WO2012106579A1

WO2012106579A1 - Amino acid dehydrogenase and its use in preparing amino acids from keto acids

Info

Publication number: WO2012106579A1
Application number: PCT/US2012/023740
Authority: WO
Inventors: Animesh Goswami; Steven L. Goldberg; Robert M. Johnston; Ronald L. Hanson; William Lawrence Parker
Original assignee: Bristol-Myers Squibb Company
Priority date: 2011-02-03
Filing date: 2012-02-03
Publication date: 2012-08-09

Abstract

The instant invention provides a novel amino acid dehydrogenase can be utilized to convert keto acids to amino acids more efficiently and in a more cost effective manner. The instant invention also provides knock-out cells which lack glutamate dehydrogenase.

Description

AMINO ACID DEHYDROGENASE AND ITS USE IN PREPARING AMINO ACIDS FROM KETO ACIDS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. provisional application serial number 61/439,044 filed February 3, 201 1.

FIELD OF THE INVENTION

[0002] This invention relates to novel compositions that can be used in the process of preparing amino acids from keto acids. This invention also relates to methods of synthesizing amino acids through the use of said novel compositions.

BACKGROUND OF THE INVENTION

[0003] Alzheimer's disease (AD) is a progressive neurodegenerative disease which begins with memory loss and progresses to include severe cognitive impairment, altered behavior, and decreased motor function (Grundman, M. et al, Arch Neurol, 61 :59-66 (2004); Walsh, D.M. et al, Neuron, 44: 181-193 (2004)). It is the most common form of dementia and represents the third leading cause of death after cardiovascular disorders and cancer. The cost of AD is enormous and includes not only the suffering of the patients and families but also the lost productivity of patients and caregivers. No treatment that effectively prevents AD or reverses the clinical symptoms and underlying pathophysiology is currently available.

[0004] A definitive diagnosis of AD for a demented patient requires a

histopathological evaluation of the number and localization of neuritic plaques and neurofibrillary tangles upon autopsy (Consensus recommendations for the postmortem diagnosis of Alzheimer's disease. Neurobiol. Aging, 18:S1-S2 (1997)). Similar alterations are observed in patients with Trisomy 21 (Down syndrome). Plaques primarily consist of β-amyloid (Αβ) peptides that are formed by a stepwise proteolytic cleavage of the amyloid precursor protein (APP) by β-site APP-cleaving enzyme (BACE), to generate the N-terminus, and γ-secretase, to generate the C-terminus (Selkoe, D.J., Physiol. Rev., 81 :741-766 (2001)). γ-Secretase is a transmembrane protein complex that includes Nicastrin, Aph-1, PEN-2, and either Presenilin-1 (PS-1) or Presenilin-2 (PS-2) (Wolfe, M.S. et al., Science, 305: 11 19-1 123 (2004)). PS-1 and PS-2 are believed to contain the catalytic sites of γ-secretase.

[0005] Αβ40 is the most abundant form of Αβ synthesized (80-90%), while Αβ42 is most closely linked with AD pathogenesis. In particular, mutations in the APP, PS-1, and PS-2 genes that lead to rare, familial forms of AD implicate Αβ42 aggregates as the primary toxic species (Selkoe, D.J., Physiol. Rev., 81 :741-766 (2001)). Current evidence suggests that oligomeric, protofibrillar and intracellular Αβ42 play a significant role in the disease process (Cleary, J.P. et al, Nat. Neurosci., 8:79-84 (2005)). Inhibitors of the enzymes that form Αβ42, such as γ-secretase, represent potential disease-modifying therapeutics for the treatment of AD.

[0006] The conversion of keto acid to amino acid by amino acid dehydrogenase (AADH) can be utilized to generate key intermediates for γ-secretase inhibitors (Patel, R.N., Biomol. Eng., 17: 167-182 (2001)). In one step of the oxidation reaction, AADH oxidizes an a-amino acid to an a-keto acid. However, the reverse of this step, which is the conversion of a-keto acid to a-amino acid, is actually more useful for synthesis. This reverse reaction requires one equivalent of the co-factor NADH or NADPH which in turn is oxidized to NAD or NADP, respectively. In order to minimize cost, the co-factor for this reaction may be regenerated in situ by using another enzyme, e.g., glucose dehydrogenase (GDH). GDH oxidizes glucose to gluconolactone with the concomitant reduction of NAD or NADP to NADH or NADPH, respectively. Performing the AADH- catalyzed reaction in the presence of GDH and one equivalent of glucose also utilizes much less co-factor for the reaction.

[0007] The chiral amino acid, (R)-5,5,5-trifluoronorvaline is a key intermediate for a γ-secretase inhibitor that can be used for the treatment of Alzheimer's disease. The intermediate, also known as (R)-5,5,5-trifluoro-2-aminopentanoic acid, can be prepared from the corresponding keto acid, 5,5,5-trifluoro-2-oxopentanoic acid, via an AADH catalyzed reaction. This enzymatic reaction generates the amino acid (R)-5,5,5- trifluoronorvaline which can then be isolated from the reaction mixture. Alternatively, the amino acid from the AADH reaction may be converted to a sulfonamide and isolated. The sulfonamide may then be converted to the acid chloride and then to the amide which is a key intermediate for the γ-secretase inhibitor drug candidate. [0008] Thus, the instant invention provides a novel AADH and a recombinantly cloned GDH that can be utilized to convert keto acids to amino acids more efficiently and in a more cost effective manner. The instant invention also provides knock-out

Escherichia coli (E. coll) cells which lack glutamate dehydrogenase (gdhA).

BRIEF SUMMARY OF THE INVENTION

[0009] In one aspect, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence according to SEQ ID NO: 12. In another aspect, the invention provides a recombinant vector comprising the isolated nucleic acid molecule comprising a nucleotide sequence according to SEQ ID NO: 12. In another aspect, the invention provides a recombinant host cell comprising said recombinant vector. In one embodiment, the recombinant host cell is an E. coli cell. In another embodiment, the E. coli cell does not express glutamate dehydrogenase (gdhA).

[0010] In another aspect, the invention provides an isolated polypeptide comprising an amino acid sequence according to SEQ ID NO: 1 1. In one embodiment, the polypeptide has amino acid dehydrogenase (AADH) activity. In another aspect, the invention provides a recombinant vector comprising the isolated nucleic acid molecule comprising a nucleotide sequence according to SEQ ID NO: 12 and a glucose dehydrogenase (GDH) gene according to SEQ ID NO: 13. In another aspect, the invention provides a recombinant host cell comprising said vector. In one embodiment, the host cell is E. coli. In another embodiment, the E. coli cell does not express gdhA.

[0011] In another aspect, the invention provides a method of converting a keto acid to an amino acid using the AADH of the present invention. In one embodiment, the amino acid is (R)-5,5,5-trifluoronorvaline.

[0012] In another aspect, the invention provides a bacterial cell which expresses the isolated nucleic acid molecules according to SEQ ID NO: 12 and SEQ ID NO: 13. In a preferred embodiment, the bacterial cell does not express gdhA.

[0013] In another aspect, the invention provides a method of making an amino acid, said method comprising: contacting a keto acid with a polypeptide comprising an amino acid sequence according to SEQ ID NO: 1 1 in the presence of a nicotinamide cofactor, said polypeptide being capable of catalyzing the conversion of the keto acid into its corresponding amino acid. In one embodiment, the polypeptide comprises SEQ ID NO: 11. In another embodiment, a GDH enzyme is added for nicotinamide cofactor regeneration. In another embodiment, the amino acid sequence of the GDH enzyme comprises SEQ ID NO: 14. In another embodiment, both the AADH and GDH are expressed in the same recombinant E coli cells. In another embodiment, the E coli cells do not express gdhA. In another embodiment, an ammonia or a source of ammonia is added. In another embodiment, the keto acid is 5,5,5-trifluoro-2-oxopentanoic acid. In another embodiment, the amino acid is (R)-2-amino-5,5,5-trifluoropentanoic acid (which is also known as (R)-5,5,5-trifluoronorvaline). In another embodiment, the amino acid is further converted to an amino acid derivative selected from the group consisting of (R)-2- (4-chlorophenylsulfonamido)-5,5,5-trifluoropentanoic acid, (R)-2-(4- chlorophenylsulfonamido)-5,5,5-trifluoropentanoic acid chloride and (R)-2-(4- chlorophenylsulfonamido)-5,5,5-trifluoropentanamide.

BRIEF DESCRIPTION OF THE TABLES

[0014] Table 1 shows the results of protein extracts assayed for their ability to catalyze the oxidative deamination of meso-2,6-diaminopimelate (DAP A) to (S)-a- amino-e-ketopimelate.

[0015] Table 2 shows the oligonucleotide primers prepared based upon the putative Gluconobacter oxydans (G. oxydans) GDH sequence.

[0016] Table 3 shows the results of protein samples assayed for the ability to catalyze reductive amination.

[0017] Table 4 shows the results of the AADH and gdhA assay

[0018] Table 5 shows the results of the gdhA assay from wild type and gdhA knockout cells.

[0019] Table 6 shows the yields of various compounds from conversion reactions.

BRIEF DESCRIPTION OF THE FIGURES

[0020] Figure 1 shows the process used for generating an amino acid from a keto acid and the subsequent conversions of the amino acid to the sulfonamide, to the sulfonamide acid chloride, and to the sulfonamide amide.

[0021] Figures 2A and 2B show the nucleotide sequence (SEQ ID NO:3,

GENBANK® accession number AB030649.1) and amino acid sequence (SEQ ID NO:4, GENBANK® accession number BAB07799) of the Bacillus sphaericus (B. sphaericus) DAPD. In Figure 2A, the start codon (ATG) and the stop codon (TAA) are underlined.

[0022] Figure 3 shows the amino acid alignment of DAPD isolated from B.

sphaericus ATCC 4525 and that reported for Cornybacterium glutamicum (SEQ ID NOs: 5 and 6, respectively).

[0023] Figure 4 shows the amino acid sequence of the AADH of the present invention (SEQ ID NO: 11). The amino acids that were mutated from the B. sphaericus DAPD enzyme are underlined.

[0024] Figure 5 shows the nucleotide sequence of the AADH of the present invention (SEQ ID NO: 12). The start codon (ATG) and the stop codon (TAA) are underlined.

[0025] Figure 6 shows the nucleotide sequence of GDH (SEQ ID NO: 13) cloned from G. oxydans.

[0026] Figure 7 shows the amino acid sequence of GDH (SEQ ID NO: 14) cloned from G. oxydans.

DETAILED DESCRIPTION OF THE INVENTION

[0027] The present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the invention and the Examples included herein. Various terms relating to the polypeptides, methods and other aspects of the present invention are used throughout the specification and claims. Such terms are to be given their ordinary meaning in the art unless otherwise indicated.

[0028] The present invention is directed to novel polynucleotides and polypeptides that are capable of catalyzing the conversion of a keto acid to an amino acid. The present invention is also directed to methods of producing amino acids by reductive amination of the corresponding keto acid through the use of these novel polypeptides.

[0029] Wild-type DAPD enzyme from B. sphaericus has little or no activity toward the reductive amination of keto acids to produce amino acids. In contrast, the present invention is based on the discovery that certain mutated forms of the B. sphaericus DAPD enzyme are capable of catalyzing the stereoselective reductive amination of a keto acid to produce an amino acid (Figure 1). Thus, in one aspect, the present invention provides a novel AADH enzyme that has been generated by evolution of the meso-α,ε- diaminopimelate dehydrogenase (DAPD) enzyme of B. sphaericus through mutagenesis. The amino acid and nucleic acid sequences are represented in SEQ ID NOs: l 1 and 12, respectively. Specifically, the AADH of the present invention has activity to convert a keto acid to an amino acid as demonstrated in Table 1.

[0030] Rozell et al. have demonstrated that it is possible to evolve a DAPD enzyme capable of catalyzing the reductive amination of 2-keto acids to (R)-amino acids (Rozell, J.D. et al., J. Am. Chem. Soc, 128: 10923-10929 (2006)) into a broad host. However, the native enzyme in that study bore very little resemblance to that of B. sphaericus DAPD from which the AADH of the present invention was evolved. In particular, Rozell's AADH was only 50% identical at the amino acid level to the DAPD enzyme of B.

sphaericus.

[0031] As stated, the AADH polynucleotides and/or polypeptides of the invention are useful in the amination of a keto acid to form an amino acid. In one embodiment, the AADH enzyme of the present invention can be utilized to generate a key intermediate for a gamma secretase inhibitor. In another embodiment, the present invention encompasses a novel AADH polypeptide comprising the amino acid sequence of SEQ ID NO: 1 1 as shown in Figure 4. More specifically, the AADH polypeptide of SEQ ID NO: 11 is 326 amino acids in length and has 95% amino acid identity with the DAPD enzyme of B. sphaericus from which it was evolved.

[0032] There are several methods known to generate potential enzymes that catalyze specific reactions of interest. For example, diverse populations of enzymes can be found in microorganisms harvested from different environments. These microorganisms can be cultured, and their DNA extracted, amplified by PCR, and cloned into a host for expression of the enzymes. Alternatively, various molecular biology techniques, such as mutagenesis, shuffling, molecular breeding, and gene reassembly, can be used to create vast numbers of mutant versions of an enzyme encoded by a known gene. Examples of gene shuffling and molecular breeding are described in U.S. Patent Nos. 5,605,793, 5,81 1,238, 5,830,721, 5,837,458, 5,965,408, 5,958,672, 6,001,574, and 6, 117,679, all incorporated herein by reference. Examples of methods for constructing large numbers of mutants are described in U.S. Patent Nos. 6,001,574, 6,030,779, and 6,054,267, also incorporated herein by reference.

[0033] The AADH enzyme of the present invention requires a nicotinamide cofactor (NADPH or NADH) which is recycled by an appropriate nicotinamide cofactor recycle system. In the practice of the invention, the nicotinamide cofactors can be used in equimolar quantities relative to the target ketone, keto acid, amine or amino acid, or the cofactors may be recycled, if desired. Numerous methods for the recycling of nicotinamide cofactors are well-known in the art, and any of these methods may be used in the practice of the present invention. Some of the methods for recycling nicotinamide cofactors are described in Lemiere, G.L. et al, Tetrahedron Letters, 26:4257 (1985); in Schneider, M., ed., Enzymes as Catalysts for Organic Synthesis, pp. 19-34, Reidel Dordecht (1986); in Shaked, Z. et al, J. Am. Chem. Soc., 102:7104-7105 (1980); and Jones, J.B. et al, Can. J. Chem., 62:77 (1984); the disclosures of which are incorporated herein by reference.

[0034] An example of such a nicotinamide cofactor recycle system includes an NAD⁺ or NADP⁺-dependent formate dehydrogenase using inexpensive formate as the reductant, an NAD⁺ or NADP⁺-dependent GDH and glucose as the reductant or any other similar system. One advantage of this recycle system is that the reaction allows amino acids to be prepared in a single step. Other advantages of this recycle system include the use of inexpensive, readily available starting materials, a 100% theoretical yield, a 100% enantiomeric excess of the chiral amino acid, and no harmful by-products (other than volatile CO_2,, or water soluble gluconic acid) that must be removed in downstream purification steps.

[0035] Once potential enzymes have been generated, the enzymes are tested for activity on the desired substrate, or target compound. Because many enzymes such as AADH require nicotinamide cofactors for optimal activity, detection of the oxidation or reduction of the cofactor can be used as a signal of enzyme activity.

[0036] Also encompassed by the present invention are polynucleotide sequences that are capable of hybridizing to the novel AADH nucleic acid sequence as set forth in SEQ ID NO: 12 under various conditions of stringency. Hybridization conditions are typically based on the melting temperature (T_m) of the nucleic acid binding complex or probe (see, Wahl, G.M. et al, Meth. Enzymol, 152:399-407 (1987) and Kimmel, A.R., Meth.

Enzymol, 152:507-51 1 (1987)), and may be used at a defined stringency. For example, included in the present invention are sequences capable of hybridizing under moderately stringent conditions to the AADH sequence of SEQ ID NO: 12 and other sequences which are degenerate to those which encode the novel AADH polypeptide. For example, a non- limiting example of moderate stringency conditions include prewashing solution of 2X SSC, 0.5% SDS, l .OmM EDTA, pH 8.0, and hybridization conditions of 50 °C, 5XSSC, overnight.

[0037] In another embodiment of the present invention, polynucleotide sequences or portions thereof which encode an AADH polypeptide or peptides can comprise recombinant DNA molecules to direct the expression of AADH polypeptide products, peptide fragments, or functional equivalents thereof, in appropriate host cells. As will be appreciated by those having skill in the art, it may be advantageous to produce AADH polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce a recombinant RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.

[0038] The nucleotide sequences of the present invention can be engineered using methods generally known in the art in order to alter the AADH polypeptide-encoding sequences for a variety of reasons, including, but not limited to, alterations which modify the cloning, processing, and/or expression of the gene product. DNA shuffling by random fragmentation, PCR reassembly of gene fragments and synthetic oligonucleotides may be used to engineer the nucleotide sequences. For example, site-directed mutagenesis may be used to insert new restriction sites, alter glycosylation patterns, change codon preference, produce splice variants, or introduce mutations, and the like.

[0039] In another embodiment of the present invention, natural, modified, or recombinant nucleic acid sequences encoding the AADH polypeptide may be ligated to a heterologous sequence to encode a fusion (or chimeric or hybrid) protein. For example, a fusion protein may comprise an amino acid sequence that differs from SEQ ID NO: 1 1 only by conservative substitutions. A fusion protein may also be engineered to contain a cleavage site located between the AADH protein-encoding sequence and the heterologous protein sequence, for example a GDH sequence, so that the AADH protein may be cleaved and purified away from the heterologous moiety.

[0040] In a further embodiment, sequences encoding the AADH polypeptide may be synthesized in whole, or in part, using chemical methods well known in the art (see, for example, Caruthers, M.H. et al, Nucl. Acids Res. Symp. Ser., 215-223 (1980) and Horn, T. et al., Nucl. Acids Res. Symp. Ser., 225-232 (1980)). Alternatively, the AADH protein itself, or a fragment or portion thereof, may be produced using chemical methods to synthesize the amino acid sequence of the AADH polypeptide, or a fragment or portion thereof. For example, peptide synthesis can be performed using various solid-phase techniques (Roberge, J.Y. et al, Science, 269:202-204 (1995)) and automated synthesis can be achieved, for example, using the ABI 431 A Peptide Synthesizer (PE Biosystems).

[0041] The newly synthesized AADH polypeptide or peptide can be substantially purified by preparative high performance liquid chromatography (e.g., Creighton, T., Proteins, Structures and Molecular Principles, W.H. Freeman and Co., New York, NY (1983)), by reverse-phase high performance liquid chromatography (HPLC), or other purification methods as known and practiced in the art. The composition of the synthetic peptides may be confirmed by amino acid analysis or sequencing (e.g., the Edman degradation procedure; Creighton, supra). In addition, the amino acid sequence of an AADH polypeptide, or any portion thereof, can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins, or any part thereof, to produce a variant polypeptide.

[0042] To express a biologically active AADH polypeptide or peptide, the nucleotide sequences encoding the AADH polypeptide, or functional equivalents, may be inserted into an appropriate expression vector, i.e., a vector, which contains the necessary elements for the transcription and translation of the inserted coding sequence.

[0043] In an embodiment of the present invention, an expression vector contains an isolated and purified polynucleotide sequence as set forth in SEQ ID NO: 12 encoding AADH, or a functional fragment thereof, in which the AADH comprises the amino acid sequence as set forth in SEQ ID NO: 11. Alternatively, an expression vector can contain the complement of the aforementioned AADH nucleic acid sequence.

[0044] Expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses, or from various bacterial plasmids can be used for the delivery of nucleotide sequences to a target organ, tissue or cell population. Methods, which are well known to those skilled in the art, may be used to construct expression vectors containing sequences encoding the AADH polypeptide along with appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described in the most recent edition of Sambrook, J. et al, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Plainview, NY (1989) and in Ausubel, F.M. et al, Current Protocols in Molecular Biology , John Wiley & Sons, New York, NY (1989).

[0045] A variety of expression vector/host systems may be utilized to contain and express sequences encoding the AADH polypeptide or peptides. Such expression vector/host systems include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with virus expression vectors (e.g., baculovirus); plant cell systems transformed with virus expression vectors (e.g., cauliflower mosaic virus (CaMV) and tobacco mosaic virus (TMV)), or with bacterial expression vectors (e.g., Ti or pBR322 plasmids); or animal cell systems, including mammalian cell systems. The host cell employed is not limiting to the present invention. Preferably, the host cell of the invention contains an expression vector comprising an isolated and purified polynucleotide having a nucleic acid sequence selected from SEQ ID NO: 12 and encoding the AADH of this invention, or a functional fragment thereof, comprising an amino acid sequence as set forth in SEQ ID NO: 11.

[0046] Bacterial artificial chromosomes (BACs) may be used to deliver larger fragments of DNA that can be contained and expressed in a plasmid vector. BACs are vectors used to clone DNA sequences of 100-300kb, on average 150kb, in size in E. coli cells. BACs are constructed and delivered via conventional delivery methods (e.g., liposomes, polycationic amino polymers, or vesicles) for therapeutic purposes.

[0047] "Control elements" or "regulatory sequences" are those non-translated regions of the vector, e.g., enhancers, promoters, 5' and 3' untranslated regions, which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. Specific initiation signals may also be used to achieve more efficient translation of sequences encoding an AADH polypeptide. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding an AADH polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only an AADH coding sequence, or a fragment thereof, is inserted, exogenous translational control signals, including the ATG initiation codon, are optimally provided. Furthermore, the initiation codon should be in the correct reading frame to insure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system that is used, such as those described in the literature (see, e.g., Scharf, D. et al, Results Probl. Cell Differ., 20: 125- 162 (1994)).

[0048] In bacterial systems, a number of expression vectors may be selected, depending upon the use intended for the expressed AADH product. For example, when large quantities of expressed protein are needed, vectors that direct high level expression of fusion proteins that can be readily purified may be used. Such vectors include, but are not limited to, the multifunctional E. coli cloning and expression vectors such as

BLUESCRIPT® (Stratagene), in which the sequence encoding the AADH polypeptide can be ligated into the vector in- frame with sequences for the amino-terminal Met and the subsequent 7 residues of B-galactosidase, so that a hybrid protein is produced; pIN vectors (see, Van Heeke, G. et al, J. Biol. Chem., 264:5503-5509 (1989)); and the like. pGEX vectors (Promega, Madison, WI) can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can be easily purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor XA protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.

[0049] In mammalian host cells, a number of viral-based expression systems can be utilized. In cases where an adenovirus is used as an expression vector, sequences encoding the AADH polypeptide may be ligated into an adenovirus transcription/ translation complex containing the late promoter and tripartite leader sequence. Insertion into a non-essential El or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing an AADH polypeptide in infected host cells (Logan, J. et al, Proc. Natl. Acad. Set, 81 :3655-3659 (1984)). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells. Other expression systems can also be used, such as, but not limited to yeast, plant, and insect vectors.

[0050] Moreover, a host cell strain may be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed protein in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation. Post-translational processing which cleaves a "prepro" form of the protein may also be used to facilitate correct insertion, folding and/or function. Different host cells having specific cellular machinery and characteristic mechanisms for such post-translational activities (e.g., CHO, HeLa, MDCK, HEK293, and W138) are available from the

American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, VA 20110-2209, and may be chosen to ensure the correct modification and processing of the heterologous protein.

[0051] Host cells transformed with vectors containing nucleotide sequences encoding an AADH protein, or fragments thereof, may be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The protein produced by a recombinant cell may be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those having skill in the art, expression vectors containing polynucleotides which encode an AADH protein can be designed to contain signal sequences which direct secretion of the AADH protein through a prokaryotic or eukaryotic cell membrane. Other constructions can be used to join nucleic acid sequences encoding an AADH protein to a nucleotide sequence encoding a polypeptide domain, which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine-tryptophan modules that allow purification on immobilized metals; protein A domains that allow purification on immobilized immunoglobulin; and the domain utilized in the FLAGS extension/ affinity purification system (Immunex Corp., Seattle, WA). The inclusion of cleavable linker sequences such as those specific for Factor XA or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the AADH protein may be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing AADH and a nucleic acid encoding 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification on IMAC (immobilized metal ion affinity chromatography) as described by Porath, J. et al, Prot. Exp. Purif, 3 :263-281 (1992), while the enterokinase cleavage site provides a means for purifying the 6 histidine residue tag from the fusion protein. For a discussion of suitable vectors for fusion protein production, see Kroll, D.J. et al., DNA Cell Biol, 12:441-453 (1993).

[0052] Any number of selection systems may be used to recover transformed cell lines. These include, but are not limited to, the Herpes Simplex Virus thymidine kinase (HSV TK), (Wigler, M. et al, Cell, 1 1 :223-232 (1977)) and adenine

phosphoribosyltransferase (Lowy, I. et al, Cell, 22:817-823 (1980)) genes which can be employed in tk^" or aprt^" cells, respectively. Also, anti-metabolite, antibiotic or herbicide resistance can be used as the basis for selection; for example, dhfr, which confers resistance to methotrexate (Wigler, M. et al, Proc. Natl. Acad. Set, 77:3567-3570 (1980)); npt, which confers resistance to the aminoglycosides neomycin and G-418 (Colbere-Garapin, F. et al, J. Mol. Biol, 150: 1-14 (1981)); and als or pat, which confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murry, supra). Additional selectable genes have been described, for example, trpB, which allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman, S.C. et al, Proc. Natl. Acad. Set, 85:8047-8051 (1988)). Recently, the use of visible markers has gained popularity with such markers as the anthocyanins, B-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, which are widely used not only to identify trans formants, but also to quantify the amount of transient or stable protein expression that is attributable to a specific vector system (Rhodes, C.A. et al, Methods Mol. Biol, 55: 121-131 (1995)).

[0053] Although the presence or absence of marker gene expression suggests that the gene of interest is also present, the presence and expression of the desired gene of interest may need to be confirmed. For example, if the nucleic acid sequence encoding the AADH polypeptide is inserted within a marker gene sequence, recombinant cells containing a polynucleotide sequence encoding the AADH polypeptide can be identified by the absence of marker gene function. Alternatively, a marker gene can be placed in tandem with a sequence encoding the AADH polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection typically indicates co-expression of the tandem gene. [0054] A wide variety of labels and conjugation techniques are known and employed by those skilled in the art and may be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding an AADH polypeptide include oligo-labeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide. Alternatively, the sequences encoding an AADH polypeptide of this invention, or any portion or fragment thereof, can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of an appropriate RNA polymerase, such as T7, T3, or SP(6) and labeled nucleotides. These procedures may be conducted using a variety of commercially available kits (e.g., Amersham Pharmacia Biotech, Promega and U.S. Biochemical Corp.). Suitable reporter molecules or labels which can be used include radionucleotides, enzymes, fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

[0055] Alternatively, host cells which contain the nucleic acid sequence coding for an AADH polypeptide of the invention and which express the AADH polypeptide product may be identified by a variety of procedures known to those having skill in the art. These procedures include, but are not limited to, DNA-DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques, including membrane, solution, or chip based technologies, for the detection and/or quantification of nucleic acid or protein.

[0056] The presence of polynucleotide sequences encoding AADH polypeptides can be detected by DNA-DNA or DNA-RNA hybridization, or by amplification using probes, portions, or fragments of polynucleotides encoding an AADH polypeptide. Nucleic acid amplification based assays involve the use of oligonucleotides or oligomers based on the nucleic acid sequences encoding an AADH polypeptide to detect transformants containing DNA or RNA encoding an AADH polypeptide.

[0057] In another aspect, the invention provides a GDH enzyme which is a common enzyme of glucose metabolism and is also necessary for the conversion reaction of Figure 1. GDH enzymes have been reported as early as 1963 (Okamoto, K., J. Biochem., 53 :346-353 (1963)). In fact, the soluble GDH enzyme from G. oxydans has been well known and well characterized (Adachi, O. et al, Agric. Biol. Chem., 44:301 (1980)). The complete gene sequence of G. oxydans was reported in 2005 (Prust, C. et al, Nature Biotechnology, 23 : 195-200 (2005); Shinjoh, M., PCT International Patent Application No. WO 2007/028601 Al) in which a soluble GDH with the open reading frame (ORF) designation of GOX2015 was described and details of the GENBANK® deposition of the genomic DNA sequence was given. The chromosomal sequence for ORF GOX2015 was provided and the nucleotide and amino acid sequences were highlighted. The nucleotide sequence (SEQ ID NO: 13) and amino acid sequence (SEQ ID NO: 14) of an exemplary GDH are shown in Figures 6 and 7, respectively. The instant invention also includes cloning of the NADP dependent GOX2015 and its expression in E. coli. A separate fermentation of this recombinant E. coli strain followed by processing gave a cell-free extract containing GDH.

[0058] In another aspect of the invention, both the GDH and AADH genes were cloned and expressed in the same E. coli strain. Any of the above mentioned expression vectors could be utilized to express these genes. In one embodiment, the AADH gene and the GDH gene are cloned into same vector thus generating a bicistronic plasmid. The main advantage of expressing both the GDH and the AADH in the same bacterial strain is that there only needs to be a single fermentation of the bacterial strain to obtain a cell-free extract containing both AADH and GDH enzymes. By utilizing this system, it reduces the cost of enzyme preparation considerably.

[0059] In bacterial cells, endogenous gdhA can convert some keto acid to amino acid with varying selectivity. Thus, the presence of endogenous gdhA in conjunction with AADH enzyme can cause lowering of the enantiomeric excess of the amino acid that would have otherwise been obtained with the AADH alone. The advantage of utilizing a cell with no endogenous gdhA activity is that the gdhA does not interfere with the exogenously expressed AADH activity.

[0060] Therefore, in another aspect, the invention provides a cell in which the endogenous gdhA is knocked out resulting in a cell which does not express gdhA and, therefore, does not have gdhA activity. In one embodiment, the cell is E. coli. In another embodiment, both AADH and GDH enzymes are cloned and then expressed in this gdhA deficient E. coli strain. In a preferred embodiment, the amino acid sequence of the AADH is the amino acid sequence according to SEQ ID NO: 1 1. In another preferred embodiment, the amino acid sequence of the GDH is the amino acid sequence according to SEQ ID NO: 14. Fermentation followed by processing will give a cell-free extract containing both AADH and GDH enzymes with no gdhA activity. These knockout cells can be generated according to procedures known to one of ordinary skill in the art. For example, the endogenous gdhA gene can be disrupted by the insertion of an intron into the chromosomal gdhA gene. The insertion of an intron, a large polynucleotide (e.g., ~1000bp size), in the gdhA gene disrupts its function to produce gdhA activity. Such an insertion can be performed through the cloning techniques described herein.

EXAMPLES

[0061] Please note that throughout the following examples the Figure 1 reaction compounds are referred to as their designated number (i.e., (1), (2)).

EXAMPLE 1 - CONSTRUCTION OF THE EVOLVED AADH ENZYME

[0062] B. sphaericus (ATCC 4525) was used to inoculate 100 mL of sterile Luria Bertani (LB) broth. The flask was grown at 30 °C on a shaker platform until late-log phase. The cells were harvested by centrifugation, washed one time with sterile distilled water, and repelleted. Chromosomal DNA was prepared from the cell paste using a standard proteinase K/SDS/NaCl/CTAB bacterial DNA purification protocol (Ausubel et al, Current Protocols in Molecular Biology, Vol. 2, John Wiley and Sons, New York, NY (2001)). The resulting crude preparation was extracted 3 times with an equal volume of phenol/chloroform/isoamyl alcohol (25:24: 1). The aqueous phase was retained and the DNA was precipitated using 0.6 volume isopropyl alcohol. The precipitated DNA was washed with 70% ethanol (in water) and recentrifuged. The DNA pellet was air dried, resuspended in 1 mL TE buffer (10 mM Tris, 1 mM EDTA, pH 7.0) containing 50 μg/mL RNase, and incubated at 37 °C for 15 minutes to digest contaminating RNA. One tenth volume 3M sodium acetate (pH 4.8) and two volume 100% ethanol were added to precipitate the chromosomal DNA. The DNA pellet was concentrated by

microcentrifugation, washed with 70% ethanol, repelleted, air dried, and resuspended in 500 μϊ_^ TE buffer. The DNA concentration was determined by absorbance at 260 nm and adjusted to a final concentration of 1 μg/mL. This chromosomal DNA was used for a target for PCR reactions to amplify the B. sphaericus DAPD gene.

[0063] The GENBANK® amino acid sequence submission for a comparable B. sphaericus DAPD protein (GENBANK® accession number BAB07799) was used to design synthetic oligonucleotides to prime amplification of the DAPD gene from chromosomal DNA. The N-terminal primer (sense strand) was 5'- GACCATATGAGTGGAATTCGAGTAG-3 ' (SEQ ID NO: 1), representing the N- terminal amino acid sequence MSAIRVG (SEQ ID NO:20) with an added Ndel restriction endonuclease cutting site (underlined in SEQ ID NO: 1) encompassing the initiator methionine ATG codon. The C-terminal primer (antisense strand) was 5"- GCAGGTACCTTATAATAGTTCCTTACG-3 ' (SEQ ID NO:2) representing the C- terminal amino acid sequence RKELLStop (SEQ ID NO:28) with an added Kpnl restriction endonuclease cutting site (underlined in SEQ ID NO:2) downstream of the translational stop codon TAA. Both of these primers were synthesized, purified, resuspended in TE buffer at 100 ρΜ/μΕ and used as PCR primers using the B. sphaericus chromosomal DNA as the target.

[0064] A PCR reaction was prepared using standard Taq reagents and Taq polymerase. A 20 μϊ_^ reaction contained 1 μg of chromosomal DNA as the target, 200 picomoles of each primer and 0.2 units of Taq polymerase. The "touchdown" cycling conditions were 94 °C/1 min/1 cycle, 94 °C/30 sec/55 °C/30 sec/72 °C/30 sec. (5 cycles); 94 °C/30 sec/65 °C (minus 1 °C per successive cycle) 30 sec/72 °C/30 sec. (16 cycles); 94 °C/30 sec/50 °C/30 sec/72 °C/30 sec. (5 cycles), 94 °C/30 sec/50 °C/30 sec/72 °C/5 min. (1 cycle). The completed PCR reaction was analyzed by ethidium bromide stained agarose gel electrophoresis. A single band of about 1000 base pairs was strongly amplified, consistent with the expected size of a B. sphaericus DAPD gene. This band was excised from the gel. The DNA was purified and resuspended in 20 of distilled water.

[0065] Two microliters of purified DNA was ligated into cloning vector pCR4-TOPO (Invitrogen) in a total volume of 6 \L, using the manufacturer's protocol. Two microliters of the ligation reaction was used to transform electrocompetent E. coli strain TOP 10 and putative transformants were plated on LB agar containing 50 μg/mL kanamycin.

Following incubation overnight at 37 °C, the resulting colonies were screened for the presence of the PCR product insert by PCR (as described previously) using a small portion of a colony as the target DNA. A colony that amplified the PCR product was grown overnight in LB/kanamycin broth and the resulting culture was used to prepare plasmid DNA. This purified plasmid DNA was used for DNA sequence analysis using plasmid based primers that flanked the fragment insert site in PCR4-T0P0. The amino acid sequence is shown in SEQ ID No 5 in Figure 3. The encoded protein displayed 95% identity (311 amino acids out of 326) with the GENBANK® submission for B.

sphaericus DAPD, suggesting the correct gene had been isolated. The restriction endonuclease cut sites that were added during the PCR amplification are underlined.

[0066] Cloning vector pCR4-TOPO+DAPD was digested with restriction enzymes Ndel and Kpnl. The digest products were separated by agarose gel electrophoresis and the DAPD insert (984 nt) was excised from the gel and purified. This DNA fragment was ligated into Ndel/Kpnl digested expression vector pET30a, placing the putative DAPD coding sequence downstream of an IPTG-inducible promoter sequence. The ligation product (pET30a+ DAPD) was used to transform competent BL21(DE3)-GOLD

(Stratagene, LaJolla, CA), selecting transformants by selection on LB agar/kanamycin plates. The presence of the DAPD insert in transformants was verified by colony PCR using DAPD-specific primers. A single positive colony was used to inoculate a 100 mL shake flask culture of MT5mod2/kan broth (40 gm/L glycerol, 20 gm/L pea hydrolysate, 18.5 gm/L TASTONE®, 6 gm/L Na₂HP0₄, 1.25 gm/L (NH₄)₂S0₄, 50 mg/L kanamycin sulfate) which was grown overnight at 37 °C. This culture was then subcultured into 100 mL of MT5mod2/kan broth at an initial optical density of OD₆₀₀ = 0.15 and grown at 30 °C until the OD600 reached ~1.0. Isopropyl β-D-thiogalactoside (IPTG) was added to a final concentration of 200 μΜ to induce transcription of the DAPD gene from the tac promoter and the culture was continued overnight at 30 °C. The cells were collected by centrifugation, resuspended in water at 10% wt/vol, and lysed by vortexing with glass beads. The resulting cellular proteins were analyzed by SDS/PAGE containing a protein molecular weight standard. The proteins derived from the DAPD expression culture displayed a novel highly overexpressed protein with a MW of -36 kD.

[0067] Protein extracts were assayed for the ability to catalyze the oxidative deamination of DAP A to (5)-a-amino-8-ketopimelate (reaction shown below).

Enzyme assay mixtures were prepared containing 100 mM glycine-KCl buffer (pH 10.5), 25 mM DAPA, 10 μϊ_^ of cell lysate and water to a final volume of 990 μϊ_^. The reactions were initiated by the addition of 10 μϊ_^ of lOOmM NADP. Activity levels were determined by monitoring the change in absorption over 2 minutes at 340 nM in a twin beam scanning spectrophotometer. Lysates tested were 10% wt/vol aqueous suspensions of B. sphaericus ATCC 4525 (positive control), untrans formed E. coli strain BL21(DE3)- GOLD (negative control) or BL21(DE)-GOLD/pET30+DAPD (recombinant expression strain). A blank reaction contained water in place of protein lysate. Serial dilutions of the 10% lysate were utilized in cases where the initial sample produced a nonlinear Δ340 during the 2 minute assay period. Protein contents were determined using a Bradford protein assay kit using serial dilutions of bovine serum albumen as a standard. The results of those assays are shown in Table 1.

TABLE 1

Results of protein extracts assayed for their ability to catalyze the oxidative deamination of DAPA to (5)-a-amino-8-ketopimelate

[0068] The oxidative deamination activity level in the recombinant DAPD E. coli expression strain was about 1000-fold higher than the level observed in the native strain used to isolate the DAPD gene clearly demonstrating that the cloned gene encoded a DAPD. The product produced by this reaction had a 100% ee of the (5)-keto acid. [0069] A QUIKCHANGE® Multisite Mutagenesis kit (Stratagene) was used to introduce nucleotide substitutions into the B. sphaericus DAPD gene, altering the amino acid sequence of the encoded protein to include five amino acid mutations. Four specific mutagenic oligonucletide primers were used to initiate PCR reactions that amplified a modified version of the native DAPD gene. Each primer replicated the sense strand of the DAPD gene in the region flanking the site of the desired mutation but substituted an alternate codon at the point of the amino acid mutation. The first primer, referred to as "Q 154L/D158G" (SEQ ID NO:7), was utilized to mutate codon 154 from a CAA (Q =glutamine) to a CTG (L = leucine), and at the same time mutated codon 158 from a GAT (D =aspartic acid) to a GGC (G = glycine). The nucleotide sequence of

Q154L/D158G is:

5'GGGGCGATGGCCTAAGTCTGGGACATTCAGGCGCTGTTCGTCGTATTGAAG G-3' (SEQ ID NO:7), with the two codon substitutions underlined. The second primer, referred to as "T173I" (SEQ ID NO: 8), was utilized to mutate codon 173 from a ACA (T = threonine) to an ATT (I = isoleucine). The nucleotide sequence of T173I is:

5 AAAATGCTGTTCAATACATTTTACCGATTAAAGAAGCGG-3 ' (SEQ ID NO:8). The third primer, referred to as "R199M" (SEQ ID NO:9), was utilized to mutate codon 199 from a CGT (R = arginine) to a ATG (M = methionine). The nucleotide sequence of R199M is:

5'-CAACACGTGAAAAACATGCAATGGAATGTTGGGTTGTATTAGAAG-3' (SEQ ID NO: 9). The final primer, referred to as "H249N" (SEQ ID NO: 10), was utilized to mutate codon 249 from a CAT (H = histidine) to an AAC (N = asparagine). The nucleotide sequence of H249N is:

5 '-CAAATCATACTGGTATGCCAAACGGTGGTTTTGTCATTCGCAGTGG-3 ' (SEQ IDNOL: 10).

[0070] The mutagenic PCR reaction was conducted following the QUIKCHANGE® manufacturer's protocol, including 100 ng of pET30+DAPD target and 200 picomoles of each of the four mutagenic primers in a total reaction volume of 25 μϊ_^. The

thermocycling parameters were 95 °C/1 minute (1 cycle); 95 °C/1 minute/55 °C/1 minute/65 °C/1 1 minutes (30 cycles); 4 °C/5 minutes. Following Dpnl digestion of the native (nonmutated) target DNA, the mutagenized PCR product was purified and concentrated on a silica membrane microcentrifuge spin column, eluting into 10 μϊ_^ of sterile distilled water. This mutagenized plasmid was used to transform competent E. coli strain XL10-GOLD selecting transformants by growth on LB/kan agar plates. Plasmid DNA was prepared from 20 isolates and used for DNA sequencing reactions using the N- terminal and C-terminal DAPD oligonucleotides as primers. Six of the colonies contained a plasmid containing an evolved version of the DAPD containing all 5 of the desired mutations. One colony containing the all five desired mutations DAPDAl ->5 (renamed as AADH enzyme) was selected and used for subsequent experiments.

[0071] The amino acid and nucleotide sequences of the evolved AADH are shown in Fig 4 (SEQ ID No. 1 1) and Fig 5 (SEQ ID No 12), respectively. The amino acids that were mutated from the native sequence are underlined.

EXAMPLE 2 - EXPRESSION OF EVOLVED AADH IN E. COLI

[0072] Plasmid pET30+AADH was used to transform E. coli strain BL21(DE3)- GOLD. A single colony was inoculated into LB/kan broth and grown at 37 °C until late log-phase. The cell density was determined by measuring the OD₆oo and the cells were subcultured into MT5mod2/kan at an initial cell density of 0.2. The culture was placed on a 30 °C shaker platform and the fermentation was continued until an OD₆₀₀ of ~ 1.0. IPTG (0.2 mM) was added to induce expression of the AADH enzyme. Following an overnight induction period, the cells were harvested by centrifugation, suspended in water at 10% wt/vol, and both total and soluble protein samples were prepared for SDS/PAGE analysis. Coomassie blue staining of the completed gel revealed a strongly overexpressed novel protein with an apparent mw of ~36 kD.

EXAMPLE 3 - CLONING OF THE GDH GENE FROM

GLUCONOBACTER OXYDANS ATCC 621

[0073] G. oxydans chromosomal DNA was prepared using a known procedure with the following modification (Ausubel, F.M. et al., eds., Current Protocols in Molecular Biology, Vol. 2, John Wiley & Sons, New York, NY (2001)). The cell pellet was resuspended in 9.5 mL GTE buffer (50 mM glucose, 25 mM Tris-HCl pH 8.0, 10 mM NaEDTA) containing 2 mg/mL lysozyme and incubated at 37 °C for 30 min before adding SDS and Proteinase K. [0074] A putative NAD(P)-dependent glucose 1 -dehydrogenase gene was identified from the sequenced genome of G. oxydans (NCBI accession number NC 006677).

TABLE 2

Oligonucleotide primers prepared based upon the putative G. oxydans GDH sequence

[0075] The primers were used for polymerase chain reaction (PCR) along with the FailSafe series of buffers (Epicentre Technologies, Madison, WI) and G. oxydans chromosomal DNA (10 ng per reaction) as template in 10 μϊ_^ reactions. Amplification was carried out in a Hybaid PCR Express thermocycler (ThermoSavant, Holbrook, NY). The amplification conditions included incubation at 94 °C for 1 min, followed by 30 cycles at 94 °C for 0.5 min; 50 °C for 0.5 min; and 72 °C for 0.5 min. Samples were electrophoresed on a 1.0% agarose gel for 2 hr at 100 v in TAE buffer (0.04 M

TRIZMA® base, 0.02 M acetic acid, and 0.001 M EDTA, pH 8.3) containing 0.5 μg/mL ethidium bromide.

[0076] Strong amplification of a single fragment of the expected size (801 bp) was obtained in 10 out of the 12 buffers tested. PCR was repeated by scaling up the reaction 20-fold with FailSafe buffer "D". DNA was purified by extraction with one volume 1 : 1 phenohchloroform and centrifuged 2 min at 13,500 x g. The upper aqueous phase was removed to a new 1.5 mL microcentrifuge tube and DNA precipitated by addition of 0.1 vol 3 M sodium acetate pH 7.5 and 3 vol ice-cold ethanol. DNA was pelleted by centrifugation at 13,500 x g for 5 min. Liquid was removed and the pellet washed once with 0.2 mL 70% ethanol before drying for 3 min in a SPEED VAC® (Savant Instruments, Farmingdale, NY) under low heat. The pellet was resuspended in 50 μί_^ dH20 and a 1 μϊ_^ sample electrophoresed along with the Low Molecular Weight DNA Mass Ladder (Invitrogen) to estimate the concentration of the amplified fragment. The amplified gene was named GDH.

EXAMPLE 4 - SUBCLONING OF THE GDH GENE INTO E. COLI EXPRESSION VECTOR PBMS2004

[0077] One microgram of the amplified GDH fragment was cleaved with 5 U each Ndel and BamHI for 2 hr, 37 °C in a final volume of 20 μϊ_^. The sample was applied to an agarose gel and after electrophoresis, the 801 bp fragment was excised from the gel and purified using the QIAQUICK® Gel Extraction kit (Qiagen, Chatsworth, CA). The concentration of the digested PCR fragment was estimated by electrophoresis along with the mass ladder previously used. Ligation to NiM-5amHI-cleaved expression vector pBMS2004 (derived from pBMS2000 (Franceschini, T. et al, U.S. Patent No. 6,068,991 A) was performed at a 5: 1 (inser vector) molar ratio in a total volume of 10 μΐ at 22 °C for 15 min using the FastLink kit (Epicentre). DNA was precipitated by addition of 100

1-butanol and pelleted at 13,500 x g in a microcentrifuge for 5 min. Liquid was removed by aspiration, and the DNA was dried in a SPEED VAC®. The pellet was resuspended in 4 μΐ dH₂0. The resuspended DNA was transformed by electroporation into 40 μϊ_^ E. coli DH10B competent cells (Invitrogen) at 2.5 kV, 25 μ¥, and 250 ohms. SOC medium was immediately added (0.96 mL) and the tube containing the transformed cells incubated in a shaker for 1 hr at 37 °C and 225 rpm. Colonies containing recombinant plasmids were selected on LB agar plates containing 50 μg/mL kanamycin sulfate (Sigma Chemicals, St. Louis, MO). Nine kanamycin-resistant colonies were screened for the presence of the GDH gene by colony PCR using oligos 819 + 820 under previously described conditions; eight amplified a fragment of the expected size. Plasmid DNA was prepared from a liquid culture of a colony that contained the insert and was verified to possess the expected 807-bp Ndel-BamHl fragment after digestion with these enzymes and named pBMS2004-GDH. The DNA sequence of the insert was determined and showed completed homology to that obtained from genomic sequencing of G.

oxydans. EXAMPLE 5 - PRODUCTION OF E. COLI CELLS PRODUCING

EVOLVED AADH

[0078] Protein samples containing 20% wt/vol cell lysates of the induced

BL21(DE3)/pET30A+AADH culture were assayed for the ability to catalyze the reductive amination of (2) to (R)-2-amino-5,5,5-trifluoro-pentanoic acid (T). The initial assays were performed on a dual beam spectrophotometer measuring the change in absorbance at 340 nm over a two minute test period. The reaction mixture for the initial 1 mL assays contained 5 mg/mL (2), 53.5 mg NH₄C1, 10.6 mg Na₂C0₃ in -800 of water. After adjusting the pH to 9.0 with 10 N NaOH, additional water was added to a final volume of 970 μϊ_^. To start the reaction 10 μϊ_^ of cell lysate and 20 μϊ_^ of 10 mM NADPH (0.2 mM final) were added. The assays were conducted at room temperature. In addition to the previously described control samples, an additional positive control, (D)- AADH #102 (Biocatalytics Inc., Pasadena, CA) was added for comparison. The results are shown below:

TABLE 3

Results of protein samples assayed for the ability to catalyze reductive amination

[0079] Evolution of the B. sphaericus ATCC 4525 DAPD gene had converted the encoded DAPD enzyme from having no activity toward (2) to an AADH enzyme that was highly efficient at catalyzing the reductive amination reaction. [0080] Plasmid pET30+AADH was digested with restriction endonucleases Ndel and Kpnl. The digest products were separated by agarose gel electrophoresis and the AADH band (983 bp) was excised from the gel and purified. This purified insert DNA was ligated into proprietary E. coli expression plasmid pBMS2004, placing the AADH coding sequence under control of an IPTG-inducible promoter. The ligation reaction was used to transform E. coli strain BL21-Gold, selecting transformants on LB/kan agar and verifying the insert by DAPD-specific PCR of transformant colonies. The resulting expression plasmid was called pBMS2004+AADH. Plasmid pBMS2004+AADH was used to transform E. coli expression strain BL21-GOLD selecting transformants on LB/kan agar plates. A single transformant colony was used to inoculate LB/kan broth, which was grown overnight at 37 °C. This overnight culture was subcultured into MT5mod2/kan and grown at 30 °C and induced 0.2 mM IPTG. SDS/PAGE analysis of proteins prepared from this induced culture demonstrated a higher level of overexpression of the novel ~37 kD protein than observed in the pET30a expression construct. BL21 - Gold/pBMS2004+AADH was used for protein expression in larger scale fermentations.

[0081] BL21-GOLD/pBMS2004+AADH was used to inoculate 1L of MT5mod2/kan broth in a 4L shake flask. The flask was placed on a 30 °C shaker platform and grown overnight at 225 RPM. The OD₆oo was measured and the entire 1L volume was used to inoculate 100L of MT5mod2/kan in a 150L Braun fermentor (B. Braun Biotech

International GMBH, Melsungen, Germany) yielding an initial OD₆₀₀ of -0.075. The cells were grown at 37 °C, 150 LPM air input, 10 psig pressure, 320 RPM, at pH 7.2. During the run the pH was controlled at 7.2+0.2 by addition of 28% ammonium hydroxide, as needed. When the OD₆oo of the culture reached -4.5, sterile IPTG was added to a final concentration of 0.5 mM. The fermentation was continued until the CO2 off-gas dropped precipitously, indicating depletion of the growth medium. The cells were harvested by centrifugation and the cell paste was analyzed for (R)-AADH activity.

Preparation of evolved AADH enzyme from E. coli cells Preparation of extract:

[0082] 225 g E. coli expressing (R)-AADH in 1500 mL 50 mM potassium phosphate buffer pH 7 (75 mL 1 M potassium phosphate pH 7, 1200 mL water) (15% w/v cells) was passed through a MICROFLUIDIZER® two times then centrifuged 30 min at 18700xg. The supernatant contained 29.6 U/mL (R)-AADH and was stored frozen at -20 °C until use. Enzyme assays:

[0083] Enzyme assays were done using 1 cm path length cuvets in a

spectrophotometer at 30 °C. The (R)-AADH assay solution contained 5 mg/mL (29.4 mM) keto acid (2), 1 M NH₄C1, 0.1 M Na₂C0_3, 0.2 mM NADPH at pH 9.0 in a volume of 1 mL. After addition of a suitably diluted enzyme solution, the absorbance decrease/min at 340 nm was used to calculate enzyme activity. A blank was run with no keto acid.

[0084] The GDH assay solution contained 0.1 M potassium phosphate buffer pH 8, 0.5 mM NADP, and 0.1 M glucose in a volume of 1 mL. After addition of diluted enzyme solution, the absorbance increase/min at 340 nm was used to calculate enzyme activity. A blank was run with no enzyme.

Calculation for both assays:

[0085] Activity in μmoles/min/mL of enzyme solution = (absorbance change/min of cuvet with enzyme- absorbance change/min of blank)/6.2/(mL enzyme sample) = U/mL Note: 1 mM NADPH has an absorbance of 6.2 in a 1 cm path length cuvet

1 U of enzyme activity= 1 μιηοΐε of product per/min

EXAMPLE 6 - PRODUCTION OF E. COLI CELLS PRODUCING GDH

[0086] pBMS2004-GDH was transformed into competent E. coli expression strain BL21 by electroporation as described above. For shake flask expression work, a single kanamycin-resistant colony was initially grown in MT5-M2 + kanamycin for 20-24 hr, 30 °C, 250 rpm. MT5-M2 medium contains Hy-Pea (Quest International) 2.0%;

TASTONE® 154 (Quest), 1.85%; Na₂HP0₄, 0.6%; (NH₄)₂S0₄, 0.125%; glycerol, 4.0%; pH adjusted to 7.2 w/10 N NaOH before autoclaving. The optical density at 600 nm (OD₆oo) was recorded and fresh medium inoculated with the culture to a starting OD₆oo of 0.30. The flask was incubated as described above until the OD₆oo reached -0.8-1.0. IPTG was added from a 1 M filter-sterilized stock in d¾0 to a final concentration of 50 μΜ or 1 mM and the culture allowed to grow for an additional 22 hr. Cells were harvested by centrifugation at 5,000 x g at 4 °C in a Beckman JA 5.3 rotor.

[0087] Medium was discarded and the pellet resuspended in an equal volume of 0.1 M potassium phosphate buffer, pH 8.0. Cells were recentrifuged under identical conditions and the buffer removed. The wet cell weight was recorded and samples were stored frozen at ^"20 °C or used immediately. Cells were resuspended in 10 mM phosphate buffer pH 8.0 containing 10% glycerol and 1 mM dithiothreitol at 1 mL/0.1 g wet cell weight. Cells were lysed by sonication (Branson Sonifier 150) at 15 watts, 3 x 15 sec and centrifuged 13,500 x g for 5 min to pellet cell debris. Gel electrophoresis of a sample of the sonicate on a 12% Tris-Glycine polyacrylamide gel using SDS-MOPS running buffer (Invitrogen) revealed a novel, highly-overexpressed protein band of M_r= 28,800 daltons. Best expression was observed following induction at the higher IPTG level.

Activity assay:

[0088] GDH activity was measured spectrophotometrically by following the rate of NADPH formation at 340 nm. Standard conditions were 200 mM Tris-HCl pH 9.0, 10 mM D-glucose, 20 mM MgCi₂, 1.25 mM NADP, and enzyme. The increase in absorbance was recorded for 3 min and units of activity per mL calculated using the formula AOD340 nm X enzyme dilution factor/6.22 x time (min) x enzyme used (mL).

[0089] The effect of incubation temperature and pH on GDH activity was investigated. Maximum activity was obtained at 40 °C and pH 9.0 (1580 U/mL) using cells grown induced with 0.5 mM IPTG. However, near-maximum activity was seen between pH 8.0 and 10.0 and temperatures from 35 to 50 °C. Preparation of GDH enzyme from is. coli cells

[0090] GDH from Gluconobacter oxydans expressed in E. coli was prepared by microfluidization, ammonium sulfate fractionation and lyophilization, then stored at 4 °C. GDH activity was 21.8 U/mg.

EXAMPLE 7 - CONVERSION OF KETO ACID (2) TO AMINO ACID (1) WITH TWO SEPARATE PREPARATIONS OF AADH AND GDH ENZYMES [0091] 5,5,5-Trifluoro-2-oxopentanoic acid (2) (1 g, 5.88 mmoles), NH₄C1 (1.07 g, 20 mmoles), glucose (1.44 g, 7.99 mmoles) and water (16.2 mL) were charged to a 20-mL jacketed reactor and the mixture was stirred with a magnet at 30 °C to dissolve the solids. NaOH (0.65 mL of 10 N) was added to raise the pH to about 8. Na₂C0₃ (212 mg, 2 mmoles) was added which brought the pH to about 8.5. NADP (765 mg, 1 mmole), GDH (6 mg, 131 units), and AADH (1.39 mL extract containing 24.2 units) were then added in that order. The reaction mixture was brought to pH 9 by dropwise addition of 5N NaOH. The reaction mixture was stirred at 30 °C and maintained at pH 9.00 by addition of 5 N NaOH from a pH stat. After 20 h the solution yield of (R)-5,5,5-trifluoro-2- aminopentanoic acid (1) was 0.94 g, 93% yield, 99.2% ee.

EXAMPLE 8 - CLONING AND EXPRESSION OF BOTH AADH AND GDH IN SAME E. COLI STRAIN

[0092] The GDH insert of expression vector pBMS2004-GDH was modified by PCR amplification using primers that substituted a Kpnl restriction endonuclease cutting site for the C-terminal BamHI site contained in the original construct. The resulting product contained an Ndel site prior to the initiation codon and a Kpnl site immediately following the termination codon. This fragment was purified and ligated into NdeLKpnl cut pBMS2004, creating an alternate GDH expression plasmid. This expression vector served as a starting point for the creation of a bicistronic E. coli expression plasmid designed to produce both the AADH and the GDH from the same IPTG-inducible mRNA. Two micrograms of this plasmid were digested with Kpnl immediately downstream of the GDH termination codon. The Kpnl cut pBMS2004-GDH plasmid was purified and eluted into 10 of sterile distilled water.

[0093] Plasmid pBMS2004+AADH was used as the target for a PCR amplification to add a Kpnl restriction site at the N-terminal and introduce a ribosome binding site between Kpnl site and the AADH initiation codon, and add a BamHI restriction site downstream of the termination codon. The N-terminal (sense) primer was:

5'AGCCTTGGTACCTAATACC^gGA4TAAATAAAACATATGAGTGCAATTCGA GTAGGTATTGTAGG-3 ' (SEQ ID NO: 15), with the Kpnl site underlined, the ribosome binding site in bold italics, and the AADH initiation codon in bold underlined. The nucleotides on the C-terminal side of the initiation codon encoded for the next nine amino acids of the AADH coding sequence. The C-terminal (antisense) primer was the same as used to initially isolate the native DAPD gene from the B. sphaericus chromosomal DNA: 5 '-GCAGGTACCTTATAATAGTTCCTTACG-3 ' (SEQ ID NO: 16), with the C-terminal Kpnl site underlined. A PCR reaction was performed using the thermocycler conditions described for the initial isolation of the DAPD native gene. Agarose gel electrophoresis of the completed reaction revealed a single amplified product of -980 bp. This fragment was excised from the gel, purified and used as an insert fragment for a ligation into the Kpnl cut pBMS2004-GDH vector. The ligation reaction was used to transform E. coli strain BL21-Gold, and transformants were selected by plating on LB kan agar. The presence of the desired insert, in the desired orientation for an authentic bicistronic mRNA, was verified by GDH+AADH-specific directional PCR. A colony that amplified a product with the appropriate mass for the GDH+AADH cassette, in the proper orientation relative to the plasmid promoter was selected for protein expression studies. DNA sequencing confirmed the desired construct. This plasmid was named pBMS2004- GDH+AADH.

[0094] The sequence of the GDH+AADH gene fusion junction of pBMS2004- GDH+AADH is shown below, with the Kpnl and Ndel sites, respectively, underlined and the ribosomal binding site in bold italics: 5" (GDH gene)... GATTTCGAAAACAACTGGTCCTCGTAAGGTACCTAATACC4 G (SEQ ID NO: 17)

Nucleotides 1-27 of SEQ ID NO: 17 encode for the eight C-terminal amino acids of the GDH protein (SEQ ID NO: 14) which are DFENNWSS Stop (SEQ ID NO: 18). GA4TAAATAAAACATATGAGTGCAATTCGAGTAGGT ... (AADH gene) ...3" (SEQ ID NO: 19)

Nucleotides of 16-36 SEQ ID NO: 19 encode for the seven N-terminal amino acids of the AADH protein (SEQ ID NO: 1 1) which are MSAIRVG (SEQ ID NO:20). [0095] Transformant BL21 -Gold/pBMS2004-GDH+AADH was used to inoculate a shake flask containing 25 mL of MT5(mod 2)/kan broth. The flask was placed on a 37 °C shaker at 250 RPM and grown until OD₆₀₀ ~1.0. IPTG was added to a final concentration of 0.5 mM and the culture was continued overnight (~16 hrs). Following the overnight induction, cells were harvested, lysed in 10% (wt/vol) water), and the cellular proteins were isolated. SDS/PAGE analysis of the cellular proteins revealed two highly overexpressed novel proteins not observed in a parallel control culture (BL21- Gold/pBMS2004). The molecular weights of the overexpressed proteins were consistent with the GDH and AADH proteins, indicating that the bicistronic construct was capable of producing both proteins from a single mRNA.

EXAMPLE 9 - PRODUCTION OF E. COLI CELLS PRODUCING

BOTH AADH AND GDH

[0096] BL21 -Gold/pBMS2004-GDH+AADH was used to inoculate 1L of

MT5mod2/kan broth in a 4L shake flask. The flask was placed on a 37 °C shaker platform and grown overnight at 225 RPM. The OD₆₀o was measured and the entire 1L volume was used to inoculate 250L of MT5mod2/kan in a 275L Braun fermentor (B. Braun Biotech International GMBH, Melsungen, Germany) yielding an initial OD₆₀₀ of -0.15. The cells were grown at 37 °C, 150 LPM air input, 10 psig pressure, 320 RPM, at pH 7.2. Based on prior shake flask fermentations, the pH level was not controlled and drifted downward during the course of the fermentation. When the OD₆oo of the culture reached ~5, sterile IPTG was added to a final concentration of 1.0 mM. The fermentation was continued until the CO₂ off-gas dropped precipitously, indicating depletion of the growth medium. The cells were harvested by centrifugation and the cell paste was analyzed for both GDH and (R)-AADH activity.

Preparation of evolved AADH and GDH enzyme mixture from E. coli cells

[0097] To 180 g frozen E. coli cells (containing both the AADH and GDH) was added 60 mL 1 M potassium phosphate buffer pH 7 and 960 mL water to give 15% w/v cells in 50 mM potassium phosphate buffer pH 7. The cells were suspended in the buffer with an ULTRA-TURRAX® T25 homogenizer. The cell suspension was passed through a MICROFLUIDIZER® one time at 12000 psi to give 1200 mL extract. To 1100 mL magnetically stirred extract was added 16.5 mL 20% w/v poly(ethyleneimine) to give

0.3% final concentration. Stirring was continued for 10 min, then the extract was kept on ice for another 30 min. The extract was centrifuged 2 min at 18000xg (1 1 min total counting acceleration, deceleration) and the clarified supernatant (960 mL containing 21.9 U/mL (R)-AADH and 1886 U/mL GDH) was stored at -20 °C until use. 1 U of enzyme activity= 1 μιηοΐε of product per/min. EXAMPLE 10 - CONVERSION OF KETO ACID TO AMINO ACID

USING AADH AND GDH ENZYME MIXTURE

[0098] Water (800 mL) was added to a 2-L jacketed reactor and stirred magnetically. NH₄C1 (26.75 g, 500 mmoles), glucose (62.5 g, 347 mmoles) and 5,5,5-trifluoro-2- oxopentanoic acid (2) (50 g, 294 mmoles) were added to the reactor, followed by 29.5 mL of 10 N NaOH. Then additional NaOH was added dropwise with continued stirring to bring the pH to 9. The temperature was maintained at 30 °C with a circulating water bath. NADP (382 mg, 0.5 mmoles) and a solution containing (R)-AADH (1250 U) and GDH (75801 U) were added to start the reaction. The pH was maintained at 9.00 with 5 N NaOH from a pH stat, and the reaction temperature was kept at 30 °C. After 22h the pH was adjusted to 1.98 with 63.5 mL cone. HC1. The final reaction mixture contained 44.54 g (260.3 mmoles, 88.5% solution yield, 98.9% ee) of (R)-5,5,5-trifluoro-2- aminopentanoic acid (1) in 1 100 mL by HPLC analysis.

HPLC analysis:

[0099] Samples of 0.02 mL were diluted with 0. 98 mL water and placed in a boiling water bath for 2 min. After cooling samples were filtered into HPLC vials. Samples were analyzed with a Regis Davankov Ligand Exchange 15 x 0.46-cm column. The mobile phase was 20% methanol/ 80% water/1 mM Q1SO₄, flow rate was 1 mL/min, detection was at 235 nm, temperature was 40 °C, and injection volume was 10 μί.

Retention times were (5)-enantiomer of 5.5.5-Trifluooronorvaline 4.7 min, (R)- 5.5.5- Trifluooronorvaline (1) 12.7 min, keto acid (2) 5.6 min.

EXAMPLE 1 1 - PRESENCE OF GLUTAMATE DEHYDROGENASE

AND ITS EFFECT ON REACTION YIELD AND EE

[00100] Extract from cells expressing (R)-AADH and GDH was prepared by sonication of 835 mg cells in 5 mL of 50 mM potassium phosphate buffer, pH 7. All further steps were carried out at 4 °C. The extract was centrifuged for 10 min at 43000xg and 2 niL of the supernatant was added to a 1-mL column of Q-SEPHAROSE® equilibrated with 20 mM tris chloride pH 7.4. The column was eluted with 2-mL portions of 20 mM tris chloride pH 7.4 containing 0, 0.1, 0.2, 0.3 and 0.4 M NaCl and 2-mL fractions were collected. Each fraction was assayed for glutamate dehydrogenase, (R)- AADH and ee of (R)-5,5,5-trifluoronorvaline produced by the fraction. The fractions giving a product with low ee had the highest amount of glutamate dehydrogenase activity, and the elevated activity in these fractions was believed to result from endogenous L- glutamate dehydrogenase found in E. coli. Low levels of glutamate dehydrogenase activity in the other fractions can result from (R)-AADH.

Ee of (R)-5,5,5-trifluoronorvaline produced:

[00101] The reaction mixture contained in a total volume of 1 mL at pH 9.0: 5 mg/mL (29.4 mM) keto acid (2), 0.5 M NH₄C1, 0.347 M glucose, 0.5 mM NADP, and 0.1 mL of the fraction being assayed at pH 9.0 in a volume of 1 mL. After 15 h incubation at 30 °C the (R)-5,5,5-trifluoronorvaline was analyzed by HPLC using a Regis Davankov column as described above. gdhA assay:

[00102] The gdhA assay solution contained 5 mg/mL (29.7 mM) a-ketoglutarate monosodium salt, 1 M NH₄C1, 0.1 M Na₂C0_3, 0.2 mM NADPH at pH 9.0 in a volume of 1 mL. After addition of a suitably diluted enzyme solution, the absorbance decrease/min at 340 nm was used to calculate enzyme activity. A blank was run with no keto acid.

TABLE 4

Results of the AADH and gdhA assay

Fraction Ee of (R)-5,5,5- (R)-Amino acid Glutamate

trifluoronorvaline dehydrogenase, dehydrogenase, produced,% U/mL U/mL

0.2 M NaCl 99.78 0.48 0.12

0.3 M NaCl 99.65 13.87 0.13

0.4 M NaCl 83.62 4.39 1.77

EXAMPLE 12 - KNOCK OUT OF gdhA GENE - PRODUCTION OF E. COLI - MINUS gdhA STRAIN

[00103] The nucleotide sequence of the gdhA gene from E. coli strain B, the parental strain of the BL21-Gold expression strain, was obtained from the GENBANK® sequence database. Based on this sequence, an N-terminal (sense) primer:

5'-ATGGATCAGACATATTCTCTGG-3' (SEQ ID NO:21), and a C-terminal (antisense) primer: 5 '-AATTTAGTGTGGGACGCGGTCG-3 ' (SEQ ID NO:22), were prepared to amplify the gdhA gene from the BL21 -Gold chromosomal DNA. A colony of BL21 - Gold was picked from a LB agar plate and resuspended in 25 of sterile distilled water. Two microliters of the cell suspension plus 200 picomoles of each gdhA primer were used to prepare a 20 \L PCR amplification reaction using standard reagents and 0.2 units of Taq polymerase. The "touchdown" cycling conditions were 94 °C/1 min/lX, 94 °C/30 sec/55 °C/30 sec/72 °C/30 sec. (5 cycles); 94 °C/30 sec/65 °C (minus 1 °C per successive cycle) 30 sec/72 °C/30 sec. (16 cycles); 94 °C/30 sec/50 °C/30 sec/72 °C/30 sec. (5 cycles), 94 °C/30 sec/50 °C/30 sec/72 °C/5 min. (1 cycle). The completed PCR reaction was analyzed by ethidium bromide stained agarose gel electrophoresis. A single band of ca. 1350 base pairs was strongly amplified, consistent with the expected size of an E. coli gdhA gene. The amplified fragment was purified, ligated into cloning vector pCR4-TOPO, and used to transform E. coli strain TOP 10. Transformants were selected by growth on LB agar plates and the gdhA insert was verified by PCR analysis of individual colonies. A PCR positive transformant was used to inoculate 10 mL of LB media. The culture was grown overnight at 37 °C then used to prepare purified plasmid DNA. The plasmid DNA was sequenced. The sequence of the PCR insert was compared to the GENBANK® database and shown to be a match for the expected gdhA sequence. [00104] A TargeTron Gene Knockout System (Sigma Aldrich) was used to disrupt the chromosomal gdhA gene in BL21-Gold. The nucleotide sequence from the gdhA gene was submitted to Sigma and analyzed using their proprietary algorithm to determine the optimal region for insertion of an intron intended to disrupt the gdhA coding sequence. Using Sigma's primer designations, the suggested oligonucleotide primers to modify the intron-containing plasmid pACD4 to target the gdhA locus were: primer "IBS" = 5'AAAAACTTATAATTATCCTTAAAAGACTTTGGTGTGCGCCCAGATAGGGTG- 3' (SEQ ID NO:23), primer "EBSld" =

5'CAGATTGTACAAATGTGGTGATAACAGATAAGTCTTTGGTCTTAACTTACCT TTCTTTGT-3' (SEQ ID NO:24), and primer "EBS2" =

5 '-TGAACGCAAGTTTCTAATTTCGGTTTCTTTCCGATAGAGGAAAGTGTCT-3 ' (SEQ ID NO:25). This primer set was designed to adapt the intron to insert between nucleotides 903 and 904 of the gdhA gene. All subsequent gene knockout experiments: amplification of a gdhA-modified intron fragment, cloning of the modified intron into the pACD4 vector and transformation of BL21 -Gold to disrupt the native gdhA gene were conducted according to the TargeTron manufacturer's protocol. Since the pACD4 has no selective marker to identify potential intron-disrupted colonies, colony PCR using the original gdhA terminal primers was used to detect which colonies contained disrupted gdhA genes. Approximately 20% of the colonies amplified a PCR product -1000 bp larger than the control (the purified pCR4-TOPO+gdhA vector) indicating they had incorporated the intron within the gdhA coding region. One of these colonies, named BL21-Gold(gdhA^minus) was selected for further analysis.

[00105] Both BL21 -Gold and BL21 -Gold(gdhA^minus) were grown in shake flasks containing MT5(mod2) medium at 37 °C. When the cultures had reached late-log phase, the cells were harvested, resuspended in 50 mM NaP0₄ (pH 8.0) at 10% (wt/vol), and lysed. The lysates were tested for glutamate dehydrogenase activity.

[00106] Cell pellets of two wild type (parental strain of the BL21-Gold expression strain) and two knockout samples were suspended in 5 mL of 50 mM potassium phosphate buffer pH 7, sonicated for 3 min, then centrifuged for 15 min at 48000xg. The supernatants were assayed for glutamate dehydrogenase activity as described above. TABLE 5

Results of gdhA assay on wild type and knockout cells

[00107] gdhA activity in knockouts measured in this assay was <10% of wild type control activity. The residual AA340/min found in the knockouts may be a result of ketoreductase activity and not glutamate dehydrogenase.

[00108] The gdhA knockout strain BL21 -Gold(gdhA^minus) was used as an expression strain for the bicistronic GDH+AADH plasmid construct. EXAMPLE 13 - EXPRESSION OF BOTH EVOLVED

AADH AND GDH IN THE E. COLI - gdhA^minus STRAIN

[00109] BL21 -Gold(gdhA^minus) was transformed with plasmid pBMS2004- GDH+AADH. Transformants were identified by growth on LB/kan agar plates and verified by colony PCR specific for amplification of the GDH+AADH gene cassette. A PCR-positive transformant was used to inoculate 25 mL of MT5(mod2)/kan broth in a shake flask. After overnight growth at 37 °C on a shaker platform, the optical density was determined and the cells were subcultured into fresh MT5(mod2)/kan medium at an initial cell density of OD600 =0.15. The flasks were returned to the 37° shaker and grown until OD₆₀₀ -1.5. IPTG was added to a final concentration of 0.2mM and the culture was continued overnight (-16 hours). The induced cells were harvested, resuspended in sterile distilled water at 10% wt/vol, and lysed. The resulting proteins were analyzed by SDS/PAGE. Coomassie blue staining of the completed gel revealed that both the GDH and AADH proteins were highly overexpressed in the gdhA^mmus background. These proteins were not produced by a parallel control culture (BL21 -Gold/pBMS2004). A sample of the GDH+AADH expression culture cells was tested for both GDH and (R)- AADH activity. EXAMPLE 14 - PRODUCTION OF E. COLI - gdhA^minus

PRODUCING BOTH AADH AND GDH

[00110] BL21 -Gold(gdhA^minus)/pBMS2004GDH+AADH was used to inoculate 500 mL of MT5mod2 kan broth in a 2L shake flask. The flask was placed on a 37 °C shaker platform and grown overnight at 225 RPM. The OD₆₀₀ was measured and the entire 500 mL volume was used to inoculate 15L of MT5mod2/kan in a 21L Braun fermentor (B. Braun Biotech International GMBH, Melsungen, Germany) yielding an initial OD₆₀₀ of -0.25. The cells were grown at 37 °C, 150 LPM air input, 10 psig pressure, 320 RPM, at pH 7.2. Based on prior shake flask fermentations, the pH level was not controlled and drifted downward during the course of the fermentation. When the OD₆oo of the culture reached ~5, sterile IPTG was added to a final concentration of 1.0 mM. The fermentation was continued until the CO₂ off-gas dropped precipitously, indicating depletion of the growth medium. The cells were harvested by centrifugation and the cell paste was analyzed for both GDH and (R)-AADH activity.

EXAMPLE 15 - PREPARATION OF EVOLVED AADH AND GDH

ENZYME MIXTURE FROM E. COLI - gdhA^minus CELLS

[00111] To 6.00g frozen cells was added a solution containing 2 mL 1 M potassium phosphate pH 7 brought to 34 mL with water to give 15% w/v cells in 50 mM potassium phosphate buffer pH 7. The cells were suspended in the buffer with an ULTRA- TURRAX® T25 homogenizer then sonicated for 3 min. The extract was centrifuged for 15 min at 48000xg, 4 °C. The supernatant contained 27.2 U/mL (R)-AADH and 1436 U/mL GDH.

EXAMPLE 16 - CONVERSION OF KETO ACID TO AMINO ACID USING AADH AND GDH ENZYME MIXTURE FROM E. COLI - gdhA^minus CELLS

[00112] 5,5,5-Trifluoro-2-oxopentanoic acid (2) (1 g, 5.879 mmoles), NH₄C1 (0.535 g, 10 mmoles), glucose (1.25 g, 6.938 mmoles) and water (16 mL) were charged to a 20-mL jacketed reactor and the mixture was stirred with a magnet at 30 °C to dissolve the solids. NaOH (10 N, 0.59 mL) was added and then NaOH was added dropwise to bring the pH to 9. NADP (765 mg, 1 mmole) and extract (0.919 mL containing 25 units of (R)-AADH and 1319 U of GDH) were then added in that order. The reaction mixture was stirred at 30 °C and maintained at pH 9.00 by addition of 1 N NaOH from a pH stat. After 20 h the solution yield of (R)-5,5,5-trifluoro-2-aminopentanoic acid (T) was 0.889 g, 89% yield, 100% ee.

HPLC:

[00113] Enzyme reaction samples of 0.02 mL were diluted with 0.98 mL water and placed in a boiling water bath for 2 min to precipitate proteins. After cooling, samples were filtered into HPLC vials. Samples were analyzed with a PHENOMENEX® Chirex 3126 (D-Penicillamine Ligand Exchange) 50x4.6-mm column. The mobile phase was 2 mM CuS0₄ in 5% isopropanol/ 95% water, flow rate was 1 mL/min, detection was at 235 nm, temperature was 40 °C, and injection volume was 10 μί. Retention times were (5)- enantiomer of 5,5,5-trifluoronorvaline 3.75 min, (R)- 5,5,5-trifluoronorvaline (T) 5.86 min, keto acid (2) 26.3 min.

EXAMPLE 17 - ISOLATION OF R-5,5,5-TRIFLUORONORVALINE 1

FROM REACTION MIXTURE

[00114] A reaction mixture, 1200 g, pH 2.0, containing 44.5 g of (R)-trifluoronorvaline

(1), was filtered to remove precipitated protein. The filtrate was adjusted to pH 7.0 with NaOH, diluted with 1-butanol (to prevent foaming and bumping) and concentrated in vacuo to 286 g of wet solid. This was mixed with 1430 mL of MeOH and the mixture refluxed briefly. The hot mixture was filtered, washing the solids with a little MeOH.

The solids, 123 g after drying, contained 22 g of the amino acid (T).

[00115] The solids were mixed with 500 mL of MeOH, refluxed, and the hot mixture filtered, washing with 100 mL of MeOH. The remaining solids were extracted with another 500-mL portion of methanol in the same way. The resulting methanol-insoluble solids, 106 g, contained 7 g of residual amino acid (1).

[00116] The combined methanol filtrates were concentrated to dryness in vacuo and the residue, 92 g, dissolved in 370 mL of water at the boiling point. To remove a small quantity of precipitated protein the hot solution was filtered, rinsing with 50 mL of hot water. Crystallization proceeded as the filtrate cooled. The mixture was cooled to 4 °C and filtered, washing with 40 mL of ice-cold water. Drying in vacuo at room temperature gave 21.4 g of (R)-2-amino-5,5,5-trifluoropentanoic acid (1) as nacreous platelets, ee >99.8%, yield 42.5%.

EXAMPLE 18 - PROCESS FOR PARA-CHLOROBENZENESULFO YLATION OF (R)-TRIFLUORONORV ALINE (1) AND CONVERSION OF THE RESULTING

ACID (3) TO THE ACID CHLORIDE (4) AND THEN TO C ARB OXAMIDE (5)

[00117] The enzymatic reaction mixture, 1400 mL, containing 51 g (298 mmoles) of (R)-trifluoronorvaline (1) (by HPLC assay), was adjusted to pH 1.5 to 2.5 (HC1). After 3 hours the mixture was mixed with CELITE® and filtered to remove precipitated protein. The filtrate was concentrated in vacuo to 950 mL, adjusted to pH 12 (NaOH), and further concentrated to the minimum stirrable volume. Water was added with continued distillation until the concentration of ammonia in the distillate was negligible. Enough water to dissolve precipitated salts was added and the pH adjusted to pH 10.5 (HC1).

[00118] With ice-bath cooling, 100 g of p-chlorobenzenesulfonyl chloride (a 60% molar excess based on assay of trifluoronorvaline at the completion of the enzymatic reaction) was blended with 200 mL of ice-cold water for 60 seconds using an ULTRA- TURRAX®, high setting. The temperature rose to about 20 °C. The resulting slurry was immediately added to the pH 10.5 amino acid solution (20 °C) and the pH maintained at 10.3 to 10.7 (NaOH) for 6 hours.

[00119] The mixture was stirred with 700 mL of methyl t-butyl ether (MTBE) and the pH adjusted to 2.2-2.6 (HC1). The upper phase was separated and washed with several small portions of water, filtering out interfacial precipitate as necessary. The solution was concentrated with addition of 2-methyltetrahydrofuran (MeTHF) to replace MTBE and remove water azeotropically, finally concentrating to about 3 mL of MeTHF per g of p- chlorobenzenesulfonyl trifluoronorvaline (3) (total volume 161 mL). The MeTHF solution (320 mL) of (3) was stirred at 18-22 °C and 25.4 mL (293 mmoles, 30% excess) of oxalyl chloride added over 10 min. The progress of the reaction was monitored by following gas evolution. After 20 min, 2 mL of a 5% solution of dimethyl formamide (DMF) in MeTHF, was added, which gave a dramatic increase in the rate of gas evolution. Further 2-mL portions were added at 40, 50 and 60 min. Gas evolution ceased entirely by 60-70 min. After 90 min the solution was concentrated in vacuo, to remove excess oxalyl chloride and HC1. A 100-mL portion of MeTHF was added and concentrated again to remove final traces of oxalyl chloride. The residue (containing the acid chloride (4)) was dissolved in 156 mL of MeTHF and poured into an ice-cold stirred mixture of 780 mL of MeTHF, 520 mL of water and 260 mL of 15M ammonia. After 10 min the lower phase was separated, back extracting with 400 mL of MeTHF. The combined upper phase was washed with 50-mL portions of 0.5 M sulfuric acid until the washes were acidic and then with 50-mL portions of water until neutral. The organic phase was concentrated in vacuo, chasing with 200 mL of n-butanol. The residue was stirred with n-butanol, (5 mL per g of product) and the mixture warmed until the solid dissolved (-94 °C). The solution was cooled slowly, seeding at 90 °C with a small portion that had been removed and cooled. The mixture was cooled to room temperature over 1.5 hours and then cooled in an ice bath for 1 hour. The product (5) was filtered out, washed with 100 mL of ice-cold n-butanol and dried by suction on the funnel and in vacuo at room temperature, giving 68 g of .(R)-2-(4-Chlorophenylsulfonamido)-5,5,5- trifluoropentanamide (5), mp 21 1-212.5 °C, ee 99.1%, 66% yield.

EXAMPLE 19 - PROCESS FOR PARA-CHLOROBENZENESULFO YLATION OF (R)-TRIFLUORONORV ALINE (1) AND CONVERSION OF THE RESULTING ACID (3) TO THE ACID CHLORIDE (4) AND THEN TO C ARB OXAMIDE (5)

[00120] (R)-2-(4-Chlorophenylsulfonamido)-5,5,5-trifluoropentanamide (5) was prepared from 15 kg of an enzymatic reaction solution containing (R)-2-amino-5,5,5- trifluoropentanoic acid (1), ee 98.95, derived from 600 g, 3.53 moles, of 5,5,5-trifluoro-2- oxopentanoic acid (2). The solution was acidified to pH 2.10 (HC1), and after holding at 5 °C for several days, precipitated protein was filtered out. The filtrate was concentrated in vacuo to 8.5 L, adjusted to pH 12.30 (NaOH) and further concentrated in vacuo with addition of water to remove ammonia. The resulting solution, 6.5 L, contained 556 g (3.25 moles) of (R)-2-amino-5,5,5-trifluoropentanoic acid (T), ee 98.95, by HPLC analysis.

[00121] p-Chlorobenzenesulfonyl chloride, 1099 g (5.20 moles) and 2.2 L of water were cooled to 5 °C, combined and blended with a homogenizer to give a fine suspension of the solid (warmed to 14 °C during the homogenization).

[00122] The pH of the amino acid solution was adjusted to 10.5 (HC1) and the p- chlorobenzenesulfonyl chloride-water mixture added in one shot. The reaction was stirred, keeping the pH between 10.3 and 10.7 for 8 hours by addition of 10 M NaOH. Water (a total of 8 L) was also added as needed to maintain effective stirring. Stirring was continued overnight and the pH, 4.7, adjusted to pH 10.5 (NaOH). After an additional 5 hours the mixture, 20 L, was stirred with 8 L of MTBE, and the pH was adjusted to 2.5 (HCl). The lower phase was separated and discarded. The organic phase contained 910 g (2.63 moles) of (R)-2-(4-chlorophenylsulfonamido)-5,5,5- trifluoropentanoic acid (3) by HPLC analysis.

[00123] The solution was concentrated in vacuo, adding portions of 2- methyltetrahydrofuran (MeTHF) until the water content in the distillate was <0.1 weight%. The solution was diluted to 4 L with MeTHF, and oxalyl chloride, 335 mL, 3.96 moles, was added in 30-mL portions at 1 min intervals. After 30 min, four 26-mL portions of a 5 vol% solution of DMF in MeTHF were added at 10-minute intervals. By 75 min gas evolution (CO and CO₂) had stopped. The solution was concentrated in vacuo with addition of MeTHF until the distillate gave negligible gas evolution when mixed with water.

[00124] A mixture of 7.8 L of MeTHF and 7.8 L of 5 M ammonium hydroxide was cooled to 10 °C and the acid chloride solution (2.8 kg) added rapidly with stirring.

Stirring was continued for 10 min and the mixture then left to settle. The lower phase was separated and discarded.

[00125] The organic phase was stirred and adjusted to pH 2.8 with 0.5 M sulfuric acid. The resulting aqueous phase was discarded and the organic phase washed with 500-mL portions of water until the extract was neutral.

[00126] The organic phase was concentrated in vacuo with addition of 1-butanol to replace the MeTHF and the resulting mixture diluted with 1 -butanol to bring the volume to 5.4 L. Heating to 100 °C dissolved all but a small quantity of the solid. The mixture was stirred while cooling to 0 °C over 6 hours and then at 0 °C for an additional 10 hours. The mixture was filtered and the solid washed with cold 1-butanol and dried on the funnel with suction, giving 800 g of (R)-2-(4-chlorophenylsulfonamido)-5,5,5- trifluoropentanamide (5), as an off-white free-flowing granular solid, mp 211-213.5 °C, ee 99.98, potency 98.4 w%, corrected weight 787 g, 2.28 moles. TABLE 6

Yields of various compounds from conversion reaction

[00127] The mother liquor/wash contained 68 g of 2-(4-chlorophenylsulfonamido)- 5,5,5-trifluoropentanamide (5). A small portion, purified by preparative TLC (not recrystallized), had ee 74.5%. The mother liquor therefore contained 59 g of the (R) enantiomer. A second crop was obtained by crystallization from 1-butanol, giving 30 g of (R)-2-(4-chlorophenylsulfonamido)-5,5,5-trifluoropentanamide (5), ee 99.6%, potency 98.9 w%.

Claims

WHAT IS CLAIMED IS:

1. An isolated nucleic acid molecule comprising a nucleotide sequence according to SEQ ID NO: 12.

2. An isolated polypeptide comprising an amino acid sequence according to SEQ ID NO: 1 1.

3. The polypeptide of claim 2, wherein the polypeptide has amino acid dehydrogenase activity.

4. A recombinant vector comprising the isolated nucleic acid molecule of claim 1.

5. A recombinant vector comprising the isolated nucleic acid of claim 1 and a glucose dehydrogenase gene according to SEQ ID NO: 13.

6. A recombinant host cell comprising the vector of claims 4 or 5.

7. The recombinant host cell of claim 6, wherein the host cell is an E. coli cell.

8. The recombinant host cell of claim 7, wherein the E. coli cell does not express glutamate dehydrogenase activity.

9. A method of converting a keto acid to an amino acid using the amino acid dehydrogenase obtained from the cells according to claim 6.

10. The amino acid of claim 9 wherein the amino acid is (R)-5,5,5- trifluoronorvaline.

11. A bacterial cell which expresses the isolated nucleic acid molecules according to SEQ ID NO: 12 and SEQ ID NO: 13.

12. A method of making an amino acid, said method comprising: contacting a keto acid with the polypeptide of claim 2, in the presence of a nicotinamide cofactor, said polypeptide being capable of catalyzing conversion of the keto acid into its corresponding amino acid.

13. The method of claim 12, wherein the polypeptide comprises SEQ ID NO

11.

14. The method of claim 13, wherein a glucose dehydrogenase enzyme is added for nicotinamide cofactor regeneration.

15. The method of claim 17, wherein the amino acid sequence of the glucose dehydrogenase enzyme comprises SEQ ID NO 14.