WO2015075622A1 - Aptamers against the myelin basic protein as neuroprotective agents - Google Patents

Abstract

The present invention provides aptamers against the Myelin Basic Protein (MBP), as well as the application thereof as neuroprotective agents in Multiple Sclerosis patients and as MBP detection agents.

Description

APTAMERS AGAINST THE MYELIN BASIC PROTEIN AS

NEUROPROTECTIVE AGENTS

Technical field of the invention :

The present invention provides aptamers against the Myelin Basic Protein (MBP), as well as the application thereof as neuroprotective agents in Multiple Sclerosis and as MBP detection agents .

Backgrounds of the invention :

Nucleic acid molecules with specific binding capacity to various target molecules are known in the art (antigens) which confers to them a huge potential for being used as therapeutic and diagnostic tools. These particular molecules are called aptamers and different manufacturing and isolation methods may be found in the literature.

Aptamers are single stranded nucleic acids (ssDNA or ssRNA) . Selection thereof is performed from libraries of oligonucleotides having a central region of variable size and randomized sequence and two flanking regions of known sequence which allow for PCR amplification. The central region is usually comprised between 30 and 60 nucleotides long, thus total length of the aptamer is 70-100 nucleotides.

Up to now, aptamers for metallic ions, organic compounds, peptides, proteins or even complex structures such as virus and cells have been isolated (review article: Gold et al . , Annu. Rev. Biochem. 64 (1995), 763-797; Ellington and Conrad, Biotechnol. Annu. Rev. 1 (1995), 185-214; Famulok, Curr. Opin. Struct. Biol. 9 (1999), 324-329) .

Aptamers are able to bind to an antigen or target specifically and with high affinity, due to its spacial structure (Osborne, S. E. and Ellington, A. D., (1997); Nucleic Acid Selection and the Challenge of Combinatorial Chemistry . Chem Rev97(2) : 349- 370) . Besides their potential application as molecular probes, many protein-recognition aptamers are also capable of interfering in protein biological function. In the last few years, several techniques have been developed that facilitate the intracellular application of aptamers and its use as in vivo modulators of cell physiology. Highly specific agents acting against intracellular targets in the context of a living cell may be obtained by using these properties.

A number of aptamers against medically relevant target proteins have been identified in the art (Jayasena, S. D. (1999) . Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin. Chem. 45(9) : 1628-1650; Cerchia, L., Hamm, J., et al . , (2002) . Nucleic acid aptamers in cancer medicine. FEBS Lett. 528(1-3) : 12-16) . The reasoning behind this new development implies advantages that the identification and application of DNA or RNA molecules have as compared with antibodies.

The method for obtaining monoclonal antibodies (Kohler, G. and Milstein, C, (1975), Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256 (5517) : 495-497) represented a great scientific step forward in many fields of modern biology and medicine. In medical research, these play a prominent role both in the diagnostic and the therapeutic field. However, disadvantages and limitations in the identification and production of antibodies are well known in the art (Jayasena, 1999), such as for example, the need to carry out the process for obtaining antibodies in animals; the problem of availability and reproducibility of hibridoma cells through time; or the high work load and huge expenses of antibodies' production.

An aptamer, in turn, may be selected in specifically designed experimental conditions, so that they are optimal for a specific diagnostic method (Jayasena, 1999) . Aptamers may be better stored for longer periods of time because, contrary to proteins, they are not subject to irreversible denaturation, rather they may be thermally renatured any time.

Strong aspects of the technology:

• In terms of diagnostic and therapeutic potential, they resemble antibodies, being more beneficial than those in several aspects (high reproducibility, room temperature stability and non-immunogenic, among others).

• Obtaining: isolation, selection and modification simplicity, without the need to use living systems. Much lower production cost.

• Aptamer selection is not affected by possible toxicity or immune reaction of certain antigens, as it happens with antibodies .

• Stability: they may withstand denaturing and renaturing processes. In turn, they may be modified during chemical synthesis for resisting the effect of various enzymes.

• Specificity and affinity: they may bind both small molecules and complex multimeric structures, with the same or higher potency than antibodies.

• Capacity to inactivate proteins, without altering the genetic material.

• They allow for simple chemical modification for implementing and customizing certain functionalities.

• Better preservation and shipping properties at room temperature .

• Its smaller size confers advantages in terms of tissue penetration capacity and adhesion to target molecules.

The SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method is used for the selection of aptamers with higher affinity and specificity to the target molecule. In a first stage, the population of aptamers is incubated together with a target molecule which may or may not be bound to a solid support and, interacting to a higher or lesser degree with the target protein according to their affinity. Non- interacting molecules are removed and selected oligonucleotides are amplified by PCR and characterized by solid phase nucleic acid-sequencing, preserving a stock by introduction into bacteria by using cloning plasmids . Once obtained, the individual aptamers are characterized according to their interaction with the target protein by different biochemical techniques such as surface plasmon magnetic resonance (SPR), ELISA, dot blot, or western blot.

The production of the selected aptamer is carried out by chemical synthesis, contrary to most of the molecules with amino acid chemistry acting in a similar fashion. Due to the interactions produced between bases along the chain, these molecules adopt tridimensional structures which allows them to bind stably and very specifically to their targets, which are small molecules through complex multimeric structures.

Given that aptamers may be manufactured by chemical synthesis, it makes them suitable for production at large scale, bringing about a high reproducibility between production batches (Jayasena, 1999) .

The modifications that lead to stabilization of the ssDNA (Agrawal, S. (1996) . Antisense oligonucleotides: towards clinical trials. Trends Biotechno. 114(10) : 376-387) or the ssRNA (Pieken, W. A., Olsen, D. B., et al . (1991) . Kinetic characterization of ribonuclease-resistant 2' -modified hammerhead ribozymes. Science 253(5017): 314-317; Ruckman, J., Green, L. S., et al . (1998) . 2 ' -Fluoropyrimidine RNA-based aptamers to the 165-amino acid form of vascular endothelial growth factor (VEGF165). Inhibition of receptor binding and VEGF-induced vascular permeability through interactions requiring the exon 7-encoded domain. J Biol Chem273(32) : 20556-20567), have been set as routine methods.

Multiple sclerosis (MS) is an inflammatory disease that affects the central nervous system (CNS) and leads to substantial disabilities through deficits of sensation and impaired motor autonomic, and neurocognitive functions.

MS is currently considered to be a CD4+ Thl-mediated autoimmune disease (1,2) . This assumption is based on the cellular composition of brain and cerebrospinal fluid- infiltrating cells and also, on data obtained from the experimental (autoimmune) allergic encephalomyelitis model (EAE) (3) . EAE is induced in susceptible rats and mice by the injection of myelin components promoting a CD4⁺-mediated autoimmune disease which shares similarities with MS (1,3) .

Despite clear indications of CD4+ Thl cells key role in the disease, its etiology remains unknown.

Much evidence suggests that myelin basic protein (MBP) may be an autoantigen candidate in MS (1) .

Myelin Basic Protein (MBP) was first discovered in 1960 by Dr. Marian Kies . In electronic microscopy images of histology sections, MBP is deposited on dense lines on the myelin layer. These layers are formed by deposition of oligodendrocyte cytoplasmic membrane portions wherein MBP serves as an adhesive molecule. MBP is the most studied protein in MS.

MBP-specific T cells may be isolated from MS patients and controls (4-10) . MBP is the most widely studied myelin protein in MS. It is the second most abundant myelin protein after the proteolipid protein (PLP) .

At present, no cure exists for MS and current treatments aim to arrest or slow the progression of the disease and alleviate the symptoms . MBP seems to play an important role in MS progression and could therefore be an interesting drug target. Published data suggest that in MS patients, antibodies recognize MBP and recruit inflammatory cells to focal areas, where myelin stability is affected in the central nervous system. Moreover, T cells in MS patients are able to recognize MBP peptides exposed on antigen-presenting cells, which are capable of triggering an immune response against MBP.

The MS plaque is characterized by having focal areas of myelin destruction. These lesions are mostly seen in optic nerve, brain, spinal cord and white matter. In these plaques there is also lymphocyte infiltration in perivascular regions together with macrophages. MBP-specific CD4+ Thl cells have been characterized in MS patients.

It is known in the state of the art from Nastasijevic et al (2012) "Remyelination Induced by a DNA Aptamer in a Mouse Model of Multiple Sclerosis". PLoS ONE 7(6) : e39595. doi : 10.1371/ j ournal . pone .0039595 , an aptamer that binds to a myelin extract. In fact, Nastasijevic et al (2012) disclosed the obtaining of the aptamer 3064 from myelin extracts, which specificity towards MBP was not proven.

The aptamer 3064 by Nastasijevic et al (2012) is 40 bases long and was injected into animals in the form of a multimeric complex, biotinylated and streptavidin-conj ugated, not being suitable for therapeutic administration. However, Nastasijevic et al (2012) demonstrated certain remyelination, though no improvements were found in the cognitive and motor functions of the animals.

Therefore, there is a need for finding MBP-binding molecules which are suitable for therapeutic use, with specificity and biodistribution so as to allow to obtain remyelination together with improved cognitive and motor functions in animals . Summary of the invention:

In one embodiment of the present invention, aptamers are provided that specifically recognize the Myelin Basic Protein (MBP) and have a length of less than 100 nucleotides. The aptamers of the invention may be single stranded DNA or RNA.

In a preferred embodiment of the present invention, aptamers or variants thereof are provided which comprise the sequence 5' GCGTCGATTGCCATGGGTTG 3' (SEQ ID N° 1) on the 5' end, and the sequence 5' CACGCAGTGAGCTCCCCTGGACC 3' (SEQ ID N° 2) on its 3 ' end .

The aptamers or variants thereof according to the present invention preferably have a length of more than 60 nucleotides and less than 93 nucleotides, and more preferably, a length of more than 60 nucleotides and less than 70 nucleotides.

In a yet more preferred embodiment of the invention, the aptamer or variants thereof is selected from:

5 ' GCGTCGATTGCCATGGGTTGGGTCCGCGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C13) (SEQ ID N° 3), and

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C19) (SEQ ID N° 4) .

Certain nucleotides of the aptamers of the invention may be modified with any one of the following: phosphorothioate, Locked Nucleic Acids (LNA), Morpholino phosphorodiamidate , N3'-P5' phosphoramidate, 2 ' -C-allyl uridine, 2'-fluoro nucleotides, 2' -amino nucleotides.

The present invention also provides pharmaceutically suitable aptamer salts, which may be manufactured by known methods.

The aptamers of the present invention are also useful as therapeutic agents for the treatment and prevention of all those MBP-related diseases, in particular, demyelinating and dysmyelinating diseases, in particular, it relates to Multiple Sclerosis (MS) .

Thus, in another aspect, the invention relates to the aptamers of the invention or mixtures of several aptamers for its use in medicine, as well as to pharmaceutical compositions comprising at least an aptamer of the invention and derivatives thereof, which homologies are 40% or less and, optionally, one or more pharmaceutically acceptable supports, excipients or solvents .

In another preferred embodiment of the invention, the present invention also relates to the use of nucleic acids, according to the invention, as a diagnostic tool.

Summary of the figures :

Fig. 1A: Binding activity of aptamers after 15 cycles. Aptamer binding was detected by a dot-blotting after 15 SELEX selection rounds. l]ig of MBP was placed on a nitrocellulose membrane and incubated with equal nanomolar amounts of biotinylated aptamers in selection buffer containing 0.1 mg/ml yeast tRNA. The selected library against MBP is MBP C15; Cll is another aptamer group selected against another MBP- unrelated target molecule. Bound aptamers were detected with an anti-biotin alkaline phosphatase-conjugated antibody.

Fig. IB: Binding activity of aptamers selected against MBP. MBPcl3 and MBPcl9 are unique MBP-specific clones. The same micromolar amount of MBP and AGP were placed on the nitrocellulose membrane and incubated with equal nanomolar amounts of biotinylated aptamers MBPcl3, MBPcl9 and a non- selected library.

Fig. 1C: Role of attached biotin in the MBPcl3 binding activity to MBP. l]ig of MBP was placed on a nitrocellulose membrane and incubated with equal nanomolar amounts of biotinylated aptamers or biotin alone. MBPcl3 is clone 3 of the selected aptamers. "Only biotin" is a membrane which was incubated with free biotin. MBPcl3 DNAsel is clone 3 of the aptamer treated with the enzyme and MBPcl3 without DNAsel is the aptamer with the enzyme buffer solution.

Fig. 2 : Sequence alignment of the two more representative clones of the enriched library selected against MBP . The sequence corresponding to the primers' binding region is underlined. Bold letters show the differences between both clones .

Fig. 3: MBP binding activity of MBPcl3 as compared to shuffled sequence-MBPcl3.

Fig. 4A: Prediction of MBPcl9 secondary structure and possible binding active sites to MBP

Fig. 4B : Prediction of MBPcl3 secondary structure and possible binding active site to MBP

Fig. 4C : Prediction of MBPcl3 secondary structure and possible binding active site to MBP

Fig. 5 : Affinity for MBP. MBPcl9 AF includes stem 5, loop A and F; MBPcl3 BC includes stem 8 and loops B and C; MBPcl3 includes stem 7 with loops A and E.

Fig. 6A: Binding activity of MBPcl3 and aptamer 3064 to MBP.

Fig. 6B: Binding activity of MBPcl3 and aptamer 3064 to MBP in a complex protein mixture. Mass units on the right side of aptamer 's name depicts the amount of MBP present in the complex protein mixture (1, 0.5 or 0 μg) .

Fig. 7A: Binding activity of MBPcl3 and an anti-MBP polyclonal antibody to MBP.

Fig. 7B: Binding activity of MBPcl3 and an anti-MBP polyclonal antibody to MBP in a complex protein mixture. Mass units on the right side of aptamer 's or IgG name depicts the amount of MBP present in the complex protein mixture (1 or 0.5 μg) . Fig. 7C: MBPcl3 and an anti-MBP polyclonal antibody competition for MBP . Columns: First column, MBP was incubated with the anti-MBP antibody, washed and then incubated with aptamer MBPcl3. Second column, MBP was incubated only with anti-MBP. Third column, MBP was incubated with MBPcl3, washed and then incubated with anti-MBP. Fourth column, anti-MBP and MBPcl3 were incubated together. Fifth column, anti-MBP was incubated without MBP.

Fig. 8A: Binding activity of MBPC13 and a version thereof with nucleotides modified with phosphorothioate (MBPcl PS) to MBP. Lib is the binding activity of the non-selected original library .

Fig. 8B: Binding activity of MBPC13 and a phosphorothioate version (MBPcl PS) to MBP using a brain myelin extract as a MBP source. Lib is the binding activity of the non-selected original library.

Fig. 9: Localization of MBPC13 in histological mouse brain sections. Serial mouse brain sections were used for assessing the localization of an anti-myelin antibody (A) and with aptamer MBPC13 (B) . MBPC13 was detected in myelin-rich areas such as corpus callosum, cerebral peduncle, thalamic radiation, fasciculus retroflexus, and premammilary nucleus. Both the MBP-specific antibody and MBPC13 were localized to similar brain areas.

Detailed description of the invention:

The details of one or more embodiments of the disclosure are set forth in the description below. Now, the preferred procedures and materials are described. Other features, objects and advantages shall become evident from the description. In the present specification, the singular references also include the plural references, unless the context clearly indicates otherwise. Unless otherwise defined, all the technical and scientific terms used in the present document have the same meaning as usually understood by an expert in the art to which this disclosure pertains. In case of conflict, the specification herein shall prevail.

The aptamers of the present invention are single stranded nucleic acid molecules and include DNA and RNA molecules, as well as variants thereof which have been modified with the aim of improving the molecules' resistance to body nucleases and pharmacokinetics. Such modifications include nucleotide modifications, phosphodiester bond modifications, as well as polyethylene glycol conjugates.

In vivo, the aptamers share with the natural DNA a very short life-time in blood, estimated to be of 1 to 2 minutes. This short life-time is sometimes attributed to the serum nuclease. The serum nuclease gives truncated aptamer DNA fragments as a result of its activity, lacking the affinity for the target protein .

For the purposes of the present invention, nucleic acids are understood as polymeric molecules which, in the case of RNA, are composed of the nucleotides adenosine (A), cytidine (C), uridine (U) , guanosine (G) and, in the case of DNA, are composed of deoxyadenosine (A), deoxycytidine (C), deoxyguanosine (G) and thymidine (T) . These nucleotides may display at least one of the following modifications: 2'-deoxy, 2'-fluoro, 2'-chloro, 2'-bromo, 2'-iodo, 2' -amino (preferably unsubstituted or mono- or disubstituted) , 2' -mono-, di- or tri-halo-methyl , 2'-0-alkyl, 2 ' -O-halo-substituted alkyl, 2'- alkyl, azido, phosphorothioate, sulfhydryl, methylphosphonate, fluorescein, rhodamine, pyrene, biotin, xanthine, hypoxanthine , 2 , 6-diaminopurine, 2-hydroxy-6-mercaptopurine, polyethylene glycol modifications and for the sulfur of the pyrimidine bases at position 6 and the halogen at position 5, Cl-5 alkyl, abasic linkers, 3 ' -deoxyadenosine or other chain terminators or non-extensible nucleotide analogs in the 3' end or other modifications at the 5' and/or 3' end. Other modifications as described in the prior art such as, for example, in WO 02/26932 are of course also included in the present invention.

For an aptamer to retain affinity for its target protein, the same nucleotide analogs should be used as those used in the selection experiment for the synthesis of the aptamer for practical use. The introduction of nucleotide analogues that override the contacts between the aptamer and the target protein should be avoided, since it would result in a decrease in binding affinity.

The affinity of aptamers for their target proteins is typically in the nanomolar range, but can be as low as the picomolar range. That is, Kd is typically 1 pM to 500 nM, more typically from 1 pM to 100 nM. Aptamers that have an affinity of Kd in the range of 1 pM to 10 nM are also useful.

Aptamers will typically have a length of 10 to 200 nucleotides, more typically less than 100.

The aptamers of the present invention have a preferred length of less than 100 nucleotides, being preferably greater than 60 and less than 93 nucleotides, and still most preferably greater than 60 and less than 70.

Nucleic acids according to the present invention may be manufactured in a simple manner, for example, by conventional chemical synthesis using a DNA / RNA solid phase synthesizer, without representing a problem for the expert in the art. The corresponding protocols and devices are known to the skilled person in the art and are of routine use. The product may be purified by size selection methods or by chromatographic methods .

Aptamer sequences may be chosen as a desired sequence, or randomized- or partially randomized- sequence populations may be made, and then be selected for their specific binding to myelin basic protein. Any of the tests typically known in the art for assessing nucleic acid-protein binding may be used, for example, Southwestern blotting using either labeled oligonucleotides or labeled protein as a probe.

A suitable process for generating an aptamer is titled "Systematic Evolution of Ligands by Exponential Enrichment" ( "SELEX (TM) " ) . The SELEX(TM) process is a process for the in vitro evolution of nucleic acid molecules having high specific binding to target molecules and is described, for example, in Patent Application US Serial No. 07/536,428 filed June 11, 1990, now abandoned, US patent No. 5,475,096 titled "Nucleic acid ligands" and US patent No. 5,270,163 (see also WO 91/19813) titled "Nucleic acid ligands". Each nucleic acid ligand identified in the SELEX (TM), that is, each aptamer, is a specific ligand for a given target compound or molecule. The SELEX (TM) process is based on the unique knowledge that nucleic acids have sufficient capacity to form a variety of bi- and tri-dimensional structure and sufficient chemical versatility available within its monomers in order to act as ligands (i.e., they form specific binding pairs) with practically any chemical compound, both monomeric and polymeric. Molecules of any size and composition may serve as targets .

SELEX (TM) is based, as a starting point, in a large library or single stranded oligonucleotide set which comprise randomized sequences. Oligonucleotides may be DNA, RNA, DNA/RNA hybrids, either modified or non-modified. In some examples, the set comprises 100% of randomized or partially randomized oligonucleotides. In other examples, the set comprises randomized or partially randomized oligonucleotides containing at least one fixed and/or conserved sequence incorporated within the randomized sequence. In other examples, the set comprises randomized or partially randomized oligonucleotides containing at least one fixed and/or conserved sequence on its 5' and/or 3' end, which may comprise a sequence shared by all the molecules of the oligonucleotide set. Fixed sequences are sequences which are common to nucleotides in the set, which is incorporated for a preselected purpose, such as CpG motifs, annealing sites for PCR primers, promoter sequences for RNA polymerases (for example, T3, T4, T7 and SP6), restriction sites or homopolymeric sequences such as portions of poly A or poly T, catalytic cores, sites for selective binding to affinity columns and other sequences for facilitating cloning and/or sequencing of an oligonucleotide of interest. Conserved sequences are sequences, different to the fixed sequences previously described, shared by several aptamers which bind the same target.

The oligonucleotides of the set preferably include a portion of randomized sequence, besides the fixed sequences required for efficient amplification. Usually, the oligonucleotides of the starting set contain fixed sequences of the 5'- and 3' -end flanking an internal region of 30-50 random nucleotides. Random nucleotides may be produced by several ways including chemical synthesis and size selection from the cellular nucleic acids cleaved at random. Sequence variation in the randomized region of the test nucleic acids may also be modified by means of the introduction or increase of sequences by mutagenesis before or during the selection/amplification iterations .

The portion of the randomized sequence of the oligonucleotide may be of any length and may comprise ribonucleotides and/or deoxyribonucleotides and may include modified nucleotides, or non-natural or nucleotide analogs. See, for instance, US patent No. 5,958,691; US patent No. 5,660,985; US patent No. 5,958,691; US patent No. 5,698,687; US patent No. 5,817,635; US patent No. 5,672,695 and PCT publication WO 92/07065. Randomized oligonucleotides may be synthesized by using oligonucleotide synthesis techniques in solid phase, well known in the art. See, for instance, Froehler et.al., Nucl. Acid Res. 14:5399-5467 (1986) and Froehler et.al., Tet. Lett. 27:5575-5578 (1986) . Randomized oligonucleotides may also be synthesized by using dissolution-free processes such as the triester synthesis processes. See, for instance, Sood et.al., Nucl. Acid Res. 4:2557 (1977) and Hirose et.al., Tet. Lett., 28:2449 (1978) . Typical synthesis carried out in DNA synthesis automated equipment yield 10¹⁴-10¹⁶ individual molecules, a number sufficient for most of the SELEX™ assays. Sufficiently large regions of the randomized sequence in the sequence design increases the chances that each synthesized molecule likely represents a single sequence.

The starting oligonucleotide library may be generated by automated chemical synthesis in a DNA synthesizer. For the synthesis of randomized sequences, mixtures of four nucleotides are added to each nucleotide addition step during the synthesis process, allowing the random incorporation of the nucleotides. As has been set forth before, in an embodiment the randomized oligonucleotides comprise complete randomized sequences; however, in other embodiments the randomized oligonucleotides may comprise extensions of nonrandomized or partially randomized sequences. Partially randomized sequences may be created by adding the four nucleotides at different molar ratios in each addition step.

The starting oligonucleotide library may be either RNA or DNA, or RNA or DNA with modified nucleotides. In those cases where an RNA library is to be used as a starting library, it is usually generated by synthesizing a DNA library, optionally amplifying by PCR, then transcribing the DNA library in vitro by using RNA polymerase T7 or modified RNA polymerases T7, and purifying the transcribed library. Then, the RNA or DNA library is mixed with the target in conditions favorable for the binding, and it is subject to step-wise binding, separation and amplification iterations, using the same general selection scheme, for achieving practically any desired affinity and binding selectivity criteria. More specifically, by beginning with a mixture containing the starting nucleic acid set, the SELEX (TM) process includes the steps of: (a) contacting the mixture with the target in conditions favorable for the binding; (b) separating unbound nucleic acids from those nucleic acids which have specifically bound to target molecules; (c) dissociating the nucleic acid- target complexes; (d) amplifying the nucleic acids dissociated from the nucleic acid-target complexes in order to give an nucleic acid ligand-enriched mixture; and (e) reiterating the steps of binding, separation, dissociation and amplification throughout as may cycles as desired to yield highly specific nucleic acid ligands with high affinity for the target molecule. In those cases where the RNA aptamers are being selected, the SELEX(TM) process also comprises the steps of: (i) reverse transcription of the dissociated nucleic acids of the nucleic acid-target complexes before the amplification in step (d) ; and (ii) transcription of the nucleic acids amplified in step (d) before starting the process again.

Within a mixture of nucleic acids containing a large number of possible sequences and structures there is a wide interval of binding affinities for a given target. A mixture of nucleic acids comprising, for example, a segment of 20 nucleotides at random by have 1.09¹² candidate possibilities. Those having the higher affinity (lower dissociation constants) for the target are the ones more likely to bind the target. After the separation, dissociation and amplification, a second mixture of nucleic acids is generated, which is enriched in the candidates with higher binding affinity. Additional selection rounds progressively favor the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or some sequences. Then, this may be cloned, sequenced and tested individually for the binding affinity as pure ligands or aptamers.

The selection and amplification cycles are repeated until a desired object is achieved. For the most general case, selection/amplification continues until a significant improvement in the binding strength is achieved by cycle repetition. The process is usually used for sampling approximately 10¹⁴ species of different nucleic acids, but may be used for sampling up to approximately 10¹⁸ species of different nucleic acids. Generally, the nucleic acid aptamer molecules are selected in a process of 5 to 20 cycles.

The main SELEX(TM) process has been modified to achieve several specific purposes. For example, US patent No. 5,707,796 discloses the use of SELEX(TM) together with gel electrophoresis for selection of nucleic acid molecules with specific structural characteristics, such as bent DNA. US patent nro. 5,763,177 discloses SELEX ( TM) -based processes for selection of nucleic acid ligands containing photoreactive groups which bind and/or photocrosslink to and/or photoinactivate a target molecule. US patent nro. 5,567,588 and US patent nro. 5,861,254 disclose SELEX (TM) -based processes that allow for a highly efficient separation between oligonucleotides having high and low affinity for a target molecule. US patent nro. 5,496,938 discloses processes for obtaining enhanced nucleic acid ligands after performing the SELEX (TM) process. US patent nro. 5,705,337 discloses processes for covalently linking a ligand to its target.

The object of the present invention is, therefore, to provide MBP-binding aptamers suitable for therapeutic use, which display a suitable specificity and biodistribution in order to obtain remyelination together with enhanced cognitive and motor functions in animals.

This is accomplished by the aptamers which specifically recognize the Myelin Basic Protein (MBP) and display a length of less than 100 nucleotides, of the present invention. In fact, its reduced size guarantees its biodistribution.

The aptamers of the invention may be single stranded DNA or RNA. In another embodiment of the present invention, aptamers or variants thereof are provided which comprise the sequence 5 ' GCGTCGATTGCCATGGGTTG (SEQ D N ° 1), or its RNA

5 ' GCGUCGAUUGCCAUGGGUUG on its 5' end.

In another embodiment of the present invention, aptamers or variants thereof are provided which comprise the sequence 5 ' CACGCAGTGAGCTCCCCTGGACC (SEQ ID N° 2), or its RNA

5 ' CACGCAGUGAGCUCCCCUGGACC on its 3' end.

In yet another embodiment of the present invention, aptamers or variants thereof are provided which comprise the sequence 5 ' CGTCGATTGCCATGGGTTG (SEQ ID N° 1) on its 5' end, and the sequence 5 ' CACGCAGTGAGCTCCCCTGGACC (SEQ ID N° 2) on its 3' end .

The aptamers or variants thereof according to the present invention preferably have a length of more than 60 nucleotides and less than 93 nucleotides, and more preferably, a length of more than 60 nucleotides and less than 70 nucleotides.

The aptamers or variants thereof according to the present invention comprise the following preferred sequences:

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C12) (SEQ ID N°5),

5 ' GCGTCGATTGCCATGGGTTGGGTCCGCGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C13) (SEQ ID N°3),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C17) (SEQ ID N°6),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C19) (SEQ ID N°4),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP Clll) (SEQ ID N°7), 5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACCACGCAGTGAGCTCCCCTGGACC (MBP_C115) (SEQ ID N°8),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C115' ) (SEQ ID N°9),

5 ' GCGTCGATTGCCATGGGTTGGCACGCAGTGAGCTCCCCCACGCAGTGAGCTCCCCTGGAC C (MBP_C117) (SEQ ID N°10),

5 ' GCGTCGATTGCCATGGGTTGGGTCCGCGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C120) (SEQ ID N°ll),

5 ' GCGTCGATTGCCATGGGTTGGGCAGTGAGCTCCCCTGGGCACGCAGTGAGCTCCCCTGGA CC (MBP_C123) (SEQ ID N°12),

5 ' GCGTCGATTGCCATGGGTTGGGTCCGCGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C124) (SEQ ID N°13),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C128) (SEQ ID N°14),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C130) (SEQ ID N°15),

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C135) (SEQ ID N°16), ό

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C138) (SEQ ID N°17) .

In a preferred embodiment of the invention, the aptamer or variants thereof is selected from:

5 ' GCGTCGATTGCCATGGGTTGGGTCCGCGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C13) (SEQ ID N°3), and

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C19) (SEQ ID N°4) .

In a more preferred embodiment of the invention, the aptamer or variants thereof is : 5 ' GCGTCGATTGCCATGGGTTGGGTCCGCGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C13) (SEQ ID N°3) .

In a more preferred embodiment of the invention, the aptamer or variants thereof is :

5 ' GCGTCGATTGCCATGGGTTGGGTCTACGCAGTGAGCTCTCCTGGACCACGCAGTGAGCTC CCCTGGACC (MBP_C19) (SEQ ID N°4) .

As previously mentioned, the invention is subject to particular modifications thus providing a molecule with the same features but with some nucleotide modifications which confer higher serum stability to the molecule. The same molecule may be used for conjugation to other chemical groups adding functionality such as for example, facilitating the translocation of the aptamer through the blood-brain barrier. The modified nucleotides may be any one of the following: phosphorothioate, Locked Nucleic Acids (LNA), Morpholino phosphorodiamidate, N3'-P5' phosphoramidate, 2'-C-allyl uridine, 2'-fluoro nucleotides, 2' -amino nucleotides.

Pharmaceutically suitable salts may be also obtained from the aptamers according to the present invention, which may be manufactured using known methods such as dissolving the compounds according to the present invention, in the corresponding aqueous buffer solutions or in H₂0 and subsequently lyophilizing them. Metallic salts may be obtained by dissolving the compounds according to the present invention, in solutions containing the corresponding ion and subsequently isolating the compound using HPLC or gel filtration methods.

Other processes and methods for the manufacturing of aptamer drugs as well as their administration are disclosed, for example, in WO02/26932 and may also be used of course in this invention .

It is known that aptamers are not only capable of binding a target molecule but also may effect structural alterations therein which may lead to the loss of activity in the target molecules or may interfere with the interaction of the target protein with other proteins in the cells. For this reason, and considering the essential role of the MBP, the aptamers of the present invention are also useful as therapeutic agents for the treatment and prevention of all those MBP-related diseases, in particular, autoimmune or demyelinating diseases of the nervous system, more specifically, demyelinating autoimmune diseases.

Examples of MBP-related diseases may be: encephalomyelitis, including viral and allergic encephalomyelitis, hypoxia, trauma leukodystrophy neoplasia, Wernicke disease, Guillen- Barre syndrome and central nervous system lupus, and demyelinating diseases of the central nervous system (such as, multiple sclerosis) .

Other demyelinating diseases may be: Clinically isolated syndrome, acute disseminated encephalomyelitis, acute hemorrhagic leukoencephalitis, Balo's concentric sclerosis, Marburg's disease, isolated acute myelitis, multiple sclerosis, optic neuromyelitis, opticospinal multiple sclerosis, isolated recurrent optic neuritis, chronic relapsing inflammatory optic neuropathy, recurrent acute myelitis, delayed post-anoxic encephalopathy, osmotic myelinolysis .

The aptamers of the present invention are especially suitable for the treatment and/or prevention (or delay in the development) of multiple sclerosis (MS) .

Thus, in another aspect, the invention relates to aptamers of the invention or mixtures thereof, for its use in medicine, as well as to pharmaceutical compositions comprising at least an aptamer of the invention and, optionally, one or more pharmaceutically acceptable supports, excipients or solvents. For each patient, the specific medication and posology are dependent upon several factors including activity of the specific compounds used, age of the patient, body weight, overall health state, sex, nutrition, time of administration, administration method, excretion rate, interaction with other medicines, and severity of the disease for which the therapy is applied. These shall be determined by a physician based on the mentioned factors .

For their use in medicine, the compounds and combinations of compounds of the invention may be formulated together with an excipient which is acceptable from a pharmaceutical point of view. Preferred excipients for use in the present invention include sugars, starches, celluloses, gums and proteins. In a particular embodiment, the pharmaceutical composition of the invention shall be formulated in a pharmaceutical administration solid form (e.g., tablets, capsules, pills, granules, suppositories, etc.) or liquid form (e.g., solutions, suspensions, emulsions, etc.) . In another particular embodiment, the pharmaceutical compositions of the invention may be administered through any route, including, without limitation, oral, intravenous, intramuscular, intraarterial, intramedular, intrathecal, intraventricular, transdermic, subcutaneous, intraperitoneal, intranasal, enteric, topical, sublingual or rectal routes. A review of the different administration forms of active ingredients, the excipients to be used and their manufacturing processes, may be found in the Tratado de Farmacia Galenica, C. Fauli i Trillo, Luzan 5, S.A. de Ediciones, 1993. Dosis and regimens of administration may be determined empirically by the expert by widely known methods .

In a preferred embodiment of the present invention, pharmaceutical preparations are provided which include at least one of the aptamers according to the invention.

In another preferred embodiment of the invention, the present invention also relates to the use of nucleic acids, according to the invention, as a diagnostic tool. In this invention, labeled nucleic acids may be used. Labelling may be accomplished for example by a fluorescent dye, enzyme, antibody or radionuclide. Corresponding detection methods are known to those skilled in the art.

Preferably, an aptamer according to the invention is a component part of a kit, together with, for example, negative and positive controls . The expert perfectly knows that the corresponding aptamers may be applied, in principle, as antibodies for example, in ELISA applications, chromatographic methods and diagnostic/tracing procedures.

Examples :

The present examples refer to particular cases of the present invention, without limitation.

MATERIALS AND METHODS

Materials. Mouse myelin basic protein, Bovine Serum Albumin fraction V, alkaline phosphatase-conj ugated monoclonal anti- biotin, human alpha acid glycoprotein and anti-MBP polyclonal antibodies were purchased from Sigma Aldrich. Yeast tRNA was purchased from Biodynamics. Taq Polymerase and dideoxynucleotides were obtained from Fermentas . The colorimetric substrates of the alkaline phosphatase (nitroblue tetrazolium chloride and bromo-chloro-indolyl [NBT/BCIP]) were purchased from Promega. HRP-conj ugated avidin was purchased from Pierce. Alkaline phosphatase-conjugated streptavidin was purchased from Promega. High binding capacity Microlon ELISA plates were obtained from Greiner Bio-One. The oligonucleotides were synthesized by Integrated DNA Technologies . Nitrocellulose Hybond™ ECL™ membranes were obtained from Amersham Biosciences. Salmon sperm DNA was purchased from Life Technologies . All other reagents and chemicals were of the highest purity available and were obtained from commercial sources. SELEX. The starting single stranded DNA (ssDNA) library was designed to contain a 35-nucleotide randomized sequence region, flanked by constant primer annealing regions (5'- GCGTCGATTGCCATGGGTTG (N) 35 CACGCAGTGAGCTCCCCTGGACC-3') - A biased molar volume (30% A, 30% C, 20% G and 20% T) was used for the synthesis of the four phosphoramidites was used to compensate for their incorporation efficiencies and to generate a truly randomized region. The first round of selection was initiated with 0.5 nmol (approximately 3xl0¹⁴ molecules) of ssDNA. Prior to selections, ssDNAs were dissolved in a buffer solution (BS; 20mM Tris-HCl pH 7.6, 150mM NaCl, 5mM MgCl₂), denatured at 95°C for 5 minutes and cooled on ice for another 5 minutes. Affinity selections were done as follows: MBP was immobilized onto a nitrocellulose membrane disc and blocked in blocking buffer (BS containing 2% BSA, bovine serum albumin) for 60 minutes. After several washes with BS, MBP was incubated with the ssDNA at 37 °C for a fixed period of time. Counter-selection of aptamers was performed by incubating the ssDNA library with nitrocellulose membrane discs that had been blocked with blocking buffer for 60 minutes at SELEX cycles 2, 3, 4, 5, 7, 9, 11, and 12. Molar ratio of MBP to aptamers, as well as washing stringency, and incubation time were modified over the SELEX cycles (table 1) .

Table 1:

115 10.097 10.019 |NO |30min |5

After the BS washing, aptamers bound to the MBP were eluted in distilled water by heating the compound at 95°C for 10 minutes. Asymmetric Polymerase Chain Reaction (asymmetric PCR) was performed with the eluted aptamers in 100 μΐ-reactions containing: 2μΜ forward primer 5 ^>-GCGTCGATTGCCATGGGTTG-3' (SEQ ID N°l); 2μΜ reverse primer 5' -GGTCCAGGGGAGCTCACTGCGTG-3' ( SEQ ID N°18); 200μΜ of each of the triphosphate deoxyribonucleotide (dNTP); lOmM Tris-HCl (pH 8.8 at 25°C), 50mM KC1, 0.08% (v/v) Nonidet P40, 0.8M MgCl₂. The thermal cycle consisted of one cycle at 95°C for 10 minutes and cycles of 95°C for 30 seconds, at 58°C for 40 seconds and 72°C for 40 seconds. The number of PCR cycles was estimated empirically in order to avoid the amplification of PCR products of incorrect sizes. Following PCR amplification, single stranded DNA was precipitated with ethanol and a pellet was collected by centrifugation . The pellet was vacuum dried and resuspended in distilled water for use in the next selection round as a template .

Cloning and sequencing. Aptamers obtained in the 15th selection round were asymmetrically amplified by PCR, purified and used as templates for standard PCR. The double-stranded DNA PCR product was cloned using the reagent kit of the product pGEM®-T Easy (Promega) and the transformed individual bacterial clones were checked for the presence of aptamers with a correct size. DNA for sequencing was produced from single colonies and sequenced at the Instituto Nacional de Tecnologia Agropecuaria (INTA) . Sequence alignments were performed using CLUSTAL W.

Dot Blotting. Biotinylated aptamers were generated by asymmetric PCR with a biotinylated forward primer 5 ' or by solid phase synthesis. Aptamers were heated to 95°C for 5 minutes and then chilled on ice for another 5 minutes. Pure MBP protein was applied to a nitrocellulose membrane with a pore size of 0,45μπι and was dried in air. The membranes were blocked with a blocking buffer or Tris buffered saline (TBS; 20 mM Tris-HCl pH 7.5, 500 mM NaCl) with 2% bovine serum albumin for one hour at room temperature. The membranes were then washed three times with BS or TBS, and incubated with 0.014 nmoles aptamers in BS or TBS containing 0.1 mg/ml yeast RNAt for 2 hours at 37°C. Then, the membranes were washed three times with BS or TBS and were incubated for 1 hour at room temperature with an anti-biotin monoclonal antibody conjugated to alkaline phosphatase in BS or TBS containing 2% bovine serum albumin. The membranes were washed three times and the biotinylated aptamers were detected with the colorimetric substrates of the alkaline phosphatase (NBT/BCIP) .

Binding assays. A Microlon high capacity ELISA plate is coated overnight with MBP in lOOul 0.05 M sodium carbonate pH 9.6. The wells were washed three times with phosphate buffer saline (PBS) containing Tween 20 (PBS-T; IMm KH₂P0₄, lOmM Na₂HP0₄, 137mM NaCl, 2.7mM KC1, 0.05% Tween 20) and were blocked with PBS-T containing 3% bovine serum albumin for 1 hour. Then, the wells were washed three times with BS and were incubated with aptamers in BS in the presence of 0.1 mg/ml yeast tRNA or salmon sperm DNA. Before the addition of aptamers, they were heated at 95°C for 5 minutes and chilled on ice for another 5 minutes. The wells were washed three times with BS and HRP-conj ugated avidin was added in BS containing 2% bovine serum albumin for 1 hour. Then, the wells were washed three times with BS and TMB (3,3', 5,5'- tetramethylbenzydine ) was used for the HRP substrate. Absorbance was measured at 450nm with a Biotek® μζ)ιΐ3ηί™ microplate spectrophotometer.

Binding assay with protein mixture. Three plates with HeLa (ATCC®) cells grown to confluence were washed twice with PBS and lysed in RIPA buffer solution (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 NP-40 1%, 0.5% sodium deoxycholate, 0.1% SDS, 0.2mM phenylmethylsulfonyl fluoride, 10 nM leupeptin and 10 pg/ml aprotinin) . The lysates were centrifuged at 15,000 xg in a table centrifuge at 4°C for 15 minutes and were collected in a single tube. Microlon ELISA plates were prepared as described above and 75μ1 of cell lysates were added for 1 hour to each well that previously had the MBP protein. After three washes with PBS-T, the wells containing the MBP protein and cell lysates with PBS-T containing 3% bovine serum albumin were blocked for 1 hour. Aptamers were added and detection continued as described above (Binding Assays) .

Histochemistry. Mouse brains were fixed in paraformaldehyde solution (PFA) and embedded in paraffin. Paraffin-embedded tissue was sectioned into 5μm-thick slices. Histochemical identification of myelin was performed as follows: Sections of mouse brain tissue were deparaffinized in xylene, rehydrated in alcohol of decreasing graduations, washed in distilled water for 5 min . and reserved in IX BS until its use. For the myelin detection with the aptamer MBPC13, the tissue was incubated in PBS containing 4% PFA and 0.3% triton for 1 min., then washed and incubated with 5mM MBPC13 for 2 hours at 37 °C in IX BS containing 2% BSA. Color development was carried out in the commercial reagent kit SIGMA Magenta and assessment was performed on a Nikon Eclipse E200 microscope.

For the detection of myelin with anti-MBP antibody, tissue sections were incubated in PBS containing 4% PFA and 0.3% triton for 1 min. Then, they were washed and treated with H₂0₂ 0.3% in water for quenching the activity of endogenous peroxidases. Then, the tissue sections were washed and blocked with PBS containing 2% BSA for 30min. Then they were washed and incubated with the rabbit anti-MBP antibody in PBS containing 1% BSA for 1 h. at room temperature. Then, the sections were washed and incubated with an anti-rabbit IgG HRP-conj ugated antibody for 1 h. in PBS containing 1% BSA. Color development was carried out with the commercial reagent Vectastain elite ABC kit (rabbit IgG) from Vector Laboratories and assessment was performed in a Nikon Eclipse E200 microscope .

RESULTS

Aptamer selection

Single-stranded DNA molecules exhibiting high affinity for mouse MBP were obtained by an in vitro aptamer selection process, named SELEX. Several variables were modified during the successive SELEX rounds in order to increase the stringency of the selection (Table 1) . The SELEX cycle was started with a library of ~3 10¹⁴ distinct ssDNA molecules. Aptamers obtained at the 15th cycle (MBP C15) were analyzed by dot-blotting (Figure la) . Figure la shows the MBP-binding activity of the pool of specific aptamers compared to the activity of another pool of aptamers that had been selected to an unrelated protein. After 15 SELEX rounds, the aptamer pool was cloned and 15 clones were sequenced. Sequences were aligned using the ClustalW algorithm and clustered into groups of closely related nucleotide sequence, which revealed two prominent families with highly conserved sequences. These families were represented by the clones MBPcl3 and MBPcl9 (Figure 2) . Interestingly, the length of the randomized region was shortened in all sequences. While the original library was designed to contain 35-nucleotide long randomized region, the aptamer obtained after 15 rounds of SELEX displayed a 26- nucleotide long randomized region.

Clones MBPcl9 and MBPcl3 were generated by solid-phase synthesis for further studies. Figure IB shows the MBP-binding activity of both clones by dot-blotting analysis. The binding of both aptamer clones to alpha acid glycoprotein (AGP) and to plasmatic albumin (data not shown) were also tested because these proteins are plasma proteins known as significant determinants for the action, distribution and availability of drugs . Same molar concentration of AGP and MBP was applied to a nitrocellulose membrane and incubated with the MBPcl3 and MBPcl9 aptamers. The MBPcl3 clone did not bind to AGP, while MBPcl9 exhibited a weak signal (Fig. IB) . Interestingly, the unselected aptamer pool also showed a strong interaction with dots of MBP suggesting that MBP bound to nucleic acids irrespective of their sequence due to its highly positive net charge at physiological pH; however, it is also possible that the binding activity resides in part within the annealing region of the reverse primer corresponding to the aptamer. On the other hand, the same test on an ELISA plate format exhibits a weak binding of the unselected library. Sequence analysis of both aptamer clones revealed a highly conserved nucleotide sequence between the randomized region and the annealing region of the reverse primer of the aptamers.

In order to verify whether or not the binding activity of MBPcl3 is sequence-specific, a scrambled version of MBPcl3 was performed and its binding activity was assessed (Fig. 3) . Indeed, the resulting scrambled clone MBPcl3 exhibited decreased binding activity.

Biotinylated aptamers were used in the Dot Blotting and ELISA analysis used in the above assays; therefore, it is important to verigy whether biotin participates in the binding activity of the selected aptamers, thus MBP was placed on nitrocellulose membranes, incubated with biotinylated MBPcl3, biotin or biotinylated MBPcl3 subjected to digestion with DNAse (Fig. 1C) . Clearly, Fig. 1C shows that biotin does not bind to MBP.

Structural Analysis

Structural analysis of MBPcl9 and MBPcl3 was performed with Mfold (12) to predict the most likely single-stranded DNA secondary structures (Fig. 4 A, B y C) . MBPcl9 structure displayed an inverted L-shape (Fig. 4A) with two long stems, each followed by a pair of loops and several terminal unpaired nucleotides. On the other hand, two optimal structures are shown for MBPcl3. One of these structures shows the inverted L-shaped figure, shared with MBPcl9 (Fig. 4B) . The second structure (Fig. 4C) contains a higher number of unpaired nucleotides. On the basis of these results, distinct domains that contain stems and loops were detected, and shorter versions of the MBP-specific aptamers were generated by solid- phase synthesis and then tested for their affinity for MBP (Fig. 5) . Aptamer domain AF comprised stem 5 with loops A and F, domain BC included stem 8 with loops B and C, while domain AE contained stem 7 with loops A and E. All three shorter versions of aptamers MBPcl3 and MBPcl9 were found to lose the MBP binding activity, suggesting that a full length version of MBPcl3 and MBPcl9 is necessary for the activity.

Aptamers Affinity and MBP

Recently, an aptamer named 3064 was raised from a suspension of crude murine myelin and it was claimed that it is specific against MBP isoforms (13) . Therefore, the activity of MBPcl3 aptamer was compared in different environments against the known aptamer 3064 (Figure 6 A) . It should be noted that aptamer 3064 showed a slightly higher activity when a pure protein of MBP was used; however, a larger standard deviation for this aptamer was observed in all trials. Furthermore, when the MBP protein was mixed with a complex mixture of proteins, 3064 aptamer performance was poor (Figure 6B) . Different amounts of MBP were fixed to Microlon ELISA plates that had a hydrophobic surface. After washing, HeLa cell lysate was used as a blocking reagent followed by a blocking solution of bovine serum albumin. Thus, the plate wells with less amount of MBP let more surface area for fixing HeLa cell lysates and bovine serum albumin protein. In contrast to MBPcl3, the aptamer 3064 exhibited a binding pattern not related to the concentration of MBP, suggesting increased non-specific binding activity (Figure 6B) .

MBPcl3 binding activity was also compared with a commercial anti-MBP polyclonal antibody. For this purpose, equal molar concentrations of MBPcl3 and anti-MBP antibody were incubated with con 0.5]ig of MBP that was previously fixed to a Microlon ELISA plate (Figure 7) . Interestingly, it was found that MBPcl3 binds to MBP with a nearly 5-fold higher activity than the antibody. Further, MBPcl3 was also compared with anti-MBP antibody in a complex mixture of proteins (Figure 7B) . The assay was performed as described for the aptamer 3064. Briefly, l]ig or 0.5 ]ig of MBP was fixed on a Microlon ELISA microplate, and was then incubated with Hela cell lysates for blocking the wells. After several washings, the same wells were also blocked with bovine serum albumin. 0.007 moles of MBPcl3 or anti-MBP were used for detection. Figure 7B shows that MBPcl3 allowed for the resolution of MBP, while it was not so with anti-MBP.

Multiple sclerosis is a disease where autoimmune antibodies play a key role. MBP recognition by the autoantibodies induce lymphocyte recruitment to MBP sites and could be involved in the degradation of the myelin protein. To test whether MBPcl3 could inhibit the action of autoantibodies, a competition assay (Figure 7C) was performed.

MBPcl3 and the anti-antibody were incubated either at different times or simultaneously in Microlon ELISA microplates with MBP previously fixed. Figure 9 shows that the presence of MBPcl3 blocks binding of the antibody and the effect was stronger when MBPcl3 and anti-MBP were incubated together .

Nucleic acids are highly susceptible to the activity of endo- and exonucleases . Consequently, aptamers that are intended to be used as therapeutic agents must be developed to withstand the enzymatic activity of these nucleases. The nucleotide modifications by phosphorothioates (PS), are well studied; however, the modification of an aptamer could trigger a change in activity so an aptamer MBPcl3 modified with nucleotide PS was tested (Figure 8A) . Figure 8A shows that the modification of MBPcl3 by PS not only retained its activity, but also enhanced it. Furthermore, the PS of MBPcl3 version was also capable of binding to myelin crude extracts (Figure 8B) .

Histochemistry

The ability of MBPC13 aptamer to detect myelin rich areas in serial histological sections of mouse brain was studied by histochemical techniques. Indeed, when such histological sections were incubated with MBPC13 it was observed that the aptamer localizes in brain areas rich in neural fibers (Figure 9B) including the corpus callosum, cerebral peduncle, thalamic radiation, fasciculus retroflexus and premammilary region. These results are testable with the localization of an anti- MBP antibody wherein similar areas of the brain are highlighted. These results strongly suggest that MBPC13 can recognize MBP in the central nervous system.

DISCUSSION

SELEX is a proven methodology to obtain active nucleic acids with the ability to bind specific targets (for reviews, see 14, 15) . Essentially, SELEX consists in repeated binding, selection and amplification tests of aptamers from an initial library until enrichment of specific molecules is attained.

Aptamers are subject to testing for different purposes such as protein purification (16) or for protein- function regulation in an antagonistic or agonistic manner (17-19) . MS is an autoimmune, inflammatory and demyelinating disease that attacks the central nervous system; delaying, stopping or reverse the progression of the disease is yet to be achieved in patients with MS.

The MBP is one of the main components of the myelin sheath (20) and is found throughout the myelin sheath (21) . Previous studies confirm that many MS patients are carriers of MBP autoantibodies and suggest that these antibodies may be responsible for the loss of myelin in the neuronal axons (1, 22-24) . Therefore, having MBP as a target protein could result in an immunoprotective therapy blocking the interaction between the autoantibodies and endogenous MBP protein.

The present invention provides specific aptamers against pure MBP from mice mainly containing 18.5 Kda-isoform in order to test them in a MS animal model. Selected clones MBPcl3 and MBPcl9 showed a shorter randomized region exhibiting 26 nucleotides, thus enabling the binding activity of the MBP onto nitrocellulose membranes (Figure 1A, B and 2A) and in the ELISA plates (Figure 3) . It is noteworthy that it was found that the unselected aptamer library binds to the MBP applied to nitrocellulose membranes (Figure IB) but not in the ELISA plates (Figure 6A) . Indeed, it was demonstrated that MBP binding activity of MBPcl3 is sequence-specific. MBPcl3 with its scrambled nucleotide sequence could not bind the MBP as good as MBPcl3 (Figure 3) . Then, the secondary structure of aptamers MBPcl9 and MBPcl3 was predicted with mFold (12) in order to rationally identify potential active domains for both aptamers. Therefore, shorter versions of aptamers were synthesized; however, none of them was able to match the activity of MBPcl3 of total length (Figure 4C and 5) . MBPcl3 activity was also compared with a recently published aptamer selected against myelin extracts, called 3064 (13) .

In those trials where pure MBP was used, aptamer 3064 demonstrated increased MBP binding activity; however, in all our studies it was not possible to reduce the standard deviation, which was very high. In contrast, when MBPcl3 and 3064 were tested with a complex protein mixture, MBPcl3 performed better. While MBPcl3 binding was related to the amount of MBP in the protein mixture, it was not so with 3064 (Figure 6B) , suggesting that 3064 binds to non-specific molecules .

Since MBPcl3 was obtained to be used as a useful therapeutic molecule for multiple sclerosis, its activity (of MBPcl3) was also compared with a commercial anti-MBP polyclonal antibody. When MBPcl3 and antibody were incubated with pure MBP, MBPcl3 could demonstrate increased MBP binding activity (Figure 7A) . MBPcl3 performance was also superior to the antibody when both were assessed for detecting the MBP in a complex protein mixture (Figure 7B) . Furthermore, with the amount used for both molecules, the anti-MBP antibody could not resolve the presence of MBP in the protein mixture. When MBPcl3 and anti- MBP antibody were subject to competition for MBP, MBPcl3 could displace the binding of the antibody and the effect was greater when both molecules were incubated together (Figure 7C) .

Aptamers that are intended to be used as a therapeutic agent must overcome the activity of endo- and exonucleases circulating in the bloodstream. A common solution to this problem is the use of aptamers with modified nucleotides. However, the modification of an aptamer post-SELEX can alter its activity. MBPcl3 was synthesized with modifications via phosphorothioate (PS) and its activity was measured. In fact, the modifications by PS did not alter MBPcl3 activity but, on the contrary, they enhanced it (Figure 8A) . MBPcl3 and its phosphorothioate analog also attained the binding to myelin crude extracts (Figure 8B) .

Thus, the aptamer MBPcl3 and its phosphorothioate analog happen to be potential agents for diagnostic studies, where there is a need to detect the presence of MBP. Both molecules are also suitable as agents for the treatment of autoimmune diseases where MBP is involved. It is suggested that MBPcl3 can block the binding of autoantibodies to MBP, so that the recruitment of inflammatory cells and their degradation is blocked .

REFERENCES 1. Martin, R. , McFarland, H.F. y McFarlin, D.E. (1992) Immunological Aspects of Demyelinating Diseases. Annu . Rev. Immunol., 10, 153-187.

2. Hafler, D. A. (2004) Multiple Sclerosis, J. Clin. Invest., 113, 788-794.

3. Zamvil, S. S. y Steinman, L. (1990) The T Lymphocyte in Experimental Allergic Encephalomyelitis. Annu. Rev. Immunol., 8, 579-621.

4. Burns, J., Rosenzweig, A., Zweiman, B. y Lisak, R. P. (1983) Isolation of Myelin Basic Protein-reactive T-cell Lines from Normal Human Blood. Cell Immunol., 81, 435-440.

5. Richert, J. R. , McFarlin, D. E., Rose, J. W., McFarland, H. F. y Greenstein, J. I. (1983) Expansion of Antigen-specific T Cells from Cerebrospinal Fluid of Patients with Multiple Sclerosis. J. Neuroimmunol , 5, 317-324.

6. Chou, Y. K., Vainiene, M. , Whitham, R. , Bourdette, D., Chou, C. H., Hashim, G . , Offner, H. y Vandenbark, A. A. (1989) Response of Human T Lymphocyte Lines to Myelin Basic Protein: Association of Dominant Epitopes with HLA Class II Restriction Molecules. J. Neurosci. Res., 23, 207-216.

7. Martin, R., Jaraquemada, D., Flerlage, M. , Richert, J., Whitaker, J., Long, E. 0., McFarlin, D. E. y McFarland, H. F. (1990) Fine Specificity and HLA Restriction of Myelin Basic Protein-specific Cytotoxic T Cell Lines from Multiple Sclerosis Patients and Healthy Individuals. J. Immunol., 145, 540-548.

8. Pette, M. , Fujita, K., Kitze, B., Whitaker, J. N., Albert, E., Kappos, L. y Wekerle, H. (1990) Myelin Basic Protein-specific T Lymphocyte Lines from MS Patients and Healthy Individuals. Neurology, 40, 1770-1776.

9. Ota, K., Matsui, M. , Milford, E. L., Mackin, G. A., Weiner, H. L. y Hafler, D. A. (1990) T-cell Recognition of an Immunodominant Myelin Basic Protein Epitope in Multiple Sclerosis. Nature, 346, 183-187.

10. Olsson, T., Zhi, W. W., Hojeberg, B., Kostulas, V. , Jiang, Y. P., Anderson, G., Ekre, H. P. y Link, H. (1990) Autoreactive T Lymphocytes in Multiple Sclerosis Determined by Antigen-induced Secretion of Interferon-gamma . J. Clin. Invest., 86, 981-985. 11. Tuerk, C. y Gold, L. (1990) Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science (New York, N. Y., 249, 505-510) .

12. Zuker, M. (2003) Mfold Web Server for Nucleic Acid Folding and Hybridization Prediction. Nucleic Acids Research, 31, 3406-3415.

13. Nastasij evic, B., Wright, B. R. , Smestad, J., Warrington, A. E., Rodriguez, M. y Maher, L. J., 3ra edicion (2012) Remyelination Induced by a DNA Aptamer in a Mouse Model of Multiple Sclerosis [ Remielinacion inducida por un aptamero de ADN en un modelo murino de EM] . PloS ONE, 7, e395955.

14. Keefe, A. D., Pai, S. y Ellington, A. (2010) Aptamers as Therapeutics [Aptameros como terapeuticos ] . Nature Reviews, 9, 537-550.

15. Nimjee, S. M. Rusconi, C. P. y Sullenger, B. A., (2005) Aptamers: An Emerging Class of Therapeutics. Annual Review of Medicine, 56, 555-583.

16. Romig, T. S., Bell, C. y Drolet, D. W. (1999) Aptamer Affinity Chromatography: Combinatorial Chemistry Applied to Protein Purification. Journal of Chromatography, 731, 275-284.

17. Jellinek, D., Green, L. S., Bell, C. y Janjic, N. (1994) Inhibition of Receptor Binding by High-affinity RNA Ligands to Vascular Endothelial Growth Factor. Biochemistry, 33, 10450- 10456.

18. Adachi, H., Ishiguro, A., Hamada, M. , Sakota, E., Asai, K. y Nakamura, Y. (2011) Antagonistic RNA Aptamer Specific to a Heterodimeric Form of Human Interleukin-17A/F. Biochimie, 93, 1081-1088.

19. Pestourie, C, Tavitian, B. y Duconge, F. (2005) Aptamers Against Extracellular Targets for In Vivo Applications, Biochimie, 87, 921-930.

20. Deber, C. M. y Reynolds, S. J. (1991) Central Nervous System Myelin: Structure, Function, and Pathology. Clin. Biochem. , 24, 113-134.

21. Brunner, C, Lassmann, H., Waehneldt, T. V. Matthieu, J. M. y Linington, C. (1989) Differential Ultrastructural Localization of Myelin Basic Protein, Myelin/Oligodendroglial Glycoprotein, and 2', 3' -cyclic Nucleotide 3' -phosphodiesterase in the CNS of Adult Rats. J. Neurochem. , 52, 296-304. 22. Allegretta, M., Nicklas, J. A., Sriram, S. y Albertini, R. J. (1990) T Cells Responsive to Myelin Basic Protein in Patients with Multiple Sclerosis. Science, 247, 718-721.

23. Uccelli, A., Giunti, D., Salvetti, M., Ristori, G . , Fenoglio, D., Abbruzzese y Mandardi, G. (1998) A restricted T Cell Response to Myelin Basic Protein (MBP) Is Stable in Multiple Sclerosis (MS) Patients. Clin. Exp. Immunol., Ill, 186-192.

24. Bielekova, B., Sung, M. H., Kadom, N., Simon, R., McFarland, H. y Martin, R. (2004) Expansion and Functional Relevance of High-avidity Myelin-specific CD4+ T Cells in Multiple Sclerosis. J. Immunol., 172, 3893-3904.

Claims

1. An aptamer, characterized by the fact that it specifically recognizes the Myelin Basic Protein (MBP) and displays a length of less than 100 nucleotides.

2. The aptamer according to claim 1, characterized by the fact that it comprises on its 5' end the sequence SEQ ID N°l or the variant thereof in RNA form.

3. The aptamer according to claim 1, characterized by the fact that it comprises on its 3' end the sequence SEQ ID N° 2 or the variant thereof in RNA form.

4. The aptamer according to claim 1, characterized by the fact that it comprises the sequence SEQ ID N° 1 on its 5' end and the sequence SEQ ID N° 2 on its 3' end or variants thereof in RNA form.

5. The aptamer according to claim 1, characterized by the fact that it comprises a length of more than 60 nucleotides and less than 93 nucleotides.

6. The aptamer according to claim 5, characterized by the fact that it comprises a length of more than 60 nucleotides and less than 70 nucleotides.

7. The aptamer according to claim 4, characterized by the fact that it comprises the sequences selected from the group consisting of SEQ ID N° 3, SEQ ID N° 4, SEQ ID N° 5, SEQ ID N° 6, SEQ ID N° 7, SEQ ID N° 8, SEQ ID N° 9, SEQ ID N° 10, SEQ ID N° 11, SEQ ID N° 12, SEQ ID N° 13, SEQ ID N° 14, SEQ ID N° 15, SEQ ID N° 16 and SEQ ID N° 17.

8. The aptamer according to claim 7, characterized by the fact that it is selected from the group consisting of SEQ ID N° 3 and SEQ ID N° 4.

9. The aptamer according to claim 7, characterized by the fact that it is SEQ ID N° 3.

10. The aptamer according to claim 7, characterized by the fact that it is SEQ ID N° 4.

11. The aptamer according to any one of claims 1 to 10, characterized by the fact that said aptamer comprises at least one modified nucleotide.

12. The aptamer according to claim 11, characterized by the fact that the modified nucleotide is selected from the group consisting of phosphorothioate, Locked Nucleic Acids (LNA), Morpholino phosphorodiamidate, N3'- P5 ' phosphoramidate, 2'-C-allyl uridine, 2'-fluoro nucleotides and 2' -amino nucleotides.

13. The aptamer according to claim 12, characterized by the fact that the modified nucleotide is phosphorothioate .

14. Pharmaceutical composition, characterized by the fact that it comprises at least an aptamer or variants thereof according to any one of claims 1 to 13, and excipients .

15. Use of the aptamer or variants thereof for manufacturing a medicament for the treatment of a MBP- related disease or condition.

16. Use of the aptamer or variants thereof for the diagnosis of a MBP-related disease or condition.

17. The use according to claims 15 or 16, wherein the MBP-related disease or condition is a demyelinating or autoimmune disease.

18. The use according to claim 17, wherein the MBP- related disease or condition is a demyelinating autoimmune disease.

19. The use according to claim 18, wherein the demyelinating autoimmune disease is Multiple Sclerosis (MS) .