match this level of discrimination.

[01251 The DNA encoding 18S, 5.8S and 28S ribosomal RNA has been widely used for the design of probes to identify organisms at the species and genus level. Within this region, different levels of variation are seen, thus much of the 18S rRNA is well conserved and has been used for identification at the genus level (Loeffler et al, 2001 , Nucleic acid sequence-based amplification of Aspergillus RNA in blood samples. J. Clin. Microbiol 39, 1626-1629;

Wellinghausen et al , 2009, Rapid diagnosis of candidaemia by real-time PCR detection of Candida DNA in blood samples, J. Med Microbiol. 58, in press), whereas the sequences between the rRNA genes (ITS 1 and ITS2) are more variable and have been used for the identification at the species level (Bouchara et al, 2009, Development of an oligonucleotide array for direct detection of fungi in sputum samples from patients with cystoc fibrosis, J. Clin. Microbiol 47, 142-152; Campa et al., 2008, DNA microarray based on arrayed-primer extension technique for identification of pathogenic fungi responsible for invasive and superficial mycoses, J. Clin.

Microbiol. 46, 909-915; Elie et al, 1998, Rapid identification of Candida species with species- specific DNA probes, J. Clin. Microbiol. 36, 3260-3265; Playford et al, 2006, Simultaneous detection and identification of Candida, Aspergillus, and Cryptococcus species by reverse line blot hybridization. J. Clin. Microbil. 44, 876-880).

[0126] Initially, 18S sequences were examined to see whether these were suitable for the design of Candida species-specific probes, however, it was found that there was insufficient discrimination at the species level. Examination of probes for a broad range of Candida species indicated that the ITS2 region was be suitable for the design of species-specific probes. These are described below.

[0127] A number of methods were used for the design and checking of probes, the modification of probe sequences, and the checking of parameters such as melting point and percentage GC. Identification by BLAST: The ITS2 sequence for an organism of a given species was identified by a text search at NCBI. This sequence was then used as a query for a nucleotide BLAST search, at NCBI, specifying 'Nucleotide collection nr/nt' as the database, and giving the species name in the 'Organism' entry field. Examination of the blast results indicated regions of variation within the ITS2 sequence, e.g., substitutions, insertions or deletions. Probes were designed to avoid or accommodate these, based on the known tolerance of the Array Tube system. Poor blast matches (e.g., with more than four or five differences) were examined further to understand whether the differences were due to poor quality sequence data or genuine heterogeneity within the species. In the case of the latter, the heterogeneity could be covered by a specific probe sequence.

[0128] Examination of alignments: An alignment of ITS sequences was generated from fungal ITS sequences taken from NCBI. Examination of sequences identified regions that were conserved within a particular species, but differeing in others, which could be used as the basis for probe design.

[0129] Automated probe design: PERL scripts were used to compute all possible probe sequences with given properties, i.e., a length of 20-50 bases and a T of 59-61 °C from a given ITS2 sequence. These putative probes could then be evaluated further using the above methods.

[0130] Checking for true and false positives: Prospective probe sequences were used as queries in BLAST and the output examined to see whether perfect matches and matches with 1 or 2 differences were annotated as the correct species. Matches annotated as a different species were examined further using BLAST to determine whether the sequence had been annotated with the wrong species name, or whether the probe had an unwanted cross-reactivity. The results of the BLAST search with the probe could also be compared with the the results of BLAST searches with the complete ITS region to determine whether a probe detected all examples of a given species.

[0131] Calculating Tm: Probe Tms were calculated using the method of Santa-Lucia (SantaLucia , 1998, A unified view of polymer, dumbbell and oligonucleotide DNA nearest- neighbor thermodynamics. Proc. Natl. Acad. Sci., 95, 1460-65).

[0132] Automated probe checking: PERL scripts were used to compare each probe with a set of ITS sequences obtained from NCBI, e.g., from yeasts, filamentous fungi,

basidiomycetes, human and mouse, and to quantify the number of mismatches. The program could also be used to check primers. [0133] Probes were designed and checked, using the above methods, to maximise the coverage of sequence variation observed within a species or group, and to minimise detection of related species. Probes for the following organisms were produced (alternative species names are given in brackets where appropriate): Candida albicans, Candida dubliniensis, Candida famata (D. hansenii), Candida glabrata, Candida guilliermondii, Candida kefyr (K. marxianus), Candida krusei (I. orientalis), Candida parapsilosis, Candida metapsilosis, Candida

parapsilosis group, Candida pelliculosa (Pichia anomala), Candida rugosa, Candida tropicalis, Candida utilis, Cryptococcus neoformans, Histoplasma capsulatum, Rhodotorula mucliaginosa, and Saccharomyces sensu stricto. Details of the final probe designs are given in Table 1.

Table 1 - Probes used

SEQ ID Probe

Sequence Species

No name

1 MA001 ATTGCTTGCGGCGGTAACGTCC C. albicans

2 MA040 GTAAGGCGGGATCGCTTTGACAATGG C. albicans

3 A041 AAACATTGCTTGCGGCGGTAACGT C. albicans

4 MA003 TTGCTAAGGCGGTCTCTGGCGT C. dubliniensis

5 MA042 TAAGGCGGAGATGCTTGACAATGGCT C. dubliniensis

6 MA009 TCCAACTCGTTGAATAGTTTAATGGTATATTTCTCGGTATTC C. famata

7 MA052 TGAGTGGTACTGGATAGTGCTATATGACTTTCAATG C. famata

8 MA011 TGTATTAGGTTTTACCAACTCGGTGTTGATCTAGG C. glabrata

9 MA047 GGACACGAGCGCAAGCTTCTCTATT C. glabrata

10 MA048 TTAATCTGCTGCTCGTTTGCGCGA C. glabrata

11 MA010 CGTTGAATGGTGTGGCGGGATATTTCTG C. guilliermondii

12 MAO 53 TAGTACTGGATAGTGCTGTCGACCTCTCA C. guilliemiondii

13 MA008 GGTCATAGAGACTCATAGGTGTTATAAAGACTCGC C. kefyr

14 MAO 51 GTGAGTGATACTCGTCTCGGGTTAACTTGAAAG C. kefyr

15 MA006 AGCTGGCCGAGCGAACTAGACTTTT C. krusei

16 MA046 TGTAAAGAGCGTCGGAGCTGCGA C. krusei

17 MA027 AAATGTGTTAGTGGGAAGGTGATTACCTGTCAG C. neoformans

18 MA028 TAGTCTTCGGCTTGCTGATAACAACCATC C. neoformans

19 MA013 CTCATTGGTACAAACTCCAAAACTTCTTCCAAATTC C. parapsibsis

20 MA014 CTCATTGGTACAAACTCCAAACATTCTTCCAAATTC C. metapsilosis

21 C. parapsibsis

MA049 GCTTGAAAGAAAG GCGG AGTATAAACTAATGG ATAGG

group

22 MA036 TCCAACTCGTTATATCAGCTAGGCAGGTTTAGAAG C. pelliculosa

23 MA037 GACTTAGCAAGAGTGTACTAATAAGCAGTCTTTCTGAAAT C. pelliculosa

24 MAO 35 CTCTCTCGCAAGGTGTTGGGCA C. rugosa

25 MA004 TCCAAAACGCTTATTTTGCTAGTGGCCAC C. tropicalis

26 MA005 TCCAAAACGCTTATTTTGTTAGTGGCCAC C. tropicalis

27 MA043 GCGACTTAGGTTTATCCAAAAACGCTTATTTTGC C. tropicalis

28 MA044 GCGACTTAGGTTTATCCAAAACGCTTATTTTGC C. tropicalis

29 MA045 ACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCC C. tropicalis

30 MA038 TGAAATACTCTAGGCAGAGCTCCCCCT C. utilis

31 MA039 CTCGTTATTTTCCAGACAGACTTCCAGGCAG C. utilis

32 MA032 AGTGGCGGTGTCGAGTTCCG H. capsulatum

33 MA029 GCATTAGCATCCGCAATCGAACTTCGG R. mucliaginosa

34 MAO 30 AGCCGGGTTGGGTTAAAGGAAGCTT R. mucliaginosa

35 MA031 CCCTC CTCTTTCTTAATG ATTGAAGAGGTGTTTG G R. mucliaginosa

36 Saccharomyces

MA033 GAGAGGTTTCTCTGCGTGCTTGAG GTATAAT

sensu stricto

37

MA034 GAGCGTATTGGAACGTTATCGATAAGAAGAGAGC Saccharomyces sensu stncto

38 MA015 GTGAATCATCGAATCTTTGAACGCACATTGC Pan-fungal

39 MA016 GTGAATCATCAAATCTTTGAACGCACATTGCG Pan-fungal

40 MA017 GTGAATCATCGAGTTCTTGAACGCACATTG Pan-fungal

41 MA018 TG GGCAATCCTGAGCC AAATCCCTTT Internal Control

[0134] P. guilliermondii: Database searches and examination of alignments indicated that P. guilliermondii ITS2 was only 1 -2 bases different to sequences annotated as P. carabbica (also known as C. fermentatii); C. carpophila (also known as C. fukuyamensis or C. xestobii); and C. smithsonii. The probes designed to match P. guilliermondii would therefore in many cases also match sequences from these other organisms.

[0135J C. krusei: BLAST searches with C. krusei ITS sequences gave a number of matches which were not annotated as "C. krusei", e.g. some sequences were annotated as P. cecembensis, C. inconspicua, or P. sporocuriosa. This is probably due to a lack of consistency and there appears to be some confusion in the taxonomy and nomenclature of C. krusei

(Kurtzman et al., 2008, Phylogenetic relationships among species ofPichia, Issatchenkia and Williopsis determined from multigene sequence analysis, and the proposal of Barnettozyma gen. nov., Lindnera gen. nov. and Wicker hamomyces, FEMS Yeast Res 8, 939-954).

[0136J C. parapsilosis group: This group is made up of three organisms, C.

parapsilosis, C. metapsilosis and C. orthopsilosis. Probes MAO 13 and MAO 14 were designed to detect and discriminate between the three species by exploiting the discriminating power of the Array Tube system, while MA 049 was designed to detect all three as it bound to a shared region (Table 2).

Table 2 - Properties if the C. parapsilosis group probes: For each probe, binding and absence of binding are indicated by a '+' and '-' respectively, while the bracketed number indicates the number of mismatches between the probe and target sequence. The Array Tube system is relatively insensitive to one base difference but more sensitive to two bases difference.

[0137] Saccharomyces sensu stricto: This is a very closely related group of organisms which includes S. cerevisiae (Edwards-Ingrams et al., 2004, Genome Res. 14, 1043-1051 ; van der Aa et al., 2003, Sys Apl Microbiol 26, 564-571).

[0138] Cryptococcus species: The three Cryptococcus species neoformans, grubii and gattii have identical ITS2 sequences, and therefore the probes designed against C. neoformans would detect all three species.

[0139] Broad-range probes: To provide positive controls which should cover the range of species that have been chosen, probes MA015-MA017 were designed against the conserved 5.8S region. MA015 was designed to detect the majority of organisms under investigation, and MA016 and MA017 were based on this but modified to cover organisms that would be missed by MA015.

[0140] Internal amplification control: for details see below. A plasmid containing the Zea mays chloroplast tRNA-Leu was used as an internal control, and probe MAO 18 was designed to detect this. (0141 | Primers ITS3 and ITS4 (White et al., 1990 in "Innis et al, PCR Protocols " Academic Press ", pages315-322) amplify the ITS2 region and were found to be suitable for the amplification of ITS2 from a range of Candida species. The primer pair was also checked against the other organisms to which probes were designed, i.e., Cryptococcus neoformans, Histoplasma < capsulatum and Rhodotorula spp., and in all cases the primers were seen to match well with few or no mismatches and should thus give a PCR product under normal conditions. The primers were subsequently refered to as PanF and PanR:

SEQ ID o 42: ITS3: PanF: CGA TCG ATG AAG AAC GCA GC

SEQ ID No. 43 : ITS4: PanR: TCC TCC GCT TAT TGA TAT GC

I [0142] Calculation of the properties of these primers indicated that they would function in an asymmetric PCR without any modfication. The primers for the internal control were as follows:

SEQ ID No. 44: ICF AAC CTG CTA AGT GGT AAC TTC CA

SEQ ID No. 45: ICR GAG TCT CTG CAC CTA TCC T

[0143] Arrays were manufactured by Clondiag (Jena) using the oligonucleotide probes described above (manufactured by Metabion, Munich). The array layout is shown in Figure 1.

Example 2 - ArravTubes method

[0144] Condititions for the optimal performance of the Array Tubes were determined by extensive optimisation of components and conditions. A range of PCR reagents and conditions were investigated; different hybridization buffers and hybridization conditions were explored; and the array method was tested with DNA from all the species represented on the chip. For the major five Candida species, twenty isolates of each species were tested. The optimised conditions and the process employed for identifying species from an organism are described

; below. The assay can be completed within 4 hours, excluding the extraction stage. The method includes an internal amplification control (IAC): An internal control was employed to enable identification of inhibiting substances in the sample, and to provide a process check for the inadvertant omission of target or problems with the target preparation. The IAC was presented as a pUC19 based plasmid carrying a chloroplast tRNA-Leu gene from Zea mays. Specific

I primers (ICF and ICR) were included for the IAC (see above). [0145] The PCR reagents used were as follows:

[0146] Other reagents used were :

Pre-wash; Water

Hybridisation Buffer; Qlhyb (Qinstruments, Jena)

Washl ; 0.5% SDS; 2x SSC

Wash2; 0.5% SDS; 0.5x SSC

Final Wash; 0.2x SSC

Blocker; Universal blocker, UCDB (STD, Aachen)

Conjugate; Streptavidin polyHRP40, SP40C) (STD, Aachen) diluted 1.TOO in

Streptavidin conjugate stabiliser SA1 (STD, Aachen). This stock is suitable for storage at 4°C, and is then diluted 1 : 80 in Blocker prior to use.

Substrate; epTMB-ma (STD, Aachen)

[0147] Samples were prepared from blood cultures (e.g. the BioMerieux BacT/ ALERT system) using the MycXtra kit (Myconostica, Manchester, UK), according to the manufacturers instructions, except that 1 mL starting volume was used as opposed to the 800 μΐ. given in the instructions. Details for samples directly from colonies on plates are given below.

[0148] For each sample to be tested, 27.0 iL of Tube 1 and 21.0 μL of Tube 2 were aliquotted into a 0.2 ml PCR tube, followed by 2.0 μL of the DNA sample to be tested. For colony PCRs, a colony was picked using a sterile cocktail stick and mix briefly into PCR reaction components in the tube. For no-template controls 2.0 ]ih water was used instead of the DNA. Tubes were briefly vortexed and then centrifuged. The PCR tubes were placed in an AB Veriti or Bio-Rad CFX-96 PCR machine and PCRs carried out with the following parameters: 95°C for 10 minutes; 40 cycles of 94°C x 15 seconds, 56°C x 15 seconds, 72°C x 30 seconds; then 72°C for 5 minutes; then 4°C indefinite.

[0149] Thermomixers (RiO or Eppendorf) were pre-heated to 58°C and a shaking speed of 550rpm, and hybridization buffer was pre-warmed in a thermal shaker for a minimum of 10 minutes. ArrayTubes were washed with 500 of Pre- Wash for 5 minutes at 58°C and 550rpm.

[0150] The pre-wash was removed from the ArrayTubes and 100 μΐ, of pre-warmed Hybridisation Buffer added to each ArrayTube, followed by incubation for 5 minutes in a thermal shaker at 58°C and 550 rpm. 5 μΐ, of labeled PCR product was then added directly to the hybridization buffer in the Array Tube, and the tubes were incubated in a thermal shaker for 60 minutes at 58°C and 550 rpm (for samples from colony PCRs, the PCR product was diluted 1 :20 in Hybridisation Buffer and 5 iL of this dilution was added to the ArrayTube containing the Hybridisation Buffer). The Hybridisation Buffer was removed from the ArrayTubes, and 500 iL of pre-warmed Wash 1 was added. Array Tubes were then incubated in a thermal shaker for 5 minutes at 58°C and 550 rpm. This step was repeated, and then two further washes were carried out using Wash 2 with the same conditions.

[0151] Wash 2 buffer was removed from the ArrayTubes, 100 μΐ_^ of Blocker added, and tubes incubated in a thermal shaker for 15 minutes at 25°C and 550 rpm. Blocker was then removed and 100 μL· of Conjugate added. ArrayTubes were then incubated in a thermal shaker for 15 minutes at 25°C and 550rpm. After this, the Conjugate was removed and tubes washed once with 500 of Wash 1 for 5 mins in a thermal shaker at 25°C and 550 rpm, once with Wash 2, and once with Final Wash, using the same conditions in both cases. After removal of the Final Wash 100 μΐ, of Substrate was added to each ArrayTube, and the tubes were incubated in a thermal shaker for 5 minutes at 25°C and 550 rpm. ArrayTubes were read using a Clondiag ATR03 ArrayTube Reader connected to a computer running the Clondiag IconoClust software. Iconoclust was also used to analyse and display the data.

[0152] Investigation of the background levels seen with the array indicated that samples should register a signal of above 0.2 to be confidently called as positive. Studies of numerous isolates indicated that, while some isolates of a given particular species gave a signal with all the probes specific for that species, others only gave a signal with some or even one of the probes. In some cases this was due to sequence heterogeneity within the species. The presence of a signal with a single species-specific probe was therefore considered sufficient to call a positive. [01S3J BacT/ALERT standard aerobic blood culture bottles were inoculated with Candida organisms, after which samples were prepared and arrays run as described above. Data are shown for the five major Candida species (C. albicans, C. glabrata, C. krusei, C.

parapsilosis, and C. tropicalis) in Figures 2-6 respectively. In all cases a strong and specific signal was seen enabling unequivocal identification of the organism to the species level. Similar results were seen for all other species represented on the chip. When samples that should give a negative result were run in the array test (A. fumigatus, H. sapiens and E. coli) no specific signal was observed (Figures 7 and 8).

[0154] In conclusion, the Array tube system enables specific identification of and discrimination between yeasts, with no signal from other potentially contaminating organisms. This system will be of value in the identification of the causative agent of Candidaemia and other blood-borne fungal infections, and thus help inform the choice of antifungal therapy.

Claims

1. A method of determining the presence or absence of six or more species of

Candida in a sample, comprising:

(a) contacting the sample with primers that are capable of amplifying the Internal Transcribed Spacer 2 (ITS2) region of all the species of Candida under conditions that promote amplification;

(c) determining whether the probes have hybridized to an ITS2 region and thereby determining the presence or absence of each of the six or more Candida species in the sample.

2. The method of claim 1 , wherein the six or more species of Candida are selected from Candida albicans, Candida dubliniensis, Candida famata, Candida glabrata, Candida guilliermondii, Candida kef r, Candida krusei, Candida parapsilosis, Candida metapsilosis, Candida orthopsilosis, Candida pelliculosa, Candida rugosa, Candida tropicalis and Candida utilis.

3. The method of claim 1 or 2, wherein the probes which specifically hybridize to the ITS2 region of each of the six or more Candida species comprise any of the sequences shown in SEQ ID NOs: 1 to 16 and 19 to 31.

4. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida albicans and step (b) comprises contacting the sample with 1 , 2 or 3 probes selected from probes comprising the sequences shown in SEQ ID NOs: 1, 2 and 3.

5. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida dubliniensis and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 4 and 5.

6. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida famata and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 6 and 7.

7. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida glabrata and step (b) comprises contacting the sample with 1 , 2 or 3 probes selected from probes comprising the sequences shown in SEQ ID NOs: 8 to 10.

8. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida guilliermondii and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 1 1 and 12.

9. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida keyr and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 13 and 14.

10. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida krusei and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 15 and 16.

11 . The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida parapsilosis and step (b) comprises contacting the sample with a probe comprising the sequence shown in SEQ ID NO: 19.

12. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida metapsilosis and step (b) comprises contacting the sample with a probe comprising the sequence shown in SEQ ID NO: 20.

13. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida orthopsilosis and step (b) comprises contacting the sample with probes comprising the sequences shown in shown in SEQ ID NOs: 19 and 20.

14. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida parapsilosis, Candida metapsilosis or Candida orthopsilosis and step (b) comprises contacting the sample with a probe comprising the sequence shown in SEQ ID NO: 21.

15. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida pelliculosa and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 22 and 23.

16. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida rugosa and step (b) comprises contacting the sample with a probe comprising the sequence shown in SEQ ID NO: 24.

17. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida tropicalis and step (b) comprises contacting the sample with 1 , 2, 3, 4 or 5 probes selected from probes comprising the sequences shown in SEQ ID NOs: 25 to 29.

18. The method of any one of the preceding claims, wherein one of the six or more species of Candida is Candida utilis and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 30 and 31.

19. The method of any one of the preceding claims, in which step (a) is carried out using a single pair of primers that are capable of amplifying the ITS2 region of all the species of Candida.

20. The method of any one of the preceding claims, wherein the primers are SEQ ID NOs: 42 and 43.

21. The method of any one of the preceding claims, wherein step (a) comprises carrying out asymmetric PCR.

22. The method of any one of the preceding claims, wherein step (a) is carried out in the presence of one or more internal PCR amplification controls to ensure appropriate amplification of any nucleic acid present in the sample.

23. The method of claim 22, wherein step (a) is carried out in the presence of a cloned or synthesized tRNA-LEU intron region, which is added to the amplification mixture in a predetermined amount to rule out the presence of inhibitors or other defective amplification steps.

24. The method of claim 23, wherein the tRNA-LEU intron region comprises a portion of the Maize {Zea mayis) tRNA-LEU intron region.

25. The method of claim 24, wherein step (a) is carried out in the presence of primers comprising the sequences shown in SEQ ID NOs: 44 and 45.

26. The method of claim 24 or 25, wherein step (b) further comprises contacting the sample with a probe that comprises SEQ ID NO: 41.

27. The method of any one of the preceding claims, wherein (i) step (b) or (ii) steps (b) and (c) are carried out in a single vessel.

28. The method of any one of the preceding claims, wherein the method further comprises testing the presence or absence of one or more non-Candida microorganisms, the primers are capable of amplifying the ITS2 region of the one or more non-Candida

microorganisms and step (b) further comprises contacting the sample with probes which specifically hybridize to the ITS2 region of each of the non-Candida microorganisms.

29. The method of claim 28, wherein the one or more non-Candida microorganisms are selected from Cryptococcus neoformans, Histoplasma caps latum, Rhodotorula

mucliaginosa and Saccharomyces sensu stricto.

30. The method of claim 29, wherein the probes comprise any of the sequences shown in SEQ ID NOs: 17, 18 and 32 to 37.

31. The method of claim 28 to 30, wherein the non-Candida microorganism is Cryptococcus neoformans and step (b) comprises contacting the sample with 1 or 2 probes selected from probes comprising the sequences shown in SEQ ID NOs: 17 and 18.

32. The method of any one of claims 28 to 31 , wherein the non-Candida

microorganism is Histoplasma capsulatum and step (b) comprises contacting the sample with a probe comprising the sequence shown in SEQ ID NO: 32.

33. The method of any one of claims 28 to 32, wherein the non-Candida

microorganism is Rhodotorula mucliaginosa and step (b) comprises contacting the sample with 1 , 2, or 3 probes selected from probes comprising the sequences shown in SEQ ID NOs: 33, 34, and 35.

34. The method of any one of claims 28 to 33, wherein the non-Candida

microorganism is Saccharomyces stricto sensu and step (b) comprises contacting the sample with 1 or 2 probes comprising the sequence shown in SEQ ID NOs: 36 and 37.

35. A kit for testing for the presence or absence of six or more species of Candida in a sample comprising probes which specifically hybridize to the ITS2 region of each of the six or more Candida species and at least one probe which hybridizes to the ITS2 and/or 5.8S rRNA region of all fungi and is selected from (1) probes comprising the sequences shown in SEQ ID NOs: 38 to 40 or (2) SEQ ID NOs: 38 to 40 themselves.

36. The kit of claim 35, wherein the probes are as defined in any one of claims 3 to 18.

37. A support for testing for the presence or absence of six or more species of Candida in a sample having immobilsed thereon probes which specifically hybridize to the ITS2 region of each of the six or more Candida species and at least one probe which hybridizes to the ITS2 and/or 5.8S rRNA region of all fungi and is selected from (1) probes comprising the sequences shown in SEQ ID NOs: 38 to 40 or (2) SEQ ID NOs: 38 to 40 themselves.

38. The support of claim 37, wherein the probes are as defined in any one of claims 3 to 18.

39. A single vessel comprising the support of claim 37 or 38.

40. A pair of primers for amplifying the ITS2 region of any species of Candida comprising the sequences shown in SEQ ID NOs: 42 and 43.

41. A pair of internal control primers comprising the sequences shown in SEQ ID NOs: 44 and 45.

42. A probe for testing for the presence or absence of a species of Candida in a sample comprising a sequence shown in any one of SEQ ID NOs: 1 to 16 and 19 to 31.

43. A probe for testing for the presence or absence of any fungus in a sample comprising a sequence shown in any one of SEQ ID NOs: 38 to 40.

44. An internal control probe comprising a sequence shown in shown in SEQ ID NO:

41.