WO2016005985A2

WO2016005985A2 - Method for reprogramming cells

Info

Publication number: WO2016005985A2
Application number: PCT/IL2015/050715
Authority: WO
Inventors: Yossi BUGANIM
Original assignee: Yissum Research Development Company Of The Hebrew University Of Jerusalem Ltd.
Priority date: 2014-07-09
Filing date: 2015-07-09
Publication date: 2016-01-14
Also published as: WO2016005985A3

Abstract

A method of generating an induced trophoblast stem cell (iTSC) from a cell is provided. Accordingly there is provided a method comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of an iTSC from the cell, thereby generating the iTSC from the cell, with the proviso that the method does not consist of expressing within the cell Eomes, Cdx2, Elf5, cMyc and Klf4. Also provided are nucleic acid constructs, isolated cells and iTSCs.

Description

METHOD FOR REPROGRAMMING CELLS

RELATED APPLICATION/S

This application claims the benefit of priority under 35 USC § 119(e) of U.S. Provisional Patent Application No. 62/022,296 filed July 9, 2014, the contents of which are incorporated herein by reference in their entirety.

FIELD AND BACKGROUND OF THE INVENTION

The present invention, in some embodiments thereof, relates to a method for reprogramming cells and, more particularly, but not exclusively, to a method for reprogramming cells to induced trophoblast stem cells (iTSC).

Regenerative medicine is a new and expanding discipline that aims at replacing lost or damaged cells, tissues or organs in the human body through cellular transplantation. Embryonic stem cells (ESCs) are pluripotent cells that are capable of long-term growth, self-renewal, and can give rise to every cell, tissue and organ in the fetus's body. Thus, ESCs hold great promise for cell therapy as a source of diverse differentiated cell types. Few major bottlenecks to realizing such potential are the risk of teratoma formation, allogenic immune rejection of ESC-derived cells by recipients and ethical issues. The discovery of induced pluripotent stem cells (iPSC) and the direct conversion approach opened an attractive avenue that resolves these problems.

Key master regulators are prevailing transcription factors that determine cell identity. Each cell type expresses a specific combination of key master regulators that together modulate the gene expression program of the cell. Alongside the master regulators, there are thousands of transcription factors, co-factors and chromatin modifiers which expression in the cell is crucial to maintain a stable cell state. The transcriptome of each cell type is tightly controlled by these factors to allow the cell to execute its function properly. The first report that demonstrated how powerful key master regulators are in modulating cell identity was in the 1980s, when Davis et al. showed that ectopic expression of MyoD in fibroblasts can convert them into myocyte- like cells(l). Almost twenty years later, Xie et al. demonstrated that forced expression of C/ΕΒΡα/β can convert differentiated B cells into macrophage-like cells(2). These two studies demonstrate how fragile and delicate the balance between cell identity and cell plasticity is, and suggest that, when overexpressed, key master regulators can alter cell fate.

In 2006, two Japanese scientists, Takahashi and Yamanaka, changed the way we used to think about cell plasticity when they showed that introduction of four transcription factors, Oct4, Sox2, Klf4 and Myc (OSKM), can reprogram fibroblasts into functional embryonic stem cell-like cells [also termed induced pluripotent stem cells (iPSCs)](3). Resetting the epigenome of a somatic cell to a pluripotent state has already been achieved by somatic cell nuclear transfer (SCNT), but this was ensued by approximately 8000 genes that are expressed within the oocyte(4). The notion that as little as four factors are sufficient to reset the epigenome of a cell, opened a new avenue where scientists have attempted to convert different adult cells into other somatic cell types from ontogenetically different lineages, by avoiding the pluripotent state, using a specific subset of key master regulators. Several subsets of cell types such as hematopoietic cells, different neuronal cells, cardiomyocytes, hepatocytes, embryonic Sertoli cells, endothelial cells and RPE were converted from different somatic cells by employing the direct conversion approach (see e.g. 5-8).

The direct conversion approach and the generation of iPSCs provide an invaluable resource of cells for disease modeling, drug screening, and patient- specific cell-based therapy. However, in contrast to embryonic stem cells (ESCs), the quality of iPSCs varies widely between different colonies, and a large proportion of these colonies is of low developmental potential, as measured by their poor capability to contribute to chimeras and to generate a healthy "all-iPSC" mouse using tetraploid complementation assay(e.g. 9 and 10). In addition, iPSCs are more prone to malignant transformation.

Since the discovery of iPSCs, there has been a remarkable progress in characterizing the resulting iPSCs. A significant effort has been made to improve reprogramming efficiency, and to examine the transcriptome, proteome, epigenome, and the pluripotency potential of iPSCs. These studies revealed a large number of genetic and epigenetic aberrations throughout the genome of iPSCs that are distinct from those found in ESCs (see e.g. 11 and 12). Despite those efforts, there is no clear understanding of how the mechanisms to create iPSCs influence the quality of iPSCs. This problem is even more profound in the direct conversion approach, as in contrast to iPSCs the converted cells do not reach a stable and complete reprogramming state. In contrast to iPSCs that can grow independently of exogenous factors and are almost indistinguishable in their epigenetic and gene expression profile from their ESC counterparts, in the vast majority of cases of direct conversion models, cells express only a fraction of the relevant markers and are dependent either fully or partially on their exogenous factors. This observation raised the possibility that nuclear reprogramming can be achieved only in stem cell populations. However, an incomplete reprogramming process was noted in the conversion of fibroblasts into neuronal stem cell-like cells(13) and into hepatic stem cell-like cells(14) as well. Similarly to the other somatic cell conversion models, these stem cell-like cells, although expressing a large set of markers and partially functioning in their native environment, are still dissimilar in many examined aspects to their in vivo counterparts. This suggests that the prevailing current reprogramming method affects the quality of the resulting converted cells and raises the question of whether stable conversion and a high degree of nuclear reprogramming state can be achieved only in pluripotent cells.

In conclusion, the data so far indicate that incomplete/aberrant reprogramming process is a frequent event in the generation of iPSCs and more so in directly converted cells. Since incomplete/aberrant conversion process could alter the function of the cells and in severe cases could even lead to a malignant transformation, improving the quality of the converted cells is an indispensable prerequisite before applying these cells in the clinic.

To improve the quality of the converted cells, efforts should be focused on uncovering the molecular elements that characterize successful reprogramming. One of the major obstacles in deciphering these elements is the heterogeneity of the transduced cell population and the small fraction of cells that eventually are converted. The majority of studies in the field are based on cell-population analyses, which presumably do not represent the small fraction of cells that undergo conversion.

In mammals, specialized cell types of the placenta mediate the physiological exchange between the fetus and mother during pregnancy. The precursors of these differentiated cells are trophoblast stem cells (TSCs). In the pre-implantation embryo, trophoblast cells are the first differentiated cells that can be distinguished from the pluripotent inner cell mass, and form the outermost layer of the blastocyst (18). In the mouse, TSCs can be isolated and cultured from outgrowths of either the blastocyst polar trophectoderm (TE) or extraembryonic ectoderm (ExE), which originates from the polar TE after implantation [e.g. Latos and Hemberger, (2014) Placenta. 35 Suppl: S81-5]. In humans embryos, TSC were identified in the blastocyst stage, however, to date, all attempts to isolate and culture human TSCs in their undifferentiated state were unsuccessful (18). The trophoblast cell lineage is the source for the most essential cell types of the main structural and functional components of the placenta. Therefore, TSCs have tremendous biomedical relevance, as one third of all human pregnancies are affected by placental-related disorders (20).

Generation of induced TSC-like cells (iTSCs) from embryonic stem cells (ESCs) and somatic cells e.g. fibroblast has been described before (Cambuli et al., 2014; Kuckenberg et al., 2010; Lu et al., 2008; Ng et al., 2008; Nishioka et al., 2009; Niwa et al., 2000; Niwa et al., 2005; Ralston et al., 2010; and 15-17); however, in all models lineage conversion remained incomplete and failed to confer a stable true TSC phenotype.

Additional background art includes:

US Patent No. US 7642091;

US Patent No: US 6630349;

US Application Publication No: US 20050191742;

International Application Publication No: WO 2006052646; and

Canadian Patent Application Publication No: CA 2588088.

SUMMARY OF THE INVENTION

According to an aspect of some embodiments of the present invention there is provided a method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of an iTSC from the cell, thereby generating the iTSC from the cell, with the proviso that the method does not consist of expressing within the cell Eomes, Cdx2, Elf5, cMyc and Klf4.

According to an aspect of some embodiments of the present invention there is provided a method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising expressing within the cell exogenous Gata3, Eomes and Tfap2c transcription factors, under conditions which allow generation of an iTSC from the cell, thereby generating the iTSC from the cell.

According to some embodiments of the invention, the expressing comprises transiently expressing.

According to some embodiments of the invention, the method comprising expressing within the cell an exogenous c-Myc transcription factor.

According to some embodiments of the invention, the method comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.

According to some embodiments of the invention, the conditions are such that expressing is for at least 10 days following introducing the exogenous transcription factor into the cell.

According to some embodiments of the invention, the conditions are such that expressing is for no more than 30 days following introducing the exogenous transcription factor into the cell.

According to some embodiments of the invention, the iTSC does not comprise the exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.

According to some embodiments of the invention, the conditions comprise a culture medium comprising FGF4 and heparin.

According to some embodiments of the invention, the expressing comprises introducing into the cell a polynucleotide encoding the transcription factor.

According to some embodiments of the invention, the polynucleotide is a DNA.

According to some embodiments of the invention, the polynucleotide is a RNA.

According to some embodiments of the invention, the method comprising isolating the iTSC.

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding at least two transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.

According to some embodiments of the invention, the at least one polynucleotide comprises a nucleic acid sequence encoding c-Myc transcription factor. According to some embodiments of the invention, the at least one polynucleotide comprises a nucleic acid sequence encoding at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.

According to an aspect of some embodiments of the present invention there is provided an isolated cell expressing at least two exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c.

According to an aspect of some embodiments of the present invention there is provided an isolated cell expressing exogenous Gata3, Eomes and Tfap2c transcription factors.

According to some embodiments of the invention, the isolated cell further expressing an exogenous Myc transcription factor.

According to some embodiments of the invention, the isolated cell further expressing at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5.

According to some embodiments of the invention, the cell is de-differentiated.

According to some embodiments of the invention, the cell comprises a DNA molecule encoding the at least one transcription factor.

According to some embodiments of the invention, the cell comprises a RNA molecule encoding the at least one transcription factor.

According to some embodiments of the invention, the cell comprises a protein molecule of the at least one transcription factor.

According to some embodiments of the invention, the expressing is not in the natural location and/or expression level of the native gene of the transcription factor.

According to some embodiments of the invention, the at least one exogenous transcription factor comprises at least two exogenous transcription factors.

According to some embodiments of the invention, the at least one exogenous transcription factor comprises Gata3, Eomes and Tfap2c.

According to some embodiments of the invention, the cell is a human cell.

According to some embodiments of the invention, the cell is a somatic cell.

According to some embodiments of the invention, the somatic cell is a fibroblast. According to an aspect of some embodiments of the present invention there is provided an isolated induced trophoblast stem cell (iTSC) obtainable according to the method.

According to an aspect of some embodiments of the present invention there is provided an isolated induced trophoblast stem cell (iTSC) maintaining differentiation level of a trophoblast stem cell for at least 20 passages in culture.

According to some embodiments of the invention, the iTSC maintaining the differentiation level in an absence of exogenous Gata3, Eomes and Tfap2c transcription factors as determined by a PCR assay.

According to some embodiments of the invention, the iTSC comprises an ectopic DNA of a transcription factor integrated in the genome.

According to some embodiments of the invention, the iTSC is characterized by at least one of:

(i) TSC morphology;

(ii) TSC markers, as determined by an immunocytochemistry and/or PCR assay;

(iii) absence of fibroblast specific markers, as determined by an immunocytochemistry and/or PCR assay;

(iv) a transcriptome similar to a blastocyst-derived TSC, as determined by a RNA sequencing assay;

(v) genomic stability similar to a blastocyst-derived TSC, as determined by a whole genome sequencing;

(vi) a methylation pattern similar to a blastocyst-derived TSC, as determined by a bisulfate assay;

(vii) similar H2A.X deposition to a blastocyst-derived TSC, as determined by a chromatin immunoprecipitation (ChIP) assay;

(viii) in-vitro differentiation following culture in a medium without Fgf4 and heparin, as determined by morphology, flow cytometry and/or PCR assay;

(ix) in-vitro and/or in-vivo differentiation into derivatives of the trophectoderm lineage, as determined by morphology, immunocytochemistry, immunocytochemistry, flow cytometry and/or PCR assay;

(x) in-vivo formation of a trophoblastic hemorrhagic lesion, as determined by histological evaluation;

(xi) localization to the extraembryonic region of the blastocyst as determined by immunohistochemistry;

(xii) localization to the placenta of the developing embryo as determined by immunohistochemistry; and

(xiii) no change in differentiation level for at least 20 passages in culture as determined by at least of the assay in (i) - (xii).

According to some embodiments of the invention, the methylation pattern comprises hypomethylation of the Elf 5 promoter, hypomethylation of the Handl promoter and/or hypermethylation of the Nanog promoter as compared to a somatic cell and/or an ESC cell.

According to some embodiments of the invention there is provided a cell culture comprising the isolated iTSC and a culture medium.

According to some embodiments of the invention there is provided a cell culture comprising the isolated cell and a culture medium.

According to some embodiments of the invention, the culture medium comprises FGF4 and heparin.

According to some embodiments of the invention, the iTSC being a cell line. According to some embodiments of the invention there is provided a cell line of the cell.

According to some embodiments of the invention there is provided a pharmaceutical composition comprising the iTSC and a pharmaceutically acceptable carrier or diluent.

According to some embodiments of the invention there is provided an isolated placenta or a blastocyst comprising the iTSC or the construct.

According to some embodiments of the invention there is provided a method of augmenting a placenta or a blastocyts comprising introducing into a placenta or a developing embryo the iTSC or the construct. According to some embodiments of the invention there is provided a method of treating and/or preventing a disorder associated with development and/or activity of trophoblasts in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the iTSC, the pharmaceutical composition, or the construct, thereby treating and/or preventing the disorder associated with development and/or activity of trophoblasts in the subject.

According to some embodiments of the invention, the disease is selected from the group consisting of recurrent miscarriage, Preeclampsia, Fetal Growth Restriction (FGR), hydatiform mole and choriocarcinoma.

According to some embodiments of the invention there is provided a method of identifying an agent capable of modulating trophoblast development and/or activity, the method comprising:

(i) contacting the isolated iTSC or the isolated placenta with a candidate agent; and

(ii) comparing development and/or activity of the isolated iTSC or the isolated placenta following the contacting with the agent to development and/or activity of the isolated iTSC or the isolated placenta without the agent,

wherein an effect of the agent on the development and/or activity of the isolated iTSC or the isolated placenta above a predetermined level relative to the development and/or activity of the isolated iTSC or the isolated placenta without the agent is indicative that the drug modulates trophoblast development and/or activity.

According to some embodiments of the invention there is provided a method of obtaining a compound produced by a trophoblast, the method comprising culturing the isolated iTSC or the cell culture and isolating from the culture medium a compound secreted by the cells, thereby obtaining the compound produced by the trophoblast.

According to some embodiments of the invention, the compound is a growth factor or a hormone.

According to an aspect of some embodiments of the present invention there is provided a method of discovering a gene which can generate an induced trophoblast stem cell (iTSC), the method comprising:

(a) introducing a candidate gene into a cell; and (b) selecting a cell that exhibits TSC morphology and/or TSC marker as determined by an immunocytochemistry and/or PCR assay and acquires a stable state in the absence of expression of the gene.

According to an aspect of some embodiments of the present invention there is provided a nucleic acid construct or system comprising at least one polynucleotide comprising:

(i) a nucleic acid sequence encoding a first reporter polypeptide and a regulatory element for directing expression of the first reporter polypeptide, the regulatory element being under the control of a first early predictive marker of an induced trophoblast stem cell (iTSC) and/or induced pluripotent stem cells (iPSC);

(ii) nucleic acid sequence encoding a second reporter polypeptide and a regulatory element for directing expression of the second reporter polypeptide, the regulatory element being under the control of a second early predictive marker of an iTSC and/or iPSC;

(iii) a nucleic acid sequence encoding a third reporter polypeptide and a regulatory element for directing expression of the third reporter polypeptide, the regulatory element being under the control of a late predictive marker of an iTSC or iPSC,

wherein the first reporter polypeptide, the second reporter polypeptide and the third reporter polypeptide are distinguishable.

According to some embodiments of the invention, the iTSC late predictive marker is Elf 5.

According to some embodiments of the invention, the iPSC late predictive marker is Nanog.

According to some embodiments of the invention, the early predictive markers are Utf 1 and Esrrb.

According to some embodiments of the invention, there is provided an isolated cell comprising the construct.

According to some embodiments of the invention, there is provided a transgenic animal comprising the cell.

According to some embodiments of the invention, there is provided a method of identifying a reprogrammable iTSC or iPSC, the method comprising: (i) obtaining the cell or a cell isolated from the transgenic animal; and

(ii) identifying the reprogrammable iTSC or iPSC based on the pattern of expression of the reporter polypeptides.

Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.

BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.

In the drawings:

FIG. 1 is a schematic representation of the strategy to reprogram fibroblasts to induced trophoblast stem cell-like (iTSCs) cells.

FIGs. 2A-B show that iTSC colonies express TSC markers. Figure 2A presents bright field images and immuno staining against Esrrb, Utfl, Elf5 and Cdx2 in stable iTSC colonies generated by 12 transcription factors (12F). Scale bar indicates 100 μΜ. Figure IB is a graph showing mRNA levels of the indicated TSC gene markers normalized to the Gapdh housekeeping gene in MEFs and five iTSC colonies as determined by qRT-PCR.

FIG. 3 is a representative bright field image of a multinucleate giant cell derived from iTSC colonies generated by 12 transcription factors (12F) following Fgf4 and heparin withdrawal.

FIG. 4 shows graphs of the viral integration of each of the 12 factors into the genome of five isolated iTSC colonies (12F-iTSC), as determined by qRT-PCR. FIG. 5 shows bright field images showing blastocyst-derived TSC colonies (TSC^blast#1) and stable iTSC colonies generated by 3 factors (Gata3, Eomes and Tfap2c, 3F-iTSC) and 4 factors (Gata3, Eomes, Tfap2c and Myc, 4F-iTSC), all from mice with mixed C57BL/6 x 129 background. Upper panel shows colonies that grew under standard TSC culture condition (70 % MEF conditioned medium (MEF-CM), 30 % TSC medium +FGF4 and Heparin). Lower panel shows colonies that grew under defined culture condition (TX medium + FGF4, Heparin and Tgfpi on matrigel).

FIG. 6 shows bright field images showing cells in 4 factors reprogramming (Gata3, Eomes, Tfap2c and Myc, GETM) at the indicated time points. Dashed circles indicate colonies in formation, before and after isolation.

FIG. 7 is a graph summarizing the number of Sox-GFP colonies generated by reprogramming of Sox2-GFP Mouse embryonic fibroblasts (MEFs) or tail tip fibroblasts (TTFs) by 3 factors (GET) or 4 factors (GETM). The graph represents the results of 30X10⁵ seeded cells within a 10 cm plate.

FIG. 8 is a graph demonstrating the proliferation curve of MEFs infected with GET or GETM during 14 days of reprogramming as indicated by cell number.

FIG. 9 shows graphs of the viral integrations of Gata3, Eomes, Tfap2c and Myc in the genomes of the indicated colonies, as determined by qRT-PCR.

FIG. 10 shows graphs of the endogenous and exogenous mRNA levels of Gata3, Eomes, Tfap2c and Myc normalized to the Gapdh housekeeping control gene in MEFs, one blastocyst-derived clone, two 3F and two 4F representative iTSC clones, as evaluated by qRT-PCR. UTR- untranslated region, CDS- coding sequence.

FIG. 11 shows flow cytometry histograms demonstrating Sox2 expression in a Sox2-GFP iTSC clone, 4F-iTSC^{Sox2 GFP}#l, that grew under standard TSC culture conditions (TSC medium- 70 % MEF-CM and 30 % TSC medium on feeder) and under defined culture conditions (TX medium).

FIG. 12 shows bright field images of a stable iTSC colony generated by 3 factors from MEFs isolated from C57BL/6 mice.

FIG. 13 shows bright field and GFP channel images of a stable iTSC colony expressing endogenous Sox2, generated by 4 factors from tail tip fibroblasts (TTFs) isolated from Sox2-GFP mice. FIG. 14 shows bright field and GFP channel images of a stable iTSC colony generated by 4 factors from MEFS isolated from Sox2-GFP mice and Oct4-GFP mice, demonstrating that the cells express endogenous Sox2 and not Oct4.

FIG. 15 shows graphs of mRNA levels of the indicated genes normalized to the Gapdh housekeeping control gene in MEFs, ESCs, blastocyst-derived TSC and 3 and 4 factors representative iTSC colonies, as determined by qRT-PCR.

FIGs. 16A-C demonstrate that reprogramming to TSC begins with the initiation of a mesenchymal-to-epithelial transition (MET). Figures 16A and 16B are representative bright field images showing the formation of epithelial foci within the indicated days of iTSC reprogramming with 4 factors (GETM, Figure 16A) or 3 factors (GET, Figure 16B). Figure 16C is a schematic representation of the MET process and key factors that block it.

FIG. 17 shows graphs of mRNA levels of the indicated MET blocking genes normalized to the Gapdh housekeeping control gene in MEFs, ESCs, blastocyst-derived TSCs and MEFs reprogrammed with 4 factors following incubation with dox for the indicated amount of days, as determined by qRT-PCR.

FIG. 18A-B show graphs of mRNA levels of the indicated epithelial and mesenchymal markers genes normalized to the Gapdh housekeeping control gene in MEFs, ESCs, blastocyts-derived TSCs and MEFs reprogrammed with 4 factors (Figure 18 A) or 3 factors (Figure 18B) following incubation with dox for the indicated amount of days, as determined by qRT-PCR.

FIG. 19 shows representative immuno staining images depicting the protein levels of the epithelial markers, Krtl8 and Cdhl, and the mesenchymal marker, Acta2, in MEFs, MEFs expressing the 4 factors for 12 days (GETM 12 days on dox), blastocyst-derived TSCs (TSC^blast#l) and the 4F-iTSC#l clone.

FIGs. 20A-D demonstrate unbiased comparative transcriptome analysis clusters iTSCs with blastocyst-derived TSCs and far from ESCs and MEFs. Figure 20A shows hierarchical clustering of global gene expression profiles for two RNA-seq technical replicates for the indicated iTSC, blastocyst-derived TSC, ESC and MEF lines. Replicate pairs were assigned a shared numerical value. Figure 20B shows principle component analysis for the genes from Figure 20A. PCI = 27 % and PC2 = 19 %. Each of the iTSC, blastocyst-derived TSC, ESC and MEF lines is marked by a specific color. The group names correspond to the names in Figure 20A. Figure 20C are scatter plots for the indicated comparisons. The blue line shows the linear representation of the data, the black line shows the y = x line and the red dots show the position of the indicated genes. Figure 20D shows heatmap of the indicated samples using the 10,000 most highly expressed genes over all samples. The heatmap was generated using the Bioconductor R package DESeq (Andres and Huber, 2010).

FIGs. 21A-C demonstrate that iTSCs exhibit genomic stability compared to blastocyst-derived TSCs. Figure 21A is a graph showing frequency of chromosomal aberrations in single ESCs, MEFs, blastocyst-derived TSCs and the indicated iTSCs clones using a single cell sequencing. Anova statistical test was used for analysis of variance. Figure 21B is a graph showing the average number of sister chromatid exchanges (SCEs) occurring at the single cell level in the indicated lines using the Strand-seq technique. Error bars present mean + SD of the indicated number of cells (n) examined. Figure 21C is a representative Strand-seq library from 4F-iTSC#5 clone. Sister chromatid exchanges are indicated by black arrows.

FIG. 22 presents promoter methylation screen of Elf5, Nanog and Handl demonstrating Elf5 and Handl hypomethylation and Nanog hypermethylation in iTSCs and blastocyst-derived TSCs. The Figure shows bisulfite analysis of promoter region of Elf5 (-652 to -263) (upper panel), the promoter region of Nanog (-399 to +49) (middle panel) and the promoter region of Handl (-110 to +40) (lower panel) in blastocyst- derived TSCs, iTSCs, ESCs and MEFs. Each circle represents one CG sequence in the depicted locus and each row represents one PCR product that was cloned into TA cloning vector and sequenced. Open circles present non-methylated promoter and the filled circles present methylated promoter.

FIG. 23 is a graph summarizing the mRNA levels of the indicated gatekeeper genes in the indicated groups as measured by RN A- sequencing analysis.

FIGs. 24A-B present deposition patterns in iTSC clones and demonstrate their resemblance to blastocyst-derived TSC clones. Figure 24A is a bar chart summarizing the number of differential H2A.X deposition domains (compared to TSC^blast#l control line) in the indicated iTSC and TSC lines, MEFs and ESCs (p-value < l.OE-100, chi- square test). Figure 24B shows comparative H2A.X depositions in the indicated iTSC clones, blastocyst-derived TSCs, ESCs and MEFs at the depicted chromosomes (Chr: 15, 1, 4 and 8). Y axis represents the relative H2A.X deposition level (RSEG enrichment score, compared to TSC control line. Positive value present regions enriched for H2A.X deposition over control; and negative values present regions devoid of H2A.X deposition over control.

FIGs. 25A-C demonstrate that iTSCs are multipotent and can differentiate invito) into various trophoblast lineages. Figure 25 A shows representative bright field images of iTSCs (4F-iTSC#5) grown in differentiation media for the indicated time points. Figure 25B shows flow cytometry histograms of iTSCs (4F-iTSC#5) grown in differentiation media for the indicated time points following propidium iodide (PI) staining. Markers indicate the staining intensities, representative of DNA copy number. The percentage of cells from each sample in every phase is indicated on the histogram. Figure 25C shows graphs of mRNA levels of the indicated trophoblast lineage and TSC markers normalized to Gapdh housekeeping control genes in 3F and 4F iTSC grown in differentiation media for the indicated time points, as determined by qRT-PCR.

FIGs. 26A-B demonstrate that iTSCs are functional and able to generate hemorrhagic lesions in-vivo. Figure 26 A is a picture showing hemorrhagic lesion 7 days following subcutaneous injection of iTSCs into nude mice. Figure 26B shows representative hematoxylin and eosin (H&E) staining of paraffin sections of hemorrhagic lesions obtained from nude mice 7 days following subcutaneous injection of iTSCs. The left image is a low power image; the right image is a higher power image showing necrotic tissue with blood and scattered giant cells (marked with an arrow).

FIG. 27 demonstrates that iTSCs can integrate into the trophectoderm of blastocysts following injection into 8-cell stage embryo. The left panel shows bright field and red channel images of a stable iTSC colony with constitutive tdTomato expression generated by 3 factors (3_F._iTSc^B6/R26-^tdTomato#4). The right image shows localization of the injected iTSCs into the extraembryonic layer.

FIG. 28 shows bright field and green chancel images of stable iTSC clones, 3F- iTSC^H2b~GFP#l, 4F-iTSC^H2b~GFP#l and 4F-iTSC^H2b~GFP#5, with constitutive nuclear GFP expression (H2b-GFP).

FIGs. 29A-B demonstrate that iTSCs and blastocyst-derived TSCs localize to the extraembryonic region of blastocyts. 4F-iTSC^{H2b GFP}#l (Figure 29A) and blastocyst-derived TSC clone, _TSc^{blast H2b GFP}#l (Figure 29B), were injected into 8-cell stage embryos and analyzed at the hatched blastocyst stage using confocal fluorescent microscopy. To detect trophectoderm cells, the blastocysts were stained for Cdx2 (red staining). To detect cells from the inner cell mass, the blastocysts were stained for Nanog (white). Co-localization of H2b-GFP nuclei and Cdx2 nuclei (yellow staining) is marked by white arrows. H2b-GFP-positive nuclei that are Cdx2-negative are marked by pink arrows.

Figures 30A-C show the contribution of H2b-GFP iTSCs, 3F-iTSC^{H2b GFP}#l (Figure 30A) and 4F-iTSC^{H2b GFP}#4 (Figure 30B), to the developing 13.5 dpc placenta. A clear H2b-GFP signal was detected in several patches within the placenta (white squares) and was completely absent in the embryo. A magnification of one region is illustrated by dashed lines. In Figure 30A placentas were imaged using the green and red channels to detect autofluorescence. White oval shows autofluorescence structure. Figure 23C is an immuno staining photomicrograph of GFP in placental tissue isolated from El 3.5 fetus following blastocyst injection of 4F-iTSC^{H2b GFP}#5 cells showing a clear nuclear GFP staining.

FIG. 31 is an immuno staining photomicrograph of GFP (green) and Tfap2c (red staining) in placental tissue isolated from E13.5 fetus following blastocyst injection of 3F-iTSC^{H2b GFP}#l cells demonstrating double positive cells (yellow staining, marked by white arrows).

FIG. 32 is a graph showing mRNA levels of the indicated ESC and TSC genes normalized to the Gapdh housekeeping control gene in MEFs, iTSC clones, blastocytes- derived TSCs and ESCs.

FIG. 33 shows bright field images, green channel images and flow cytometry analysis of iPSCs generated by OSKM expression in MEFs isolated from Nanog-GFP (left panel) or Oct4-GFP (right panel) mice grown in ESC or in TSC medium.

FIG. 34 shows flow cytometry histograms of GFP positive cells during reprogramming of MEFs isolated from Nanog-GFP or Oct4-GFP mice with the 4 factors at the indicated time points.

FIG. 35 is a graph showing mRNA levels of the early pluripotent marker Fbxol5 normalized to the Gapdh housekeeping control gene in MEFs, TSCs, ESCs and MEFs exposed to OSKM or GETM in the indicated time points, as determined by qRT-PCR. FIG. 36 shows bright field images, green channel images of a representative stable iTSC colony expressing endogenous Sox2/GFP, generated from Sox2-GFP MEFs infected with GETM in the presence of JAK inhibitor (JAKi) In the upper panel there is a schematic representation of the strategy to reprogram MEFs into iTSCs in the presence of a JAKi.

FIGs. 37A-C demonstrate the generation of iTSCs using GETM is independent of Oct4 while generation of iPSCs using OSKM is dependent on the presence of Oct4. Figure 37A is a schematic representation of the strategy for growing iTSC or iPSC clones without Oct4. Figure 37B shows semi-quantitative PCR analysis using primers for the recognition of Cre activity on Oct4 loxP sites and using primer pair C, producing a 245 bp fragment from floxed alleles and a 1455 bp fragment from non-floxed alleles (upper photomicrograph) or using primer pair A, producing a 498 bp fragment from WT Oct4 alleles or a 532 bp (498+34 bp of the loxP) fragment from flox oct4 alleles or no PCR product (white star) (lower photomicrograph). Figure 37C shows bright field and green channel representative images of iTSC and iPSC colonies, with or without Cre expression.

FIGs. 38A-D demonstrate the generated iTSCs do not differentiate to cardiomyocytes. Figure 38A shows bright field images of beating colonies generated by OSKM, 6 and 10 days following dox induction as compared to bright field images of cells infected with the 4 factors (GETM), 6 and 10 days following dox exposure. Figure 38B is a graph summarizing the percentages of beating and non-beating colonies out of the total "n" number of colonies generated by OSKM or GETM, 6 and 10 days following dox induction. Figure 38C shows bright field images and immuno staining with anti-Tnnt2 (Troponin2) antibody in a beating colony generated by OSKM, 10 days following dox induction as compared to cells infected with GETM, 10 days following dox exposure. Figure 38D shows bright field images and immuno staining with anti- Tnnt2 (Troponin2) antibody in a beating colony generated by OSKM, 6 days following dox induction as compared to cells infected with GETM, 6 days following dox exposure.

FIG. 39 is a schematic presentation of the fluorescent knock-in reporter systems for studying reprogramming indicating the different fluorescent proteins and their targeted loci in the ESC KH2 line. FIG.s 40A-F demonstrate the establishment of the dox-inducible fluorescent knock-in reporter KH2 systems. Figure 40A shows southern blot analysis of 24 KH2 colonies that were electroporated with the Nanog-2A-EGFP targeting construct along with a CRISPR/Cas9 vector containing a guide RNA targeting the 3 'UTR of Nanog (Upper panel). Red asterisk represents correctly targeted clones. C represents control untargeted KH2 cells. Bright field and green channel images of correctly targeted colony number 12 (KH2-Ng#12) are presented in the lower panel. This colony was picked for further targeting events since it displayed a proper ESC morphology and a stable EGFP expression under the microscope. Figure 40B shows southern blot analysis of 24 KH2-Ng#12 colonies that were electroporated with the Esrrb-2A-EBFP targeting construct along with a CRISPR/Cas9 vector containing a guide RNA targeting the 3 'UTR of Esrrb (Upper panel). Images of correctly targeted colony number 24 (KH2- NgEb#24) are presented in the right panel. This colony was picked for further targeting events since it displayed a proper ESC morphology and a stable EGFP and EBFP expression under the microscope and when analysed by flow cytometry (lower panel). Figure 40C shows southern blot analysis of 15 KH2-Ng#12 colonies that were electroporated with the Utfl-2A-tdTomato targeting construct along with a CRISPR/Cas9 vector containing a guide RNA targeting the 3 'UTR of Utfl (Upper panel). Images of correctly targeted colony number 4 (KH2-NgUr#4) are presented in the right panel. This colony was selected since it displayed a proper ESC morphology and a stable EGFP and tdTomato expression under the microscope and when analysed by flow cytometry (lower panel). Figure 40D shows representative images of a gonad isolated from E13.5 embryos generated following injection of KH2-NgUr#4 and KH2- NgEb#24 into tetraploid (4n) blastocysts demonstrating expression of the Nanog-2A- EGFP and Utfl-2A-tdTomato reporters solely in the germ cells. Figure 29E shows representative images adult mice generated following injection of KH2-NgUr#4 and KH2-NgEb#24 into tetraploid (4n) blastocysts. Figure 40F shows southern blot analysis of 12 KH2-NgEb#24 colonies that were electroporated with the Utfl -2 A- tdTomato targeting construct along with a CRISPR/Cas9 vector containing a guide targeting the 3 'UTR of Utfl (Left panel). Representative images of correctly targeted colony number 1 (KH2-NgEbUr#l) are presented in the middle and right panels. This colony was picked for further targeting events since it displayed a proper ESC morphology and a stable EGFP/EBFP and tdTomato expression under the microscope.

FIG. 41 demonstrates that Esrrb and Utfl reporters turn on during the conversion to iTSCs. Depicted are representative fluorescent microscope images of the various reporters following infection of the knock-in Nanog-EGFP and Esrrb-EBFP (KH2-NgEb#24) or Nanog-EGFP and Utfl -tdTomato (KH2-NgUr#4) MEFs with the 12 key master factors.

DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION

Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.

Regenerative medicine is a new and expanding discipline that aims at replacing lost or damaged cells, tissues or organs in the human body through cellular transplantation. The generation of induced stem cells and the direct conversion approach provide an invaluable resource of cells for regenerative medicine and disease modeling. In here, the direct conversion approach refers to both de-differentiation of a somatic cell and reprogramming of a stem cell. In mammals, specialized cell types of the placenta mediate the physiological exchange between the fetus and mother during pregnancy. The precursors of these differentiated cells are trophoblast stem cells (TSCs) and therefore, TSCs have tremendous biomedical relevance. Generation of induced TSC-like cells (iTSCs) from embryonic stem cells (ESCs) and somatic cells e.g. fibroblast has been described before; however, in all models lineage conversion remained incomplete and failed to confer a stable true TSC phenotype.

Whilst reducing the present invention to practice, the present inventors have now uncovered that transient ectopic expression of TSC key master regulators in cells leads to the formation of stable and transgene-independent iTSCs that resemble endogenous TSCs in their transcriptome, methylome and function and suggest its use in disease modeling, drug screening, and placenta augmentation.

As is illustrated hereinunder and in the examples section, which follows, the present inventors have shown that transient ectopic expression of three trophoblast stem cell (TSC) key master regulators, Gata3, Eomes and Tfap2c with or without c-Myc in fibroblasts, initiates a mesenchymal-to-epithelial transition (MET) process that leads to the formation of stable and transgene-independent induced trophoblast stem cells (iTSCs). The induced TSCs may be cultured independently of the exogenous factors for a large number of passages (> 30 passages) and resemble blastocyst-derived TSCs in their morphology, expression of TSC specific markers, no expression of ESC specific and fibroblasts specific markers, transcriptome, genomic stability, methylation status, and H2A.X organization (Examples 1-3, Figures 1-23, 24A-B and 32). The inventors further demonstrate that the generated iTSCs can differentiate into all derivatives of the trophectoderm lineage in vitro (Example 1, Figure 3 Example 3 Figures 25A-C), can give rise to hemorrhagic lesions in nude mice (Example 3, Figures 26A-B), and can chimerize the placenta of the developing embryo (Example 3, Figures 27-31), suggesting that iTSCs acquire all hallmarks of TSCs. Careful examination of the conversion process indicates that the cells did not go through a transient pluripotent state (Example 3, Figures 33-36, 37A-C and 38A-D). Without being bound by theory, these results suggest that a high degree of nuclear reprogramming can be attained in non-pluripotent cells.

In addition, the inventors have developed a fluorescent knock-in reporter system that can be used to capture a reprogrammable iTSC or iPSC early in the re- programming process (Example 4, Figures 39-41) that can be used along the teaching of the present invention.

Consequently, these results suggest the use of Gata3, Eomes and Tfap2c with or without c-Myc for generation of iTSC from somatic cells and their further use in regenerative medicine and disease modeling. Furthermore, this is the first time that an isolated iTSC was generated that maintained its differentiation level in culture for prolong periods of time (> 30 passages) without expressing the exogenous transcription factors used to reprogram the parental cell (i.e. Gata3, Eomes Tfap2c and c-Myc) Thus, according to a first aspect of the present invention, there is provided an isolated induced trophoblast stem cell (iTSC) maintaining differentiation level of a trophoblast stem cell for at least 20 passages in culture.

As used herein the term "isolated" refers to at least partially separated from the natural environment e.g., from the mammalian (e.g., primate) embryo or the mammalian (e.g., primate) body or from other cells in culture. Isolation can be done such that pure populations e.g., above 80 %, above 85 %, above 90 %, above 95 % or 100 % iTSCs are produced.

As used herein the term "induced trophoblast stem cell (iTSC)" refers to a cell obtained by de-differentiation or re-programming of a cell. The iTSC thus produced is endowed with multipotency, in this case being capable of differentiating into the trophoblastic lineage. According to specific embodiments, such cells are obtained from a differentiated cell (e.g. a somatic cell such as a fibroblast) and undergo de- differentiation by genetic manipulation which re-program the cell to acquire trophoblast stem cells (TSC) characteristics. According to specific embodiments, the iTSC is capable of differentiating to the three types of the trophoblast lineage cells in the placental tissue: the villous cytotrophoblast, the syncytiotrophoblast, and the extravillous trophoblast. The villous cytotrophoblast cells are specialized placental epithelial cells which differentiate, proliferate and invade the uterine wall to form the villi. Cytotrophoblasts, which are present in anchoring villi can fuse to form the syncytiotrophoblast layer or form columns of extravillous trophoblasts (Cohen S. et al., 2003. J. Pathol. 200: 47-52).

According to specific embodiments, the iTSC is a primate cell.

According to specific embodiments, the iTSC is a human cell.

According to other specific embodiments, the iTSC is a rodent cell (e.g. mouse, rat).

An iTSC is typically similar to a TSC which is derived from the placenta of a mammalian embryo in e.g. morphology, expression of specific markers, transcriptome, methylation pattern, and function, as further described below.

According to specific embodiments, the iTSC is characterized by at least one of: (i) TSC morphology, as determined by e.g. microscopic evaluation (by bright field or H&E staining, electron microscopy. According to specific embodiments the TSC morphology is characterized by flat dense colony with higher edges;

(ii) TSC markers, as determined by an immunocytochemistry and/or PCR assay;

(x) in-vivo formation of a trophoblastic hemorrhagic lesion (e.g. in nude mice), as determined by histological evaluation;

(xii) localization to the placenta of the developing embryo as determined by immunohistochemistry and fluorescent reporter; and

(xiii) no change in differentiation level for at least 20 passages in culture as determined by at least of the assay in (i-) - (xii).

According to specific embodiments, the TSC markers are selected from the group consisting of Elf5, Cdx2, Esrrb, Utfl, Tead4 and Handl, Tfap2c, Ets2, Eomes, Sox2. According to specific embodiments, the ESC specific markers are selected from the group consisting of Nanog, Oct4 and Dppa3.

According to specific embodiments, the fibroblast specific markers are selected from the group consisting of Thyl, Col5a2, Postn.

According to specific embodiments, the methylation pattern comprises hypomethylation of the Elf 5 promoter, hypomethylation of the Handl promoter and/or hypermethylation of the Nanog promoter as compared to the parental non- reprogrammed cell and/or an ESC cell.

According to specific embodiments the iTSC is characterized by absence of embryonic stem cell (ESC) specific markers (e.g. Nanog, Oct4 and Dppa3), as determined by an immunocytochemistry and/or PCR assay;

According to specific embodiments, the iTSC expresses ESC specific markers e.g. Oct4. According to specific embodiments, the iTSC maintains differentiation level of a TSC for at least 20, at least 30, at least 50 passages in culture.

According to a specific embodiment, the iTSC maintains its differentiation level of a TSC for at least 20 passages.

According to other specific embodiments, the iTSC maintains differentiation level of a TSC in an absence of expression of an exogenous transcription factor as determined by e.g. a PCR assay.

According to specific embodiments, the iTSC does not comprise the exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.

According to a specific embodiment, the iTSC does not comprise exogenous Gata3, Eomes and Tfap2c transcription as determined by PCR, western blot and/or flow cytometry.

According to specific embodiments, the iTSC comprises an exogenous transcription factor not in the natural location (i.e., gene locus) and/or expression level (e.g., copy number and/or cellular localization) of the native gene of the transcription factor.

According to specific embodiments, the iTSC comprises an ectopic DNA of an exogenous transcription factor integrated in the genome of the cell but not in its natural location (i.e. locus) and/or copy number. According to specific embodiments, the transcription factor is selected form the group consisting of Gata3, Eomes and Tfap2c.

As described, the present inventors have developed a novel method for generating an iTSC.

Thus, according to another aspect of the present invention, there is provided a method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of an iTSC from said cell, thereby generating the iTSC from the cell, with the proviso that the method does not consist of expressing within said cell Eomes, Cdx2, Elf5, cMyc and Klf4.

According to another aspect of the present invention, there is provided a method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising transiently expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of a iTSC from said cell, thereby generating the iTSC from the cell.

According to another aspect of the present invention, there is provided a method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising expressing within the cell exogenous Gata3, Eomes and Tfap2c transcription factors, under conditions which allow generation of an iTSC from said cell, thereby generating the iTSC from the cell.

According to an aspect of some embodiments of the invention, there is provided an isolated induced trophoblast stem cell (iTSC) obtainable by the method of some embodiments of the invention.

As used herein the term "cell" refers to any cell derived from an organism including an adult cell, a fetal cell, a somatic cell and a stem cell.

According to specific embodiments, the cell is a stem cell.

As used herein, the phrase "stem cell" refers to a cell which is not terminally differentiated i.e., capable of differentiating into other cell types having a more particular, specialized function (e.g., fully differentiated cells). The term encompasses embryonic stem cells, fetal stem cells, adult stem cells or committed/progenitor cells. According to specific embodiments, the cell is a somatic cell.

As used herein, the phrase "somatic cell" refers to a terminally differentiated cell. Non-limiting examples of somatic cells include a fibroblast, a blood cell, an endothelial cell, a hepatocyte, a pancreatic cell, a cartilage cell, a myocyte, a cardiomyocyte, a smooth muscle cell, a keratinocyte, a neural cell, a retinal cell, an epidermal cell, an epithelial cell (e.g., isolated from the oral cavity) or a cell isolated from placenta.

According to specific embodiments, the somatic cell is selected from the group consisting of a fibroblast, a blood cell, a keratinocyte, an epithelial cells e.g., a cell isolated from the oral cavity or a cell isolated from placenta.

According to a specific embodiment, the somatic cell is a fibroblast.

According to specific embodiments, the cell is a primate cell.

According to specific embodiments, the cell is a human cell.

According to other specific embodiments, the cell is a rodent cell (e.g. mouse, rat).

According to specific embodiments, the cell is comprised in a homogenous population of cells, i.e. wherein at least about 80 % of the cells in the population are iTSCs.

According to other specific embodiments, the cell is comprised in a heterogeneous population of cells, i.e. in a population which comprises more than one cell type, in which at least 30 % are iTSCs.

As mentioned, an exogenous transcription factor is expressed in the cell.

As used herein, the term "transcription factor" refers to a cellular factor regulating gene transcription. According to specific embodiments, the transcription factor is a polypeptide with the ability to bind a specific nucleic acid sequence (i.e. the binding site) which is specific for a specific transcription factor(s). The transcription factor of the present invention is a key master regulator that is part of the core circuitry of the cell. Non-limiting examples of transcription factors include Tfap2c, Tead4, Handl, Dppal, Gata3, Ets2, Elf5, Cdx2, Eomes, c-Myc, Utfl and Esrrb.

As used herein, the term "Tfap2c", also known as Transcription Factor AP-2 Gamma, Activating Enhancer-Binding Protein 2 Gamma, Estrogen Receptor Factor 1 and AP2-GAMMA, refers to the polynucleotide and expression product e.g., polypeptide of the TFAP2C gene. According to specific embodiments the Tfap2c refers to the human Tfap2c, such as provided in the following GeneBank Numbers NP_003213 and NM 003222 (SEQ ID NO: 122-123). According to other specific embodiments, the Gata3 refers to the mouse Tfap2c, such as provided in the following GeneBank Numbers NP_001153168 and NM_001159696 (SEQ ID NO: 124-125). A functional expression product of Tfap2c is capable of supporting, optionally along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Tead4" also known as TEA Domain Family Member 4, TCF13L1, RTEF1, TEF3, HRTEF-1B, EFTR-2 and TEFR-1, refers to the polynucleotide and expression product e.g., polypeptide of the TEAD4 gene. According to specific embodiments the Tead4 refers to the human Tead4, such as provided in the following GeneBank Numbers NP_003204 and NM_003213 (SEQ ID NO: 126-127). According to other specific embodiments, the Tead4 refers to the mouse Tead4, such as provided in the following GeneBank Numbers NP_001074448 and NM_001080979 (SEQ ID NO: 128-129). A functional expression product of Tead4 is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Handl" also known as Heart And Neural Crest Derivatives Expressed 1, Class A Basic Helix-Loop-Helix Protein 27, BHLHa27, EHand, Thingl and Hxt refers to the polynucleotide and expression product e.g., polypeptide of the HAND1 gene. According to specific embodiments the Handl refers to the human Handl, such as provided in the following GeneBank Numbers NP_004812 and NM_004821 (SEQ ID NO: 130-131). According to other specific embodiments, the Handl refers to the mouse Handl, such as provided in the following GeneBank Numbers NP_032239 and NM_008213 (SEQ ID NO: 132-133). A functional expression product of Handl is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Gata3", also known as GATA Binding Protein 3 and HDRS, refers to the polynucleotide and expression product e.g., polypeptide of the GAT A3 gene. According to specific embodiments the Gata3 refers to the human Gata3, such as provided in the following GeneBank Numbers NP_001002295 and NM_001002295 (SEQ ID NO: 134-135). According to other specific embodiments, the Gata3 refers to the mouse Gata3, such as provided in the following GeneBank Numbers NP_032117 and NM_008091 (SEQ ID NO: 136-137). A functional expression product of Gata3 is capable of supporting, optionally along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Ets2" also known as V-Ets Avian Erythroblastosis Virus E26 Oncogene Homolog 2 and Protein C-Ets-2, refers to the polynucleotide and expression product e.g., polypeptide of the ETS2 gene. According to specific embodiments the Ets2 refers to the human Ets2, such as provided in the following GeneBank Numbers NP_001243224 and NM_001256295 (SEQ ID NO: 138-139). According to other specific embodiments, the Ets2 refers to the mouse Ets2, such as provided in the following GeneBank Numbers NP_035939 and NM_011809 (SEQ ID NO: 140-141). A functional expression product of Ets2 is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Elf5" also known as E74-like factor 5, Epithelium- Restricted ESE-1 -Related Ets Factor, Epithelium-Specific Ets Transcription Factor 2 and ESE2, refers to the polynucleotide and expression product e.g., polypeptide of the ELF5 gene. According to specific embodiments the Elf5 refers to the human Elf5, such as provided in the following GeneBank Numbers NP_001230009 and NM_001243080 (SEQ ID NO: 142-143). According to other specific embodiments, the Elf5 refers to the mouse Elf5, such as provided in the following GeneBank Numbers NP_001139285 and NM_001145813 (SEQ ID NO: 144-145). A functional expression product of Elf5 is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Cdx2" also known as Caudal Type Homeobox 2, CDX3 and CDX2/AS, refers to the polynucleotide and expression product e.g., polypeptide of the CDX2 gene. According to specific embodiments the Cdx2 refers to the human Cdx2, such as provided in the following GeneBank Numbers NP_001256 and NM_001265 (SEQ ID NO: 146-147). According to other specific embodiments, the Cdx2 refers to the mouse Cdx2, such as provided in the following GeneBank Numbers NP_031699 and NM_007673 (SEQ ID NO: 148-149). A functional expression product of Cdx2 is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Eomes" also known as Eomesodermin, TBR2 and T- Box Brain Protein 2, refers to the polynucleotide and expression product e.g., polypeptide of the EOMES gene. According to specific embodiments the Eomes refers to the human Eomes, such as provided in the following GeneBank Numbers NP_005433 and NM_005442 (SEQ ID NO: 150-151). According to other specific embodiments, the Eomes refers to the mouse Eomes, such as provided in the following GeneBank Numbers NP_001158261 and NM_001164789 (SEQ ID NO: 152-153). A functional expression product of Eomes is capable of supporting, optionally along with other factors which are described herein, the generation of iTSC.

As used herein, the term "c-Myc" also known as V-Myc Avian Myelocytomatosis Viral Oncogene Homolog, Class E Basic Helix-Loop-Helix Protein 39, Transcription Factor P64, BHLHe39, MRTL and MYCC, refers to the polynucleotide and expression product e.g., polypeptide of the MYC gene. According to specific embodiments the c-Myc refers to the human c-Myc, such as provided in the following GeneBank Numbers NP_002458 and NM_002467 (SEQ ID NO: 154-155). According to other specific embodiments, the c-Myc refers to the mouse c-Myc, such as provided in the following GeneBank Numbers NP_001170823 and NM_001177352 (SEQ ID NO: 156-157). A functional expression product of c-Myc is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Utfl " also known as Undifferentiated Embryonic Cell Transcription Factor 1, refers to the polynucleotide and expression product e.g., polypeptide of the UTF1 gene. According to specific embodiments the Utfl refers to the human Utfl, such as provided in the following GeneBank Numbers NP_003568 and NM_003577 (SEQ ID NO: 158-159). According to other specific embodiments, the Utfl refers to the mouse Utfl, such as provided in the following GeneBank Numbers NP_033508 and NM_009482 (SEQ ID NO: 160-161). A functional expression product of Utfl is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Esrrb" also known as Estrogen-related receptor beta and NR3B2, refers to the polynucleotide and expression product e.g., polypeptide of the ESRRB gene. According to specific embodiments the Esrrb refers to the human Esrrb, such as provided in the following GeneBank Numbers NP_004443 and NM_004452 (SEQ ID NO: 162-163). According to other specific embodiments, the Esrrb refers to the mouse Esrrb, such as provided in the following GeneBank Numbers NP_001152972 and NM_001159500 (SEQ ID NO: 164-165). A functional expression product of Esrrb is capable of supporting, along with other factors which are described herein, the generation of iTSC.

As used herein, the term "Dppal" also known as developmental pluripotency associated 1 refers to the polynucleotide and expression product e.g., polypeptide of the DPPA1 gene. According to specific embodiments, the Dppal refers to the mouse Dppal, such as provided in the following GeneBank Numbers NP_001156830, NP_839978 and NM_001163358, NM_178247 (SEQ ID NO: 166-169). A functional expression product of Dppal is capable of supporting, along with other factors which are described herein, the generation of iTSC.

The terms "Tfap2c", "Tead4", "Handl", "Gata3", "Ets2", "Elf 5", "Cdx2", "Eomes", "c-Myc", "Utf 1" "Esrrb" and "Dppal", also refer to functional Tfap2c, Tead4, Handl, Gata3, Ets2, Elf5, Cdx2, Eomes, c-Myc, Utfl, Esrrb and Dppal, homologues which exhibit the desired activity (i.e., de-differentiating or reprogramming a cell to an iTSC). Such homologues can be, for example, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide of SEQ ID NOs: 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166 and 167, respectively, or 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical to the polynucleotide sequence encoding same (as further described hereinbelow).

The homolog may also refer to an ortholog, a deletion, insertion, or substitution variant, including an amino acid substitution, as long as it retains the activity.

Sequence identity or homology can be determined using any protein or nucleic acid sequence alignment algorithm such as Blast, ClustalW, and MUSCLE.

The present invention contemplates expressing at least one transcription factor selected form the group consisting of Gata3, Eomes and Tfap2c. According to specific embodiments, one, two or all of the transcription factors are exogenously expressed in the cell i.e.: Gata3; Eomes; Tfap2c; Gata3 + Eomes; Gata3 + Tfap2c; Eomes + Tfap2c; or Gata3+ Eomes + Tfap2c.

According to specific embodiments all of the transcription factors are exogenously expressed in the cell i.e. Gata3+ Eomes + Tfap2c.

According to specific embodiments, the method comprises expressing within the cell an exogenous c-Myc transcription factor.

According to specific embodiments, the method comprises expressing within the cell least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf 5.

According to specific embodiments, one, two, three or all of the transcription factors are exogenously expressed in the cell i.e.: Tead4; Ets2; Cdx2; Elf5; Tead4 + Ets2; Tead4 + Cdx2; Tead4 + Elf 5; Ets2 + Cdx2; Ets2 + Elf 5; Cdx2 + Elf 5; Tead4 + Ets2 + Cdx2; Tead4 + Ets2 + Elf5; Tead4 + Cdx2 + Elf 5; Ets2 + Cdx2 + Elf 5; or Tead4 + Ets2 + Cdx2 + Elf 5.

Additional transcriptional factors which may be expressed according to some embodiments of the invention may be selected from the group consisting of Tead4, Handl, Dppal, Ets2, Utfl and Esrrb.

Thus, according to specific embodiments, the method comprises expressing Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Esrrb and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the method comprises expressing Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Elf5 and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the method comprises expressing Gata3,

Tfap2c, Eomes, Tead4, Ets2 and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the method comprises expressing Gata3, Tfap2c, Eomes, Tead4 and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the method comprises expressing Gata3, Tfap2c, Eomes, Ets2 and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the method comprises expressing Gata3, Tfap2c, Eomes, c-Myc and Esrrb exogenous transcription factors. According to specific embodiment, the method does not consist of expressing within the cell Eomes, Cdx2, Elf5, c-Myc and Klf4.

As used herein, the term "Klf4" also known as Kruppel-Like Factor 4 (Gut), GKLF and EZF, refers to the polynucleotide and expression product e.g., polypeptide of the KLF4 gene. According to specific embodiments the Klf4 refers to the human Klf4, such as provided in the following GeneBank Numbers NP_004226 and NM_004235 (SEQ ID NO: 170-171). According to other specific embodiments, the Klf4 refers to the mouse Klf4, such as provided in the following GeneBank Numbers NP_034767 and NM_010637 (SEQ ID NO: 172-173). The term "Klf4" also refers for Klf4 homologues and orthologs. Such homologues can be, for example, at least 80 %, at least 81 %, at least 82 %, at least 83 %, at least 84 %, at least 85 %, at least 86 %, at least 87 %, at least 88 %, at least 89 %, at least 90 %, at least 91 %, at least 92 %, at least 93 %, at least 94 %, at least 95 %, at least 96 %, at least 97 %, at least 98 %, at least 99 % or 100 % identical or homologous to the polypeptide of SEQ ID NOs: 170 and 172 or the polynucleotide sequence encoding same.

As used herein, the term "expressing" or "expression" refers to gene expression at the RNA and/or protein level. The term also refers to upregulating gene expression by expressing the DNA or RNA or upregulating the level of the protein by direct administration of the protein to the cell.

As used herein, the term "exogenous" refers to a heterologous polynucleotide or polypeptide which is not naturally expressed within the cell or which overexpression in the cell is desired. The exogenous polynucleotide and/or polypeptide may be introduced into the cell in a stable or transient manner. In the case of a polynucleotide introduction is effected so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule. According to specific embodiments, expressing comprises transiently expressing. It should be noted that the exogenous polynucleotide and/or polypeptide may comprise a nucleic acid sequence and/or an amino acid sequence, respectively, which is identical or partially homologous to an endogenous nucleic acid sequence and/or an endogenous amino acid sequence of the cell. Methods of expressing an exogenous nucleic acid sequence and/or amino acid sequence are known in the art and include those described for example in the materials and methods of the Examples section which follows and in Mansour et al. 2012; Warren et al. 2010 and Hongyan Zhou al. Cell Stem Cell (2009) 4(6): 581; Rabinovich and Weissman (2013) Methods Mol Biol. 969:3-28; International Application Publication No. WO 2013049389 and US Patent No. US 8557972, which are fully incorporated herein by reference in their entirety.

Further description of preparation of expression vectors and modes of administering them into cells are provided hereinunder.

According to specific embodiments, expressing is not in the natural location (i.e., gene locus) and/or expression level (e.g., copy number and/or cellular localization) of the native gene of the transcription factor.

According to other specific embodiments, expressing is not in the natural position and/or copy number of the native gene of the transcription factor in a genome.

Alternatively or additionally, exogenous expression of a transcription factor may be facilitated by activation of the endogenous locus of these genes such that the transcription factor is overexpressed in the cell. Methods of activating and overexpressing an endogenous gene are well known in the art [see for example Menke D. Genesis (2013) 51: - 618; Capecchi, Science (1989) 244: 1288-1292; Santiago et al. Proc Natl Acad Sci USA (2008) 105:5809-5814; International Patent Application Nos. WO 2014085593, WO 2009071334 and WO 2011146121; US Patent Nos. 8771945, 8586526, 6774279 and UP Patent Application Publication Nos. 20030232410, 20050026157, US20060014264; the contents of which are incorporated by reference in their entireties] and include, but not limited to and include targeted homologous recombination (e.g. "Hit and run", "double-replacement"), site specific recombinases (e.g. the Cre recombinase and the Flp recombinase), PB transposases (e.g. Sleeping Beauty, piggyBac, Tol2 or Frog Prince), genome editing by engineered nucleases (e.g. meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system) and genome editing using recombinant adeno-associated virus (rAAV) platform, and small molecules. Agents for introducing nucleic acid alterations to a gene of interest can be designed publically available sources or obtained commercially from Transposagen, Addgene and Sangamo Biosciences.

The term "endogenous" as used herein refers to a polynucleotide or polypeptide which is present and/or naturally expressed within the cell. Distinguishing a cell expressing an exogenous polynucleotide and/or polypeptide (e.g. transcription factor) from a cell not expressing the exogenous polynucleotide and/or polypeptide can be effected by e.g. determining the level and/or distribution of the RNA and/or protein molecules in the cell, the location of DNA integration in the genome of the cell and/or the number of gene copy number. Methods of determining the presence of an exogenous polynucleotide and/or polypeptide in a cell are well known in the art and include e.g. PCR, DNA and RNA sequencing, Southern blot, Western blot, immunoprecipitation, immunocytochemistry, flow cytometry and imaging.

As used herein the term "polynucleotide" refers to a single or double stranded nucleic acid sequence which is isolated and provided in the form of an RNA sequence, a complementary polynucleotide sequence (cDNA), a genomic polynucleotide sequence (e.g. sequence isolated from a chromosome) and/or a composite polynucleotide sequences (e.g., a combination of the above). This term includes polynucleotides and/or oligonucleotides derived from naturally occurring nucleic acids molecules (e.g., RNA or DNA), synthetic polynucleotide and/or oligonucleotide molecules composed of naturally occurring bases, sugars, and covalent internucleoside linkages (e.g., backbone), as well as synthetic polynucleotides and/or oligonucleotides having non-naturally occurring portions, which function similarly to the respective naturally occurring portions.

The term "polypeptide" as used herein encompasses native peptides (either degradation products, synthetically synthesized peptides or recombinant peptides) and peptidomimetics (typically, synthetically synthesized peptides), as well as peptoids and semipeptoids which are peptide analogs, which may have, for example, modifications rendering the peptides more stable while in a body or more capable of penetrating into cells. Such modifications include, but are not limited to N terminus modification, C terminus modification, peptide bond modification, backbone modifications, and residue modification. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press (1992), which is incorporated by reference as if fully set forth herein.

Peptide bonds (-CO-NH-) within the peptide may be substituted, for example, by N-methylated amide bonds (-N(CH3)-CO-), ester bonds (-C(=0)-0-), ketomethylene bonds (-CO-CH2-), sulfinylmethylene bonds (-S(=0)-CH2-), a-aza bonds (-NH-N(R)- CO-), wherein R is any alkyl (e.g., methyl), amine bonds (-CH2-NH-), sulfide bonds (- CH2-S-), ethylene bonds (-CH2-CH2-), hydroxyethylene bonds (-CH(OH)-CH2-), thioamide bonds (-CS-NH-), olefinic double bonds (-CH=CH-), fluorinated olefinic double bonds (-CF=CH-), retro amide bonds (-NH-CO-), peptide derivatives (-N(R)- CH2-CO-), wherein R is the "normal" side chain, naturally present on the carbon atom.

These modifications can occur at any of the bonds along the polypeptide chain and even at several (2-3) bonds at the same time.

Natural aromatic amino acids, Trp, Tyr and Phe, may be substituted by non- natural aromatic amino acids such as l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid (Tic), naphthylalanine, ring-methylated derivatives of Phe, halogenated derivatives of Phe or O-methyl-Tyr.

The polypeptides of some embodiments of the invention may also include one or more modified amino acids or one or more non-amino acid monomers (e.g. fatty acids, complex carbohydrates etc).

The term "amino acid" or "amino acids" is understood to include the 20 naturally occurring amino acids; those amino acids often modified post-translationally in vivo, including, for example, hydroxyproline, phosphoserine and phospho threonine; and other unusual amino acids including, but not limited to, 2-aminoadipic acid, hydroxylysine, isodesmosine, nor-valine, nor-leucine and ornithine. Furthermore, the term "amino acid" includes both D- and L-amino acids.

The polypeptides of some embodiments of the invention may be synthesized by any techniques known to those skilled in the art of peptide synthesis, for example but not limited to recombinant DNA techniques or solid phase peptide synthesis.

Following is a non-limiting description of expression vectors and modes of administering thereof into cells which can be used to express a polypeptide-of-interest (e.g., any of the proteins described hereinabove and below, e.g. Gata3, Eomes, Tfap2c and c-Myc and a reporter polypeptide) in a cell.

According to specific embodiments, expressing comprises introducing into the cell a polynucleotide encoding the polypeptide-of-interest (e.g. the transcription factor

According to specific embodiments, the polynucleotide is a DNA.

According to specific embodiments, the polynucleotide is a RNA. Typically, mRNA introduced into cells exists only in the cytoplasm, does not cause genome perturbations and is essentially transient. Unless expression of the mRNA changes the cell epigenetically, transient transfection is limited by the time of mRNA and cognate protein persistence in the cell, and does not continue after degradation of cognate proteins.

To express an exogenous protein in mammalian cells, a polynucleotide sequence encoding the polypeptide-of-interest is preferably ligated into a nucleic acid construct suitable for mammalian cell expression.

Teachings of the invention further contemplate that the polynucleotides are part of a nucleic acid construct system where the polypeptides of interest are expressed from a plurality of constructs.

It will be appreciated that over-expression or exclusion of genes can be effected using knock-in and/or knock-out constructs [see for example, Fukushige, S. and Ikeda, J. E.: Trapping of mammalian promoters by Cre-lox site-specific recombination. DNA Res 3 (1996) 73-50; Bedell, M. A., Jerkins, N. A. and Copeland, N. G.: Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice. Genes and Development 11 (1997) 1-11; Bermingham, J. J., Scherer, S. S., O'Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L. and Rosenfeld, M. G.: Tst-l/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 10 (1996) 1751-62].

Thus, according to an aspect of the present invention, there is provided a nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding at least two transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.

According to specific embodiments, two or all of the transcription factors are encoded by the polynucleotide i.e.: Gata3 + Eomes; Gata3 + Tfap2c; Eomes + Tfap2c; or Gata3+ Eomes + Tfap2c.

According to specific embodiments, the at least one polynucleotide further comprises a nucleic acid sequence encoding c-Myc transcription factor.

According to other specific embodiments, the at least one polynucleotide comprises a nucleic acid sequence encoding at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf5. According to specific embodiments, one, two, three or all of the transcription factors are encoded by the polynucleotide i.e.: Tead4; Ets2; Cdx2; Elf5; Tead4 + Ets2; Tead4 + Cdx2; Tead4 + Elf 5; Ets2 + Cdx2; Ets2 + Elf 5; Cdx2 + Elf 5; Tead4 + Ets2 + Cdx2; Tead4 + Ets2 + Elf 5; Tead4 + Cdx2 + Elf 5; Ets2 + Cdx2 + Elf 5; or Tead4 + Ets2 + Cdx2 + Elf 5.

According to specific embodiments, the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c and optionally c-Myc.

According to specific embodiments, the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c and Tead4 and optionally c-Myc.

According to specific embodiments, the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c and Ets2 and optionally c-Myc.

According to specific embodiments, the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c, Tead4 and Ets2 and optionally.

According to specific embodiments, the nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding Gata3, Eomes, Tfap2c, Tead4, Ets2, Cdx2 and Elf5 and optionally c-Myc.

Thus, according to specific embodiments, the nucleic acid construct system comprises an individual nucleic acid construct for each transcription factor.

According to other specific embodiments a single construct comprises a number of transcription factors.

Such a nucleic acid construct or system includes at least one cis-acting regulatory element for directing expression of the nucleic acid sequence. Cis-acting regulatory sequences include those that direct constitutive expression of a nucleotide sequence as well as those that direct inducible expression of the nucleotide sequence only under certain conditions. Thus, for example, a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner is included in the nucleic acid construct. In the case of mRNA, since gene expression from an RNA source does not require transcription, there is no need in a promoter sequence or the additional sequences involved in transcription described hereinbelow.

The nucleic acid construct or system (also referred to herein as an "expression vector") of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vector may also contain a transcription and/or translation initiation sequence, transcription and/or translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.

Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.

Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.

In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.

In addition to the elements already described, the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.

The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.

The expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.

It will be appreciated that the individual elements comprised in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding the protein-of- interest can be arranged in a "head-to-tail" configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.

Other than containing the necessary elements for the transcription and translation of the inserted coding sequence, the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide.

According to specific embodiments, the expression construct include labels for imaging in cells, such as fluorescent labels.

Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/-), pGL3, pZeoSV2(+/-), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMTl, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.

Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-lMTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205. Other exemplary vectors include pMSG, pAV009/A⁺, pMTO10/A⁺, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.

As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein.

Various methods can be used to introduce the polynucleotide or polypeptide of some embodiments of the invention into cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504- 512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation, nucleofection, microinjection, and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods. Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems.

Naked DNA or RNA, cell penetrating peptide or Viral and non-viral vectors (e.g. but not limited to liposomes, nanoparticles, mammalian vectors and the like) may be utilized as delivery vehicles in delivery of the polynucleotide or polypeptide as is known in the art. According to specific embodiments of the invention, the delivery system used is biocompatible and nontoxic.

Following are exemplary embodiments suitable for enhancing penetration of the exogenous polynucleotide or polypeptide to cells.

According to one exemplary embodiment, naked DNA or RNA [e.g., naked plasmid DNA (pDNA)] is non-viral vector which can be produced in bacteria and manipulated using standard recombinant DNA techniques. It does not induce antibody response against itself (i.e., no anti-DNA or RNA antibodies generated) and enables long-term gene expression even without chromosome integration. Naked DNA or RNA can be introduced by numerous means, for example but not limited to, intravascular and electroporation techniques [Wolff JA, Budker V, 2005, Adv. Genet. 54: 3-20], or by jet injection [Walther W, et al., 2004, Mol. Biotechnol. 28: 121-8].

According to another exemplary embodiment mammalian vectors are used, as further described hereinabove.

According to specific embodiments, the polynucleotide is comprised in a viral vector. Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses. The viral vector may be a virus with DNA based genome of a virus with RNA based genome (i.e. positive single stranded and negative single stranded RNA viruses). Examples of viral vectors include, but are not limited to, Lentivirus, Adenovirus and Retrovirus.

A viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. Protocols for producing recombinant retroviruses and for infecting cells in-vitro or in-vivo with such viruses can be found in, for example, Ausubel et al., [eds, Current Protocols in Molecular Biology, Greene Publishing Associates, (1989)]. Other suitable expression vectors may be an adenovirus, a lentivirus, a Herpes simplex I virus or adeno-associated virus (AAV).

Regulatory elements that limit expression to particular cell types can also be included. Such features include, for example, promoter and regulatory elements that are specific for the desired cell type.

According to specific embodiments, expressing comprises introducing into the cell the polypeptide-of-interest (e.g. the transcription factor).

According to specific embodiments, the polypeptide is provided in a formulation suitable for cell penetration that enhances intracellular delivery of the polypeptide as further described hereinbelow.

Cell-Penetrating Peptides (CPPs) are short peptides (<40 amino acids), with the ability to gain access to the interior of almost any cell. They are highly cationic and usually rich in arginine and lysine amino acids. They have the exceptional property of carrying into the cells a wide variety of covalently and noncovalently conjugated cargoes such as proteins, oligonucleotides, and even 200 nm liposomes. Therefore, according to additional exemplary embodiment CPPs can be used to transport the polynucleotide or polypeptide to the interior of cells.

TAT (transcription activator from HIV-1), pAntp (also named penetratin, Drosophila antennapedia homeodomain transcription factor) and VP22 (from Herpes Simplex virus) are examples of CPPs that can enter cells in a non-toxic and efficient manner and may be suitable for use with some embodiments of the invention. Protocols for producing CPPs-cargos conjugates and for infecting cells with such conjugates can be found, for example L Theodore et al. [The Journal of Neuroscience, (1995) 15(11): 7158-7167], Fawell S, et al. [Proc Natl Acad Sci USA, (1994) 91:664-668], and Jing Bian et al. [Circulation Research. (2007) 100: 1626-1633].

The expression level and/or activity level of the exogenous polynucleotide and/or polypeptide expressed in the cells of some embodiments of the invention can be determined using methods known in the arts, e.g but not limited to Northern blot analysis, PCR analysis, Western blot analysis, Immunohistochemistry, and Fluorescence activated cell sorting (FACS).

"Conditions which allow generation of an iTSC from said cell" refer to those conditions which are directly correlated with the de-differentiation/re-programming of the cells and maintenance of the TSC phenotype for at least 20 passages. These conditions may comprise culturing time, medium composition and expression of an exogenous transcription factor.

According to specific embodiments the conditions are such that expressing is transient.

Thus, according to specific embodiments, the iTSC does not comprise the exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.

According to specific embodiments the conditions are such that expressing is for at least 5 days, 10 days, at least 15 days, at least 20 days, at least 25 days or at least 30 days following introducing of the exogenous transcription factor into the cell.

According to specific embodiments, the conditions are such that expressing is for at least 10 days following introducing the exogenous transcription factor into the cell.

According to specific embodiments the conditions are such that expressing is for no more than 15 days, no more than 20 days, no more than 25 days, no more than 30 days, or no more than 40 days following introducing of the exogenous transcription factor into the cell.

According to specific embodiments, the conditions are such that expressing is for no more than 30 days following introducing the exogenous transcription factor into the cell. According to specific embodiments, the conditions are such that the reprogramming is performed in the absence of eggs, embryos, embryonic stem cells (ESCs) or iPSCs. Thus any of these components are missing from the culture system.

According to specific embodiments, the conditions comprise a culture medium comprising FGF4 and heparin, as further described hereinbelow.

According to specific embodiments, the method comprising isolating the iTSC.

Methods of isolating cells are well known in the art and include mechanical and marker based techniques. Non-limiting examples of isolating techniques include cell sorting of cells via fluorescence activated cell sorter (FACS), magnetic separation using magnetically-labeled antibodies and magnetic separation columns (e.g. MACS, Miltenyi) and manual picking under the microscope.

According to specific embodiments, cell isolation is effected by picking the iTSC colonies under the binocular/microscope followed by trypsinization and culturing in a plate containing feeder cells.

According to specific embodiments, the isolation process yields a population comprising at least about 10%, at least about 12%, at least about 14%, at least about 16%, at least about 18%, at least about 20%, at least about 22%, at least about 24%, at least about 26%, at least about 28%, at least about 30%, at least about 32%, at least about 34%, at least about 36%, at least about 38%, at least about 40%, at least about 42%, at least about 44%, at least about 46%, at least about 48%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% of the iTSCs of some embodiments of the invention.

According to specific embodiments, the method is effected ex-vivo or in-vitro.

The present invention further contemplates a method of discovering at least one gene (e.g. transcription factor) that, when introduced into a cell, can reprogram the cell into trophoblast stem cell-like cells (iTSCs) the method comprising:

a) introducing a candidate gene into a cell; and

b) selecting a cell that exhibits TSC morphology and/or TSC marker (e.g., as described above) and acquire a stable state in the absence of expression of said gene. As used herein the term "stable" refers to an iTSC maintaining the differentiation level of a TSC for e.g. at least 20 passages in culture optionally without expressing the introduced candidate gene.

As the iTSCs of the present invention are generated by expressing the at least one transcription factor in a cell; according to another aspect of the present invention, there is provided an isolated cell expressing at least two exogenous transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.

According to another aspect of the present invention, there is provided an isolated cell expressing exogenous Gata3, Eomes and Tfap2c transcription factors.

According to specific embodiments, the isolated cell further expresses an exogenous c-Myc transcription factor.

According to specific embodiments, the isolated cell expresses at least one, at least two, at least three, at least 4, at least 5, at least 6, at least 7, or at least 8 additional transcription factors. The additional transcriptional factors may be selected from the group consisting of Tead4, Handl, Dppal, Ets2, Elf5, Cdx2, Utfl and Esrrb.

According to specific embodiments, the isolated cell further expresses at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2 Cdx2 and Elf 5.

Thus, according to specific embodiments, the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Esrrb and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the isolated cell expresses Gata3, Tfap2c, Eomes, Esrrb and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2, Elf5 and optionally c-Myc exogenous transcription factors.

According to specific embodiments, the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4, Ets2 and optionally c-Myc exogenous transcription factors.

According to other specific embodiments, the isolated cell expresses Gata3, Tfap2c, Eomes, Tead4 and optionally c-Myc exogenous transcription factors.

According to other specific embodiments, the isolated cell expresses Gata3,

Tfap2c, Eomes, Ets2 and optionally c-Myc exogenous transcription factors. According to specific embodiments, the isolated cell comprises a DNA molecule encoding said at least one transcription factor. Methods of evaluating the presence of an exogenous DNA molecule are known in the art and include, but are not limited to, DNA sequencing, Southern blotting, FISH and PCR.

According to specific embodiments, the isolated cell comprises a RNA molecule encoding said at least one transcription factor. Methods of evaluating the presence of an exogenous RNA molecule are known in the art and include, but are not limited to, RNA sequencing, Northern blotting and PCR.

According to specific embodiments, the isolated cell comprises a protein molecule of said at least one transcription factor. Methods of evaluating the presence of an exogenous protein molecule are known in the art and include, but are not limited to western blot, immunoprecipitation, immunocytochemistry and flow cytometry.

According to specific embodiments, the isolated cell is de-differentiated from a somatic cell. At times such cell may still comprise markers of origin i.e., of the source somatic cell.

Once obtained, the cells are cultured in a medium and being serially passaged.

Thus according to an aspect of the present invention, there is provided a cell culture comprising the isolated cell of the invention and a culture medium.

According to an aspect of the present invention, there is provided a cell culture comprising the isolated iTSC and a culture medium.

According to specific embodiments, the culture comprises a feeder cell layer such as, but not limited to, mouse embryonic feeder (MEF) cells, human embryonic fibroblasts or adult fallopian epithelial cells and human foreskin feeder layer. Typically, feeder cell layers secrete factors needed for stem cell proliferation, while at the same time, inhibit their differentiation.

The cell culture can be maintained in vitro, under culturing conditions, in which the cells are being passaged for extended periods of time (e.g., for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more), while maintaining the cell differentiation level (i.e. their TSC undifferentiated state).

It should be noted that culturing the cell (e.g. iTSC or iPSC) involves replacing the culture medium with a "fresh" medium (of identical composition) every 24-72 hours, and passaging each culture dish (e.g., a plate) every once - three times a week days. Thus, when cells in the culture reach about 60 - 90 % confluence the supernatant is discarded, the culture dishes are washed [e.g., with phosphate buffered saline (PBS)] and the cells are subjected to enzymatic dissociation from the culture dish, e.g., using trypsinization (0.25 % or 0.05% Trysin + EDTA), e.g., until single cells or cell clumps are separated from each other.

It should be noted that the culture conditions enable maintenance of the iTSC in their undifferentiated state without the need of further exogenous expression of the transcription factors. This is in sharp contrast to all prior attempts to generate iTSC which required exogenous expression of the transcription factors, and which upon withdrawal of these factors could not be maintained in the undifferentiated and pluripotent stem cells.

During the culturing step cells are further monitored for their differentiation state. Cell differentiation can be determined by evaluating cell morphology, or by examination of cell or tissue- specific markers which are known to be indicative of differentiation. For example, undifferentiated iTSC may express the TSC specific markers Elf5, Cdx2, Esrrb, Utfl, Tead4 and Handl, Tfap2c, Ets2, Eomes, and Sox2. In contrast, differentiated cells express other specific markers, thus for example fibroblast specific markers include Thyl, Col5a2 and Postn; cardiomyocytes specific markers include Troponin2.

Tissue/cell specific markers can be detected using immunological techniques well known in the art [Thomson JA et al., (1998). Science 282: 1145-7]. Examples include, but are not limited to, flow cytometry for membrane -bound markers and also for intracellular markers, immunohistochemistry for extracellular and intracellular markers and enzymatic immunoassay, for secreted molecular markers.

Methods useful for monitoring the expression level of specific genes are well known in the art and include RT-PCR, semi-quantitative RT-PCR, Northern blot, RNA in situ hybridization, Western blot analysis and immunohistochemistry.

Determination of iTSC undifferentiated state can also be effected by evaluating their differentiating potential both in-vitro and in-vivo by methods well known in the art such as disclosed in the materials and methods of the Examples section that follows, and include growing the cells in specified differentiation culture medium, and formation of a trophoblastic hemorrhagic lesion, localization to the extraembryonic region of the Blastocyst or localization to the placenta of the developing embryo, as shown in the Examples section which follows.

In addition to monitoring a differentiation state, the iTSC are often also being monitored for genomic stability, transcriptome, methylation pattern and H2A.X deposition by methods well known in the art, such as disclosed for examples in the Examples section which follows; and compared to the corresponding species.

As used herein the phrase "culture medium" refers to a solid or a liquid substance used to support the growth of cell. According to specific embodiments the culture medium is a liquid medium. According to specific embodiments the culture medium is capable of maintaining the iTSC in their differentiation state (i.e. an undifferentiated state). According to specific embodiments, the culture medium is capable of maintaining the iTSCs in their differentiation level for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more. According to a specific embodiment, the culture medium is capable of maintaining the iTSCs in their differentiation level for at least 20 passages.

The culture medium used by the present invention can be a water-based medium which includes a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids, proteins such as cytokines, growth factors and hormones, all of which are needed for cell proliferation and are capable of maintaining the stem cells in an undifferentiated state. For example, a culture medium can be a synthetic tissue culture medium such as RPMI (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), Ko-DMEM (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), DMEM/F12 (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), or DMEM/F12 (Biological Industries, Biet Haemek, Israel), supplemented with the necessary additives as is further described hereinunder. Preferably, all ingredients included in the culture medium of the present invention are substantially pure, with a tissue culture grade.

According to specific embodiments of the invention, the culture medium comprises FGF4 and heparin.

As used herein, the term "FGF4" refers to a polypeptide encoded by the FGF4 gene. According to specific embodiments the FGF4 the human polypeptide, such as provided in the following GeneBank Number NP_001998 (SEQ ID NO: 174), which is encoded by the nucleic acid set forth by GenBank Accession No. NM_002007 (SEQ ID NO: 175). Preferably, the FGF4 used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of iTSC. FGF4 can be obtained from various manufacturers such as PeproTech, R&D systems and Life Technologies.

According to some embodiments of the invention, FGF4 is provided at a concentration range from about 0.5 nanogram per milliliter (ng/ml) to about 1000 ng/ml, e.g., about 1-1000 ng/ml, e.g., about 1-500 ng/ml, e.g., about 1-200 ng/ml, e.g., about 1- 100 ng/ml, e.g., about 1-50 ng/ml, e.g., about 2-50 ng/ml, e.g., about 4-50 ng/ml, e.g., about 5-50 ng/ml, e.g., about 10-50 ng/ml, e.g., about 10-40 ng/ml, e.g., about 10-30 ng/ml, e.g., about 25 ng/ml.

As used herein, the term "heparin" refers to a glycosaminoglycan with anticoagulant properties, CAS No. 9005-49-6. According to a specific embodiment, the heparin used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of iTSC. Heparin can be obtained from various manufacturers such as Sigma- Aldrich, Baxter and Pharma Action.

According to some embodiments of the invention, heparin is provided at a concentration range from about 0.1 microgram per milliliter ^g/ml) to about 100 μg/ml, e.g., about 0.1-500 μg/ml, e.g., about 0.1-200 μg/ml, e.g., about 0.1-100 μg/ml, e.g., about 0.1-50 μg/ml, e.g. about 0.5-50 μg/ml, e.g., about 0.5-20 μg/ml, e.g., about 0.5-10 μg/ml, e.g., about 0.5-10 μg/ml.

According to some embodiments of the invention, the culture medium further comprising at least one additional agent selected from the group consisting of 2i inhibitors (MEK inhibitor PD 0325901 and GSK3 inhibitor CHIR 99021), activin, fgf2, and Tgfbl.

It will be appreciated that any of the proteinaceous factors used in the culture medium of some embodiments of the invention (e.g., FGF4) can be recombinantly expressed or biochemically synthesized. In addition, naturally occurring proteinaceous factors can be purified from biological samples (e.g., from human serum, cell cultures) using methods well known in the art. According to specific embodiments the culture medium comprises a conditioned medium. A conditioned medium is the growth medium of a monolayer cell culture (i.e., feeder cells) present following a certain culturing period. The conditioned medium includes growth factors and cytokines secreted by the monolayer cells in the culture.

According to specific embodiments, the culture medium is devoid of conditioned medium.

According to some embodiments of the invention, the culture medium is devoid of serum, e.g., devoid of any animal serum.

According to some embodiments of the invention, the culture medium is devoid of any animal contaminants, i.e., animal cells, fluid or pathogens (e.g., viruses infecting animal cells), e.g., being xeno-free.

According to some embodiments of the invention, the culture medium is devoid of human derived serum.

According to some embodiments of the invention, the culture medium further comprises serum replacement, such as but not limited to, KNOCKOUT™ Serum Replacement (Gibco-Invitrogen Corporation, Grand Island, NY USA), ALBUMAX®II (Gibco®; Life Technologies - Invitrogen, Catalogue No. 11021-029;

Lipid-rich bovine serum albumin for cell culture) or a chemically defined lipid concentrate (Gibco®; Invitrogen, Life Technologies - Invitrogen, Catalogue No. 11905-031).

According to specific embodiments, the culture medium is devoid of serum replacement.

According to some embodiments of the invention, the culture medium can further include antibiotics (e.g., PEN-STREP), L-glutamine, NEAA (non-essential amino acids).

According to a specific embodiment, the medium comprises RPMI, 20 % FBS, Glutamine, pyruvate, 25 ng/ml Fgf4 and lmg/ml Heparin.

In addition to the primary cultures of the isolated cells and/or the iTSC of the invention can be used to generate cell lines and/or iTSC lines which are capable of unlimited expansion in culture.

Cell lines of some embodiments of the invention can be produced by immortalizing the isolated cell and/or iTSCs by methods known in the art, including, for example, expressing a telomerase gene in the cells (Wei, W. et al., 2003. Mol Cell Biol. 23: 2859-2870) or co-culturing the cells with NIH 3T3 hph-HOXl l retroviral producer cells (Hawley, R.G. et al., 1994. Oncogene 9: 1-12).

According to an aspect of some embodiments of the invention there is provided a method of generating differentiated cells, comprising subjecting the iTSC of some embodiments of the invention to differentiating conditions, thereby generating the differentiated cells. Methods of differentiating iTSC into a particular cell type are known in the art and the present invention contemplates all such methods such as disclosed e.g. in Kidder (2014) Methods Mol Biol. 1150:201-12; Lei et al. Placenta. 2007 Jan;28(l): 14-21; Chen et al. (2013) Biochemical and biophysical research communications 431, 197-202; and Genbacev et al. (2011) Stem Cells 29, 1427-1436 and include culturing the cells in a medium devoid of GFG4 and heparin. The method may involve genetic modification of the cells and/or culturing of the cells in media comprising differentiating factors. It will be appreciated that the re-differentiating stage may result in the generation of fully differentiated cells or partially differentiated cells along a particular lineage.

According to specific embodiments of the invention, the iTSC of some embodiments of the invention can be used to isolate lineage specific cells.

As used herein, the phrase "isolating lineage specific cells" refers to the enrichment of a mixed population of cells in a culture with cells predominantly displaying at least one characteristic associated with a specific lineage phenotype. Thus for example an iTSC can be differentiated into any of the trophoblast cell lineages. Lineage specific cells can be obtained by directly inducing the expanded, undifferentiated iTSC to culturing conditions suitable for the differentiation of specific cell lineage by methods well known in the art. It will be appreciated that the culturing conditions suitable for the differentiation and expansion of the isolated lineage specific cells include various tissue culture medium, growth factors, antibiotic, amino acids and the like and it is within the capability of one skilled in the art to determine which conditions should be applied in order to expand and differentiate particular cell types and/or cell lineages. The invention, according to some embodiments thereof, contemplates the use of cells, tissues and organs generated from the iTSC of the invention using any differentiation protocol known in the art.

The isolated cells and constructs of the present invention may be further used for disease modeling, drug screening, and patient- specific cell-based therapy.

Thus, according to an aspect of the present invention, there is provided an isolated placenta or a blastocyst comprising the iTSC or the construct of the present invention.

According to another aspect of the present invention, there is provided a method of augmenting a placenta or a blastocyts comprising introducing into a placenta or a developing embryo the iTSC or the construct of the invention.

As used herein the term "developing embryo" refers to an embryo at any stage of development and includes an embryo at a 4-cell stage, 8- cell stage, 16- cell stage embryo, early morula, late morula, early blastocyst, and/or a late blastocyst.

Methods of in-vitro or in vivo administration of cells into a placenta of a developing embryo of an animal are well known in the art, such as in Gafni O, et al.

Nature. 2013 Dec 12;504(7479):282-6; and Manipulating the Mouse Embryo: A

Laboratory Manual, Fourth Edition. By Richard Behringer Marina

Gertsenstein Kristina Vintersten Nagy Andras Nagy, each of which is fully incorporated herein by reference, and are also disclosed in the materials and methods of the Examples section which follows.

According to some embodiments of the invention, introducing the cells is performed in vitro or ex vivo via direct injection or aggregation with the developing host placenta or embryo.

The iTCS and iTSC-derived cell preparations and the chimeric placentas may be used to prepare model systems for disorders associated with development and/or activity of trophoblasts, to screen for genes expressed in or essential for trophoblast differentiation and/or activity, to screen for agents or conditions (such as culture conditions or manipulation) that effect trophoblast differentiation and/or activity, to produce trophoblast specific growth factors and hormones and as a cell therapy for disorders associated with development and/or activity of trophoblasts. Consequently, the cell preparations and the chimeric placentas may be used to screen for potential agents that modulate trophoblast development or activity e.g. invasion or proliferation.

Thus, according to an aspect of the present invention, there is provided a method of identifying an agent capable of modulating trophoblast development and/or activity, the method comprising:

(ii) comparing development and/or activity of the isolated iTSC or the isolated placenta following said contacting with said agent to development and/or activity of said isolated iTSC or said isolated placenta without said agent,

wherein an effect of said agent on said development and/or activity of said isolated iTSC or said isolated placenta above a predetermined level relative to said development and/or activity of said isolated iTSC or said isolated placenta without said agent is indicative that said drug modulates trophoblast development and/or activity.

As used herein, the term "modulating" refers to altering trophoblast development and/or activity either by inhibiting or by promoting.

According to specific embodiments, modulating is inhibiting development and/or activity.

According to specific embodiments, modulating is promoting development and/or activity.

For the same culture conditions the effect of the candidate agent on trophoblast development and/or activity is generally expressed in comparison to the development and/or activity in a cell of the same species but not contacted with the candidate agent or contacted with a vehicle control, also referred to as control.

As used herein the phrase "an effect above a predetermined threshold" refers to a change in trophoblast development and/or activity following contacting with the compound which is higher than a predetermined threshold such as a about 10 %, e.g., higher than about 20 %, e.g., higher than about 30 %, e.g., higher than about 40 %, e.g., higher than about 50 %, e.g., higher than about 60 %, higher than about 70 %, higher than about 80 %, higher than about 90 %, higher than about 2 times, higher than about three times, higher than about four time, higher than about five times, higher than about six times, higher than about seven times, higher than about eight times, higher than about nine times, higher than about 20 times, higher than about 50 times, higher than about 100 times, higher than about 200 times, higher than about 350, higher than about 500 times, higher than about 1000 times, or more relative to the level of expression prior to contacting with the compound.

According to specific embodiments, the candidate agent may be any compound including, but not limited to a chemical, a small molecule, a polypeptide and a polynucleotide.

The cell preparations and the chimeric placentas derived from mutant animals can also be used to identify genes and substances that are important for the trophoblast development and/or activity. The isolated iTSC can also be modified by introducing mutations into genes in the cells or by introducing transgenes into the cells.

According to specific embodiments the selected agents may be further used to treat various conditions requiring regulation of trophoblast development or activity such as the conditions described below.

Recurrent miscarriage and fetal growth restriction (FGR) are associated with placental dysfunction and contribute to handicaps and in severe cases death. Cellular transplantation of intact and healthy TSCs holds great promise in the clinic as the transplanted cells might be able to rescue some of these fetuses by supporting the undeveloped/damaged placenta.

According to another aspect of the present invention, there is provided a method of treating and/or preventing a disorder associated with development and/or activity of trophoblasts in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the iTSC or the construct, thereby treating and/or preventing the disorder associated with development and/or activity of trophoblasts in the subject.

The terms "treating" or "treatment" refers to inhibiting, preventing or arresting the development of a pathology (e.g. recurrent miscarriage) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology. As used herein the phrase "subject in need thereof" refers to a mammalian subject (e.g., human being) who is diagnosed with the pathology. In a specific embodiment, this term encompasses individuals who are at risk to develop the pathology. Veterinary uses are also contemplated. The subject may be of any gender or at any age including neonatal, infant, juvenile, adolescent, adult and elderly adult. According to specific embodiments, the subject is a female.

This aspect of the present invention contemplated treating a disorder associated with development and/or activity of trophoblasts. According to specific embodiments, the disease is selected from the group consisting of recurrent miscarriage, Preeclampsia, Fetal Growth Restriction (FGR), hydatiform mole and choriocarcinoma.

As trophoblasts produce several secreted growth factors and hormones, according to another aspect of the present invention, there is provided a method of obtaining a compound produced by a trophoblast, the method comprising culturing the isolated iTSC or the iTCS cell culture of the present invention and isolating from the culture medium a compound secreted by the cells, thereby obtaining the compound produced by the trophoblast.

According to specific embodiments, the compound is a growth factor or a hormone, such as but not limited to human Chorionic Gonadotropin (hCG).

The cells or the nucleic acids of the present invention, may be transplanted to a subject per se, or in a pharmaceutical composition where they are mixed with suitable carriers or excipients. Similarly, the constructs of the present invention may be administered to a subject per se, or in a pharmaceutical composition.

As used herein a "pharmaceutical composition" refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients. The purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.

Herein the term "active ingredient" refers to the redifferentiated pancreatic cells of the present invention accountable for the biological effect.

Hereinafter, the phrases "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" which may be interchangeably used refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound. Herein the term "excipient" refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient. Examples, without limitation, of excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils and polyethylene glycols.

Pharmaceutical compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or lyophilizing processes.

Pharmaceutical compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations which, can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.

For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.

Typically, the pharmaceutical composition is administered in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a tissue region of a patient.

The pharmaceutical composition described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with optionally, an added preservative. The compositions may be suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.

Pharmaceutical compositions for parenteral administration include aqueous solutions of the active preparation in water-soluble form. Additionally, suspensions of the active ingredients may be prepared as appropriate oily or water based injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acids esters such as ethyl oleate, triglycerides or liposomes. Aqueous injection suspensions may contain substances, which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the active ingredients to allow for the preparation of highly concentrated solutions.

Pharmaceutical compositions suitable for use in context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a therapeutically effective amount means an amount of active ingredients (insulin producing cells) effective to prevent, alleviate or ameliorate symptoms of a disorder (e.g., diabetes) or prolong the survival of the subject being treated.

Determination of a therapeutically effective amount is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein.

For any preparation used in the methods of the invention, the therapeutically effective amount or dose can be estimated from animal models (e.g. STZ diabetic mice) to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.

Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in experimental animals. The data obtained from these animal studies can be used in formulating a range of dosage for use in human. The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl, et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. l).

Dosage amount and interval may be adjusted individually to provide cell numbers sufficient to induce normoglycemia (minimal effective concentration, MEC). The MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations of C peptide and/or insulin.

The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. Compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA approved kit, which may contain one or more unit dosage forms containing the active ingredient. The pack may, for example, comprise metal or plastic foil, such as a blister pack. The pack or dispenser advice may be a syringe. The syringe may be prepacked with the cells. The pack or dispenser device may be accompanied by instructions for administration. The pack or dispenser may also be accommodated by a notice associated with the container in a form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions or human or veterinary administration. Such notice, for example, may be of labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert. Compositions comprising a preparation of the invention formulated in a compatible pharmaceutical carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as if further detailed above.

Alternatively or additionally the present teachings are directed to a knock in reporter system that can be used to capture a reprogrammable iTSC or iPSC early in the conversion process as according to the following aspect.

Thus, according to another aspect of the present invention there is provided a nucleic acid construct or system comprising at least one polynucleotide comprising:

(i) a nucleic acid sequence encoding a first reporter polypeptide and a regulatory element for directing expression of said first reporter polypeptide, said regulatory element being under the control of a first early predictive marker of an induced trophoblast stem cell (iTSC) and/or induced pluripotent stem cells (iPSC);

(ii) nucleic acid sequence encoding a second reporter polypeptide and a regulatory element for directing expression of said second reporter polypeptide, said regulatory element being under the control of a second early predictive marker of an iTSC and/or iPSC;

(iii) a nucleic acid sequence encoding a third reporter polypeptide and a regulatory element for directing expression of said third reporter polypeptide, said regulatory element being under the control of a late predictive marker of an iTSC or iPSC, wherein said first reporter polypeptide, said second reporter polypeptide and said third reporter polypeptide are distinguishable.

According to specific embodiments, the construct comprising a nucleic acid sequence encoding a forth reporter polypeptide and a regulatory element for directing expression of said forth reporter polypeptide, said regulatory element being under the control of a late predictive marker of an iTSC or iPSC, wherein said first reporter polypeptide, said second reporter polypeptide, said third reporter polypeptide and said forth reporter polypeptide are distinguishable.

According to specific embodiments, the regulatory element of said third reporter polypeptide is under the control of a late predictive marker of an iTSC and said regulatory element of said forth reporter polypeptide is under the control of a late predictive marker of an iPSC.

According to specific embodiments, the reporter polypeptide comprises a detectable moiety. Various types of detectable moieties can be used in the present invention such as, but not limited, to those disclosed in Example 4 of the Examples section which follows. According to specific embodiment the detectable moiety is a translational product. These include, but not are limited to, a phosphorescent chemical, a hemiluminescent chemical such as luciferase and galactosidase, a fluorescent chemical (fluorophore) such as GFP, an enzyme, a fluorescent polypeptide, an affinity tag, and molecules (contrast agents) detectable by Positron Emission Tomagraphy (PET) or Magnetic Resonance Imaging (MRI).

Fluorescence detection methods which can be used to detect the expression of a fluorescent reporter polypeptide include, for example, fluorescent plate reader, fluorescence activated flow cytometry (FACS), immunofluorescence confocal microscopy, fluorescence in-situ hybridization (FISH) and fluorescence resonance energy transfer (FRET).

Non limiting example of a chemiluminescent chemical is luciferase. Chemiluminescent detection methods which can be used to detect the expression of a chemiluminescent moiety include, for example, luminescence plate reader.

Detection of the detectable moiety can be effected by methods and apparatuses well known in the art including, but not limited to flow cytometer, fluorescent plate reader and luminescence plate reader. Methods of designing and integrating the reporter polypeptide and a regulatory element for specific predictive marker are known in the art and include those described for example in Example 4 of the Example section which follows and targeted homologous recombination (e.g. "Hit and run", "double-replacement"), site specific recombinases (e.g. the Cre recombinase and the Flp recombinase), PB transposases (e.g. Sleeping Beauty, piggyBac, Tol2 or Frog Prince), genome editing by engineered nucleases (e.g. meganucleases, Zinc finger nucleases (ZFNs), transcription-activator like effector nucleases (TALENs) and CRISPR/Cas system) and genome editing using recombinant adeno-associated virus (rAAV) platform. Further description of preparation of expression vectors and modes of administering them into cells are provided hereinabove.

Expression of the reporter polypeptide is under the control of a predictive marker (e.g. early predictive marker of an iTSC and/or iPSC, late iTSC predictive marker or late iPSC predictive marker).

According to specific embodiments, the late predictive marker is an iTSC late predictive marker. According to specific embodiment, the iTSC late predictive marker is Elf 5.

According to specific embodiments, the late predictive marker is an iPSC late predictive marker. According to specific embodiment, the iPSC late predictive marker is Nanog.

According to specific embodiments, the early predictive markers are Utfl and

Esrrb.

According to an aspect of the present invention, there is provided an isolated cell comprising the construct encoding the reporter polypeptide of some embodiments of the invention.

The present invention also contemplates a transgenic animal comprising the isolated cell of this aspect of the present invention. Thus, according to specific embodiments, the transgenic animal is a primate.

According to some embodiments of the invention, the transgenic animal is not human.

According to other specific embodiments, the transgenic animal is a rodent. The cells containing the knock in reporter system can be used to capture a reprogrammable iTSC or iPSC early in the conversion process.

Thus, according to an aspect of the present invention, there is provided a method of identifying a reprogrammable iTSC or iPSC, the method comprising:

(i) obtaining the cell or a cell isolated from the transgenic animal of some embodiments of the invention; and

(ii) identifying the reprogrammable iTSC or iPSC based on the pattern of expression of said reporter polypeptides.

According to specific embodiments:

(i) expression of said reporter polypeptide under the control of said early predictive markers; and

(ii) expression of said reporter polypeptide under the control of said late predictive marker of iPSC and/or no expression of said reporter polypeptide under the control of said late predictive marker of iTSC,

is predictive of a reprogrammable iPSC.

According to other specific embodiments:

(ii) expression of said reporter polypeptide under the control of said late predictive marker of iTSC and/or no expression of said reporter polypeptide under the control of said late predictive marker of iPSC,

is predictive of a reprogrammable iTSC.

According to another aspect of the present invention, there is provided a method for producing induced pluripotent stem cells (iPSCs), the method comprising introducing into somatic stem cells at least one gene and culturing the cells with the introduced genes in a mES medium.

As used herein, the term "induced pluripotent stem cells" or "iPSC" refers to cells obtained by de-differentiation of cells which are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm). According to specific embodiments of the invention, such cells are obtained from a differentiated tissue (e.g., a somatic cell such as a fibroblast) and undergo de-differentiation by genetic manipulation which re- program the cell to acquire embryonic stem cells characteristics.

Generation of the iPSC according to the methods of some embodiments of the present invention can be combined with any method known in the art for generating an iPSC such as described for example in Yamanaka S, Cell Stem Cell. 2007, l(l):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008; IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008;451: 141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131 :861-872; Stadtfeld et al., 2008, Science 322, 945-949; and Okita et al., 2008, Science 322, 949-953; and International Application Publication No: WO2013159103] and include genetic manipulation of e.g. somatic cells, e.g., by retroviral transduction of e.g. somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c- Myc, and KLF4.

According to specific embodiments of this aspect of the present invention, the method comprising introducing at least two and preferably at least three genes.

According to specific embodiments of this aspect of the present invention, the method comprising introducing at least four genes.

According to specific embodiments of this aspect of the present invention, the method comprising introducing at least five genes.

According to specific embodiments of this aspect of the present invention, the at least two, at least three, at least four at least 5 at least 6 at least 7 or at least 8 genes are introduced to the somatic cell.

According to specific embodiments of this aspect of the present invention, the at least one introduced gene, sequence coding for gene product or protein product of the gene is a transcription factor.

According to specific embodiments of this aspect of the present invention, the transcription factor is a key master regulator being a transcription factor that is part of the core circuitry of the cells.

According to specific embodiments of this aspect of the present invention, the at least one introduced gene is discovered by: a) Cloning key master regulators (factors that contains large number of target genes) into delivery vehicles, preferably viruses,

b) introduction of the candidate genes into targeted cells,

c) selection for cells that exhibit epithelial/transformed morphology and acquire a stable state and express TSC marker genes as mentioned above.

According to specific embodiments of this aspect of the present invention, the introduced gene is discovered by the methods described in the Examples section which follows.

According to specific embodiments of this aspect of the present invention, the gene is selected from the group consisting of: Tfap2c, Tead4, Handl, Dppal, Gata3, Ets2, Elf5, Cdx2, Eomes, Myc, Utfl and Esrrb

According to specific embodiments of this aspect of the present invention, the gene is selected from the group consisting of Gata3, Tfap2c, Eomes, Tead4, Ets2, Cdx2 Esrrb, Myc.

According to specific embodiments of this aspect of the present invention, the introduced genes are at least one, at least two, at least three, at least four or all five of the genes selected from the group consisting of Gata3, Eomes, Tfap2c, Myc and Esrrb.

According to specific embodiments of this aspect of the present invention, the gene is selected from the group consisting of: Gata3, Tfap2c, Eomes, Myc and Esrrb.

According to specific embodiments of this aspect of the present invention, the gene is selected from the group consisting of Gata3, Tfap2c, Eomes and Myc.

According to specific embodiments of this aspect of the present invention, the gene is selected from the group consisting of Gata3, Tfap2c, Eomes.

According to another aspect of the present invention, there is provided a method of improving the quality of iPSCs the method comprising introducing to the somatic cells to be reprogrammed to form iPSC, genes validated (e.g. by the prior art) for reprogramming somatic cells into iPSC, and in addition at least one, at least two, at least three preferably all fours of genes selected from the group consisting of Gata3, Eomes, Tfap2c.

According to specific embodiments, the improvement in the quality is evident by shortening of times until the iPSCs form colonies. According to specific embodiments, the genes validating for reprogramming somatic cells to iPSC are Oct4, sox2, Klf4, Myc, Gata3, Tfap2c and Eomes.

A non-limiting example n genes validated already by research for reprogramming somatic cells to iPSC are Oct4, sox2, Klf4, Myc, Gata3, Tfap2c and Eomes.

According to specific embodiments, the somatic cell is a human cell.

According to specific embodiments, the somatic cell is selected from the group consisting of fibroblasts, blood cells (B -cells, T-cells Macrophage etc), keratinocytes, an epithelial cells e.g., a cell isolated from the oral cavity or a cell isolated from placenta.

According to specific embodiments, the introduction occurs by any viral vector, preferably by a viral vector selected from the group consisting of lenti, Adeno, Retro, episome,; by directed insertion of naked RNA, DNA or the protein product of the gene.

According to specific embodiments, the reprogramming is performed in the absence of eggs, embryos, embryonic stem (ES) cells or induced pluripotent stem cells (iPSCs).

According to specific embodiments, the medium comprises DMEM, 15% FBS, Glutamine, non essential amino acid, b-mercapto and LiF with or without the naive ground state inhibitors 2i condition (GSK3B inhibitor and MEK inhibitor).

Protocols for insertions, cells to be used, selection, growing medium and the like can be found in WO2013159103 inserted herein in its entirety by reference.

As used herein the term "about" refers to ± 10 %

The terms "comprises", "comprising", "includes", "including", "having" and their conjugates mean "including but not limited to".

The term "consisting of means "including and limited to".

The term "consisting essentially of" means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.

As used herein, the singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a compound" or "at least one compound" may include a plurality of compounds, including mixtures thereof. Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.

Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases "ranging/ranges between" a first indicate number and a second indicate number and "ranging/ranges from" a first indicate number "to" a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.

As used herein the term "method" refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.

When reference is made to particular sequence listings, such reference is to be understood to also encompass sequences that substantially correspond to its complementary sequence as including minor sequence variations, resulting from, e.g., sequencing errors, cloning errors, or other alterations resulting in base substitution, base deletion or base addition, provided that the frequency of such variations is less than 1 in 50 nucleotides, alternatively, less than 1 in 100 nucleotides, alternatively, less than 1 in 200 nucleotides, alternatively, less than 1 in 500 nucleotides, alternatively, less than 1 in 1000 nucleotides, alternatively, less than 1 in 5,000 nucleotides, alternatively, less than 1 in 10,000 nucleotides. It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.

Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.

EXAMPLES

Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.

Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, "Molecular Cloning: A laboratory Manual" Sambrook et al., (1989); "Current Protocols in Molecular Biology" Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., "Current Protocols in Molecular Biology", John Wiley and Sons, Baltimore, Maryland (1989); Perbal, "A Practical Guide to Molecular Cloning", John Wiley & Sons, New York (1988); Watson et al., "Recombinant DNA", Scientific American Books, New York; Birren et al. (eds) "Genome Analysis: A Laboratory Manual Series", Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; "Cell Biology: A Laboratory Handbook", Volumes I-III Cellis, J. E., ed. (1994); "Culture of Animal Cells - A Manual of Basic Technique" by Freshney, Wiley-Liss, N. Y. (1994), Third Edition; "Current Protocols in Immunology" Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), "Basic and Clinical Immunology" (8th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), "Selected Methods in Cellular Immunology", W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; "Oligonucleotide Synthesis" Gait, M. J., ed. (1984); "Nucleic Acid Hybridization" Hames, B. D., and Higgins S. J., eds. (1985); "Transcription and Translation" Hames, B. D., and Higgins S. J., eds. (1984); "Animal Cell Culture" Freshney, R. I., ed. (1986); "Immobilized Cells and Enzymes" IRL Press, (1986); "A Practical Guide to Molecular Cloning" Perbal, B., (1984) and "Methods in Enzymology" Vol. 1-317, Academic Press; "PCR Protocols: A Guide To Methods And Applications", Academic Press, San Diego, CA (1990); Marshak et al., "Strategies for Protein Purification and Characterization - A Laboratory Course Manual" CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.

MATERIALS AND METHODS

Cell culture and mice - M2rtTA C57BL/6, Sox2-GFP and Oct4-GFP mice were purchased from Jackson laboratory. The Oct4/lox system is described in (Kehler et al., 2004 EMBO reports 5, 1078-1083). Mouse embryonic fibroblasts (MEFs) and tail tip fibroblasts (TTFs) were isolated as previously described (Wernig et al., 2008). MEFs and TTFs were grown in DMEM supplemented with 10 % fetal bovine serum, 1 % non-essential amino acids, 2 mM L-Glutamine and antibiotics. Embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs, generated by the OSKM factors) were grown in DMEM supplemented with 10 % fetal bovine serum, 1 % non-essential amino acids, 2 mM L-Glutamine, 2X10⁶ units mLif, 0.1 mM β-mercaptoethanol (Sigma) and antibiotics with or without 2i-PD0325901 (PD, 1 μΜ), CHIR99021 (CH, 3 μΜ). Blastocyst-derived TSC lines were isolated as described by Oda et al. (Methods Enzymol (2006) 419, 387-400). All cells were maintained in a humidified incubator at

37 C and 5 % C0₂. For the primary infection, MEFs were isolated from 13.5 days post coitum (dpc) embryos that were generated by three different crosses: (1) M2rtTA mouse X Oct4-GFP mouse (2) M2rtTA mouse X Sox2-GFP mouse (3) M2rtTA mouse X Nanog-GFP mouse. All infections were performed on MEFs (passage 0) that were seeded at 70 % confluency two days before the first infection. Blastocyst-derived TSC lines were isolated as described (Oda et al., 2006). TSCs and iTSCs were grown in a combined medium containing 30 % RPMI and 70 % conditioned media (CM) supplemented with 20 % FBS, 1 % non-essential amino acids, 2 mM L-Glutamine, 25 ng / ml human recombinant FGF4 (PeproTech) and 1 μg / ml heparin (Sigma- Aldrich). During the reprogramming to iTSC, the cells were grown without CM and with the addition of 2 mg / ml doxycycline (hereinafter denoted as dox). For culture in defined medium, cells were grown on Matrigel-coated dishes in TX medium as described previously (Kubaczka et al., 2014). Identified iTSC colonies were picked under the binocular, trypsinized and cultured in one well of 6-well plate containing feeder cell layer. For differentiation experiments, medium without CM, FGF4, heparin and TGF-βΙ was used. MEFs were directly converted into cardio myocytes as previously reported (Efe et al., 2011). Beating colonies were visualized under an inverted microscope.

Molecular cloning and lentiviral infection - Dox-inducible embryonic trophoblast stem cell factors were generated by cloning the open reading frame of the factors, obtained by reverse transcription with specific primers (see Table 1 below), into the TOPO-TA vector (Invitrogen), and then restricted with EcoRI or Mfel and inserted into the FUW-teto expressing vector (Addgene). Replication-incompetent lentiviruses containing the embryonic trophoblast stem cell factors were packaged in 293T cells and collected 48, 60 and 72 hr after transfection. The supernatants were filtered through a 0.22 μιη filter, supplemented with 2 μg / ml of polybrene (Sigma) and then used to infect MEFs or TTFs.

Reprogramming in the present of JAKI - MEFs (passage 0, 70 % confluency) were infected with dox-inducible GETM lenti- viral vectors. To initiate the reprogramming process, the infected MEFs were cultured in TSC reprogramming medium containing dox (2 μg / ml) and JAKi (5 μΜ). Following 20 days of reprogramming, dox was removed from the medium. Three days later, JAKi was removed as well to allow proper stabilization of iTSC colonies. Ten days after dox removal (i.e., 7 days after JAKi removal), stable iTSC colonies were isolated and cultured on feeder cells.

Reprogramming in the absence of Oct4 - Two days prior to day 0, Sox2- GFP/Oct4 lox/lox MEFs (Kehler et al., 2004) were infected with dox-inducible GETM or with OS KM in combination with FUW-M2rtTA-2A-puro and FUW-Zeo-Cre or with FUW-Zeo-TetO empty vector. Starting on day 0, MEFs underwent 20 days of dox treatment, followed by 10 days without dox. Puromycin and Zeocin were added during the entire course of the experiment. Clones from all plates were picked on day 30 and genomic DNA was purified. Semi-quantitative PCR using primers for the recognition of Cre activity on Oct4 loxP sites, as described previously (Kehler et al., 2004) and primer pair C, producing a 245 bp fragment from floxed alleles and a 1455 bp fragment from non-floxed alleles were used to validate Oct4 looping. Note that only iTSC colonies with properly floxed alleles could be isolated. The very few iPSC colonies that emerged from the reprogramming process that contained the Cre plasmid, did not looped out Oct4 as depicted by the PCR reactions.

Direct conversion into cardiomyocytes - MEFs infected with dox- inducible OSKM or GTEM factors were exposed to reprogramming media containing JAK inhibitor (JAKi) for 6 or 10 days, followed by 3 days of dox withdrawal. Cells were then differentiated to cardiomyocytes by a chemically defined medium supplemented with BMP4 for 5 days, followed by 7 days of BMP4 withdrawal.

Immunocytochemistry - Cells were fixed in 4 % paraformaldehyde in PBS for 20 minutes, rinsed three times with PBS, blocked for 1 hour with PBS containing 0.1 % Triton X-100 and 5 % FBS, and incubated overnight in PBS containing 0.1 % Triton X- 100 and 1 % FBS with one of the following antibodies (1:200 dilution): anti-Esrrb (Perseus Proteomics, #PP-H6705-00), anti-Utfl (Abeam, ab24273), anti-Elf5 (Santa Cruz, SC-9645), anti-Cdx2 (Biogenex, CDX2-88), anti-Tnnt2 (Abeam, ab8295), anti- Krtl8 (Santa Cruz, SC-51582) and Anti-Acta2 (Abeam, ab5694). Following, the cells were washed three times with PBS and incubated for 1 hour in PBS containing 0.1 % Triton X-100 and 1 % FBS with the relevant (Alexa) secondary antibody (1:500 dilution). DAPI (1: 1000) was added for the last 10 minutes of incubation. The cells were washed three times with PBS and visualized under a fluorescence microscope (Nikon eclipse Ti). Quantitative real-time PCR - Total RNA was isolated using the Macherey- Nagel kit (Ornat). 500-2000 ng of total RNA was reverse transcribed using iScript cDNA Synthesis kit (Bio-Rad). Quantitative PCR analysis was performed in duplicates using 1/100 of the reverse transcription reaction in a StepOnePlus (Applied Biosystems) with SYBR green Fast qPCR Mix (Applied Biosystems). Specific primers flanking an intron were designed for the different genes (see Table 1 below).

RNA sequencing analysis - Total RNA was isolated using Rneasy Kit (QIAGEN) and sent to the "Technion Genome Center", Israel, for library preparation and sequencing. The raw and the processed data have assigned a GEO accession number: GSE64684.

Cleaning and filtering of raw reads - Raw reads (fastq files) were inspected for quality issues with FastQC

(v0.11.2,://www.bioinformatics.babraham.ac.uk/projects/fastqc/). According to the FastQC report, reads were then trimmed to a length of 50 bases with fastxjximmer of the FASTX package (version 0.0.13,www://hannonlab.cshl.edu/fastx_toolkit/), and quality-trimmed at both ends, using in-house perl scripts, with a quality threshold of 32. In short, the scripts use a sliding window of 5 base pairs from the read's end and trim one base at a time until the average quality of the window passes the given threshold. Following quality-trimming, adapter sequences were removed by Trim Galore (version 0.3.7, ://www .bioinformatics.babraham.ac.uk/projects/trim_galore/), using the command "trim_galore -a $adseq -length 15" where $adseq is the appropriate adapter sequence. The remaining reads were further filtered to remove very low quality reads, using the fastq_quality_filter program of the FASTX package, with a quality threshold of 20 at 90 percent or more of the read's positions.

Expression analysis - The cleaned fastq files were mapped to the mouse transcriptome and genome, Ensembl version GRCm38 from Illumina's iGenomes (://support.illumina.com/sequencing/sequencing_software/igenome.html), using TopHat (v2.0.11), allowing up to 3 mismatches and a total edit distance of 8 (full command: tophat -G Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.gtf -N 3 — read- gap-length 5 — read-edit-dist 8 —segment-length 18 — read-realign-edit-dist 5 — b2-i S, 1,0.75 -b2-mp 3,1 -b2-score-min L,-0.5,-0.5

Mus_musculus/Ensembl/GRCm38/Sequence/Bowtie2Index/genome clean.fastq). Quantification and normalization were done with the Cufflinks package (v2.2.1). Quantification was done with cuffquant, using the genome bias correction (-b parameter), multi-mapped reads assignment algorithm (-u parameter) and masking for genes of type IG, TR, pseudo, rRNA, tRNA, miRNA, snRNA and snoRNA (-M parameter). Normalization was done with cuffnorm (using output format of Cuffdiff).

Visualization - The R package cummeRbund (version 2.8.2) was used to calculate and draw the figures (such as scatter plots, MA plots, etc.) from the normalized expression values.

Methylation analysis - The bisulfite treatment of genomic DNA was performed using the EZ-DNA methylation Gold kit (Zymo Research) according to the manufacturer's instructions. Primer sequences for Elf5 (Ng et al., 2008) and Nanog (Hattori et al., 2007) were used as previously described. Amplified products were purified using a gel clean-up system (Macherey-Nagel), cloned into the pMini vector (New England Biolabs), and sequenced using pMini forward primers. CpG methylation was analyzed using Sequencer software. For each promoter sequence, ten randomly selected clones were sequenced.

ChlP-Sequencing and data analysis pipeline for H2A.X deposition analysis - Native chromatin immunoprecipitation (N-ChIP) assay was performed as previously described (Xiao et al. 2009). 10 millions of ESCs, MEFs or TSCs were used for each ChIP and massive parallel sequencing (ChlP-Seq) experiment. Cell fractionation and chromatin pellet isolation were performed as described (Xiao et al. 2009). Chromatin pellets were briefly digested with MNase (New England BioLabs) and the mononucleosomes were monitored by electrophoresis. 5 μg anti-H2A.X antibodies (generated by Xiao lab) were used per ChIP experiment. Co-purified DNA molecules were isolated and quantified (100-200 ng for sequencing). Co-purified DNA from ChIP and whole cell extraction (WCE) input genomic DNA were subjected to library construction, cluster generation and next-generation sequencing (Illumina HiSeq 2000). The output sequencing reads were filtered and pre-analyzed with Illumina standard workflow. After filtration, the qualified tags (in fastq format) were aligned to the mouse genome (mm9) with bowtie2 (Langmead et al. 2009); only the tags with unique alignment and contained less than one mismatch were kept for the downstream analyses. Following, these aligned reads were used for peak calling with the RSEG algorithm (0.4.8) (Song and Smith, 2011). The ChlP-Seq reads of endogenous TSC^endo#l (parental cells) were used as baseline for H2A.X deposition to run the RSEG (mode 3). Output results were filtered according to the enrichment scores and domain size (between 5kb to 200kb). Output results were filtered according to the enrichment scores and domain size mentioned above.

Cell Cycle Analysis - iTSCs grown in differentiation media for the indicated time points were trypsinized and fixed with 95 % ice-cold ethanol. Cells were stained in propidium iodide (PI) staining solution (50 μg / ml PI [BD]; 0.1 % [v/v] Triton X-100 [Sigma- Aldrich]; 0.2 mg / ml RNaseA [Sigma- Aldrich] in PBS) for 30 minutes at room temperature. Flow cytometry analysis of the stained cells was performed on a Beckman Coulter and analyzed using Kaluza Software.

Hemorrhagic lesion formation - A total of 5 x 10⁶ iTSCs were re-suspended in 100 μΐ CM containing FGF4 and were injected subcutaneously into male athymic nude mice. 7 days following infection, lesions were dissected, fixed overnight in 4 % paraformaldehyde, embedded in paraffin, and sectioned (4 μιη). Sections were stained with hematoxylin and eosin and analyzed by a certified pathologist.

Karyotyping and SCE analyses - Single cell sorting: For Strand-seq (mESCs, MEFs, endogenous TSCs and iTSCs) were cultured in the presence of 40 μΜ BrdU during approximately one cell division (12 hours for ESCs, 24 hours for MEFs and 18 hours for TSCs). Cells were harvested and suspended in nuclei isolation buffer (100 mM Tris-HCl pH 7.4, 150 mM NaCl, 1 mM CaCl₂, 0.5 mM MgCl₂, 0.1 % NP-40, 0.2 % BSA). Nuclei were washed and re- suspended in isolation buffer supplemented with Hoechst-33258 and PI (10 μg / ml each). Nuclei were sorted based on low Hoechst (quenching by presence of BrdU in DNA) and PI (Gl phase) fluorescence. For whole-genome sequencing, nuclei from untreated cells were isolated and stained with PI (10 μg / ml) to sort Gl phase nuclei. All nuclei were sorted into 96-well skirted PCR plates (4Titude) containing 5 μΐ_^ freeze medium (Pro-Freeze CDM Freeze Medium (Lonza) containing 15 % DMSO) using a MoFLo Atrios sorter (Beckman Coulter).

DNA fragmentation and library construction: DNA fragmentation and library construction were performed as previously published (Falconer et al., 2012), with the following modifications. All enzymatic reactions were performed using the Bravo Liquid Handling Platform (Agilent). Reaction volumes were reduced while enzyme and buffer concentrations were kept constant. All DNA purification steps were performed using AMPure XP magnetic beads (Agencourt AMPure, Beckman Coulter). A double purification using a 1.2x volume of beads was performed after adapter ligation and the PCR reactions consisted of 17 cycles. For Strand-seq, nascent DNA strands were nicked using Hoechst + UV treatment prior to PCR.

Illumina sequencing: Libraries were pooled for sequencing and 270- to 320-bp sized fragments were purified using 2 % E-Gel Agarose gels (Invitrogen). DNA quality was assessed and quantified on a High Sensitivity dsDNA kit (Agilent) on the Agilent 2100 Bio-Analyzer and on the Qubit 2.0 Fluorometer (Life Technologies). For sequencing, clusters were generated on the CBot (Illumina) and single-end 50 bp reads were generated using the HiSeq2500 sequencing platform (Illumina).

Bioinformatics analysis: Sequencing reads were demultiplexed and subsequently aligned to the mouse reference genome (assembly GRCm38/mmlO) using Bowtie2 (version 2.0.5, Langmead and Salzberg, 2012). Indexed and aligned bam files were further analyzed as previously described (Falconer et al., 2012) using the BAIT software package (Hills et al., 2013). Sister chromatid exchanges were flagged by the BAIT software and confirmed visually. Aneuploidies were identified as chromosomes showing more than 1.3x (trisomy) or less than 0.7x (monosomy) coverage compared to the average coverage in that single cell library.

Chimeric embryo or placenta formation - Blastocyst injections were performed using CB6F1 host embryos. After priming with Pregnant mare's serum gonadotropin (PMSG) and Human Chorionic Gonadotropin (hCG) hormones and mating with CB6F1 males, embryos were obtained at 0.5 dpc (1-cell stage) or 3.5 dpc (blastocyst stage). Embryos were cultured in Evolve® KSOMaa (Zenith Biotech, Guilford, CT) until 8-cell stage or blastocysts were formed. 8-cell stage or blastocysts were injected with ESCs or iTSCs with a flat tip microinjection pipette with an internal diameter of 16 μιη (Origio Inc, Charlottesville, VA) in drop of Evolve® w/HEPES KSOMaa (Zenith) medium under mineral oil. Each 8-cell stage embryo or blastocyst was injected with 10-20 ESCs or iTSCs. Shortly after injection, blastocysts were transferred to 2.5 dpc pseudopregnant CD1 females (20 blastocysts per female). 8-cell stage embryos were grown in Evolve® KSOMaa (Zenith Biotech, Guilford, CT) until the blastocyst stage and then also transferred to 2.5 dpc pseudopregnant CDl females. Chimeric embryos or placentas were isolated at embryonic day (E) 13.5.

Table 1: Primers list

SEQ ID NO: Gene Primers

1 Cdx2 F- 5' CACTTTAGTCGATACATCACCATC 3'

2 R- 5' GATTTTCCTCTCCTTGGCTCT 3'

3 Elf5 F- 5' GGACCGATCTGTTCAGCAAT 3'

4 R- 5' GGGTGCACTGATGTCCAGTA 3'

5 Tfap2c F- 5' CAGGTCACTCTCCTCACGTC 3'

6 R- 5' C AGCTTCGC AG AC AT AGGC3 '

7 Nanog F- 5' AAACCAGTGGTTGAAGACTAGCAA 3'

8 R- 5' GGTGCTGAGCCCTTCTGAATC 3'

9 Oct4 F- 5' GCTTGGGCTAGAGAAGGATGTG 3'

10 R- 5' TGGCGCCGGTTACAGAAC 3'

11 Dppa3 F- 5' TCGGATTGAGCAGAGACAAAAA 3'

12 R- 5' TCCCGTTCAAACTCATTTCCTT 3'

13 Thyl F- 5' CGAATCCCATGAGCTCCAAT 3'

14 R- 5' CCAGCTTGTCTCTATACACACTGATA 3'

15 Col5a2 F- 5' TAGAGGAAGAAAGGGACAAAAAGG 3'

16 R- 5' GTTACAACAGGCACTAATCCTGGTT 3'

17 Postn F- 5' ACAACAATCTGGGGCTTTTT 3'

18 R- 5' AATCTGGTTCCCATGGATGA 3'

19 Cgn F- 5' ACCCGAAAAATGGAGGAACT 3'

20 R- 5' CAACCCTGGATGGTTCTAGC 3'

21 Krtl8 F- 5' GATTGAGGAGAGTACCACAGTTGTCA 3'

22 R- 5' TCCCTGATTTCGGCAGACTT 3'

23 Twist F- 5' AGCGGGTCATGGCTAACG 3'

24 R- 5' GGACCTGGTACAGGAAGTCGA 3'

25 Snail F- 5' TGCTGACCGCTCCAACCT 3'

26 R- 5' CTTCACATCCGAGTGGGTTTG 3'

27 Snai2 F- 5' ATCCTCACCTCGGGAGCATA 3'

28 R- 5' TGCCGACGATGTCCATACAG 3'

29 Des F- 5' TGG AGCGTG AC AACCTGAT A3 '

30 R- 5' AAGGCAGCCAAGTTGTTCTC3'

31 Esrrb F- 5' CACCTGCTAAAAAGCCATTGACT 3'

32 R- 5' CAACCCCTAGTAGATTCGGAGCGAT 3'

33 Utfl F- 5' GTCCCTCTCCGCGTTAGC 3'

34 R- 5' GGCAGGTTCGTCATTTTCC 3'

35 Handl F- 5' TC AA A AAG ACGG ATGGTGGT3 '

36 R- 5' GCGCCCTTTAATCCTCTTCT 3'

37 Tead4 F- 5' GCACCATTACCTCCAACGAG 3'

38 R- 5' GATCAGCTCATTCCGACCAT 3'

39 Sall4 F- 5' AACATATGCGGGCGGGCCTTCA 3'

40 R- 5' CCAGGAGGCGGGGTCCACACTC3' Sox2 F- 5' GCGGCGG A A A ACC A AG A3 '

R- 5' CCGGGAAGCGTGTACTTATCC3'

Gata3 F- 5' ATGAAACCGAAACCCGATGG 3'

R- 5' TTCAC AGC ACTAG AG AG ACC3 '

Eomes F- 5' CGGCAAAGCGGACAATAACA 3'

R- 5' GGAGCCAGTGTTAGGAGATTC 3'

Myc F- 5' GACTCTGAAGAAGAGCAAGAAGATGA 3'

R- 5' TCCACAGACACCACATCAATTTC 3'

Ets2 F- 5' GGAATCAAGAACATGGACCAA 3'

R- 5' AGCCATCGAAGGTGTCAAAG 3'

Gapdh F- 5' ACCTGCCAAGTATGATGACATCA 3'

R- 5' CCCTCAGATGCCTGCTTCAC 3'

Zebl F- 5' CCAGGTGTAAGCGCAGAAAG 3'

R- 5' TCATCGGAATCTGAATTTGCT 3'

Foxc2 F- 5' AGAACAGCATCCGCCACAAC 3'

R- 5' GCACTTTCACGAAGCACTCATT 3'

Gsc F- 5' GTCAGAAAACGCCGAGAAGTG 3'

R- 5' TCCGGCGAGGCTTTTGA 3'

Cdhl F-5' AGCTGCCCCGAAAATGAAA 3'

R- 5' GATCTGAACCAGGTTCTTTGGAAA 3'

Cdh2 F- 5' GGCGTCTGTGGAGGCTTCT 3'

R- 5' GGAAATCCAGTCTTGCATAATGC 3'

Dsp F- 5' ACCGTCAACGACCAGAACTC 3'

R- 5' TTTGCAGCATTTCTTGGATG 3'

Mmp3 F- 5' ATCCCACATCACCTACAGGATTG 3'

R- 5' TGTCTTGGCAAATCCGGTGT 3'

Ocln F- 5' GGCCTTTTGAAAGTCCACCT 3'

R- 5' CATGTCATTGCTTGGTGCAT 3'

Fnl F- 5' AGAGGCAGGCTCAGCAAA 3'

R- 5' TGCTTCCCATTGTCAAAACA3'

Cldnl F- 5' CGACTCCTTGCTGAATCTGA 3'

R- 5' CCAGCAGGATGCCAATTA 3'

Ctsq F- 5' AGGCTATGTGACTCGTGTGA 3'

R- 5' GGCACCAGTCACAGGAAAAG 3'

PrDbl F- 5' CCAGAAAACAGCGAGCAAGT 3'

R- 5' CCAGGCTTGTAAAATAGTGATGG 3'

Prl2c2 F- 5' GCCGGCAGTTTGTCTCATAA 3'

R- 5' TGAGCCCGAGCACGTTAGAA 3'

Tpbpa F- 5' GCTATAGTCCCTGAAGCGCA 3'

R- 5' ACTCCACACTGCTTTTATGAGA 3'

Prl3dl F- 5' GCCGCAGATGTGTATAGGGA 3'

R- 5' AGGGGAAGTGTTCTGTCTGT 3'

Gca F- 5' CTGACAGCTACTCCCCTGC 3'

R- 5' CAGCTCATGATGTTCTACTGTGCC 3'

. , transgenic F- 5' TGTCCATTCAAGCAGACGAG 3'

Myc ^e

Table 2: Summary of the various tests and the examined TSC and iTSC clones.

EXAMPLE 1

GENERATION OF INDUCED TROPHOBLAST STEM CELL-LIKE CELLS (iTSCs) FROM FIBROBLASTS BY EXTOPIC EXPRESSION OF KEY

MASTER REGULATORS

Inter-conversion between adult cells from ontogenetically different lineages by the transdifferentiation/direct conversion approach mostly generates cells with incomplete reprogramming state that are dependent either partially or fully by their exogenous factors. In contrast, iPSCs exhibit a stable state and transgene-independent growth and function. This raises the question whether the ability to reach a stable state and a high degree of nuclear resetting is a unique property of pluripotent cells. The present inventors hypothesized that key master regulators that control early embryonic development might have this unique characteristic as well, even if they are not expressed in pluripotent cells. To test this hypothesis, fibroblasts were converted into induced trophoblast stem cell-like cells (iTSCs), which are the embryonic precursors of the placenta and therefore also have a high therapeutic potential in treating placental dysfunction diseases. To convert fibroblasts into iTSCs, transcription factors with a known role in the development of the trophoblast lineage and in reprogramming at large were screened for. Twelve TSC transcription factors (hereinafter 12 factors or 12F): Tfap2c, Tead4, Handl, Dppal, Gata3, Ets2, Elf5, Cdx2, Eomes, Myc, Utfl and Esrrb were cloned into doxycycline (dox) -inducible lentiviral vectors and then were used to infect mouse embryonic fibroblasts (MEFs) to initiate the conversion process (Figure 1). To select for stable clones (i.e., colonies that can grow and maintain their characteristics for prolonged culture time without expression of the exogenous factors) dox was removed from the medium 20 days following infection. As can be seen in Figure 1, 10 days post dox withdrawal, epithelial colonies with TSC-like morphology appeared in the dish. Five 12F-iTSC clones were isolated for further characterization. First, all isolated clones grew on mitomycin-c-treated MEFs, and similarly to freshly isolated blastocyst-derived TSCs, could be weaned from feeder cells following 5-10 passages. Second, to examine whether the cells activated their endogenous TSC circuitry, the mRNA and protein level of several well-known TSC markers were measured. Importantly, as demonstrated in Figures 2A-B, all isolated colonies exhibited TSC-like morphology, expressed high mRNA levels of the TSC markers: Elf 5, Cdx2, Esrrb, Utfl, Tead4 and Handl and a high protein level of Esrrb, Utfl, Cdx2, and Elf 5. Moreover, when Fgf4 and heparin were removed from the medium, the cells differentiated into multinucleate giant cell-like cells (Figure 3).

In the next step, the present inventors aimed at narrowing down the number of transcription factors (i.e. transgenes) needed for the conversion process. To this end, the five 12F-iTSC colonies were analyzed for their transgene integrations by quantitative real time PCR (qRT-PCR) (Figure 4). Factors that are present in all iTSC clones are the most essential ones and considered as "indispensible factors" for the fibroblasts into iTSCs reprogramming process. As can be seen in Figure 4, 3 factors, Gata3, Tfap2c and Eomes, were present in all clones analyzed. In accordance, ectopic expression of Gata3, Tfap2c and Eomes (hereinafter denoted as 3 factors, 3F or GET) was sufficient to generate iTSCs from MEFs from mice with mixed C57BL/6 x 129 background (Figure 5).

As Myc was shown to be a global gene amplifier in ESCs, in cancer and during reprogramming (Lin et al., 2012; Nie et al., 2012; Soufi et al., 2012), Myc was added to the reprogramming cocktail to boost the conversion rate. Indeed, ectopic expression of Myc together with the three TSC key factors, Gata3, Eomes and Tfap2c (hereinafter denoted as 4 factors, 4F or GETM), facilitated the reprogramming process (Figures 5 and 6). To measure reprogramming efficiency, MEFs harboring a GFP reporter in Sox2 (the endogenous locus of the TSC/ESC marker, Adachi et al., 2013) were infected with either GET or GETM. While GET produced an average of 112 Sox2-GFP-positive colonies per 3X10⁵ seeded cells after 20 days of dox addition followed by 10 days of dox withdrawal, GETM produced approximately two fold more Sox2-GFP-positive colonies (an average of 196 colonies) (Figure 7). Since more cells could initiate proliferation following Myc addition (Figure 8), it is suggested that one of its main effects in boosting the reprogramming to iTSCs process is by overcoming contact inhibition and senescence. All isolated clones from GET (3F) and GETM (4F) grew for several passages under standard TSC culture conditions and could be weaned from feeder cells following 5-10 passages under recently published defined medium and culture conditions (Kubaczka et al., 2014), Figure 5 lower panel) and exhibited a correct composition of transgenes in their genome (Figure 9) with non or minor leaky expression of the transgenes (Figure 10). iTSC clones were also generated from inbred strains such as C57BL/6 (Figure 12) and adult tail tip fibroblasts (TTFs) expressing the ESC and TSC marker, Sox2 ((Adachi et al., 2013), Figure 13). Importantly, while the Sox2-GFP reporter was highly activated in iTSC clones, the pluripotent reporter Oct4- GFP remained silent (Figure 14). FACS analysis of Sox2-GFP-positive cells on one representative Sox2-GFP 4F-iTSC clone (4F-iTSC^{Sox2 GFP}#l) that grew either on feeder under standard TSC culture conditions or on matrigel under defined culture conditions revealed a highly homogenous expression of the Sox2 protein (83.4 % and 98.9%, respectively, Figure 11). Analyzing the mRNA expression levels of various genes in the generated iTSC clones showed that the expression of TSC-specific genes, Cdx2, Elf5, Tfap2c, Ets2, Tead4 and Eomes was comparable between various iTSC clones and two freshly isolated blastocyst-derived TSC lines (Figures 15). Moreover, the mRNA expression levels of pluripotent- specific genes, Nanog, Oct4 and Dppa3, and the expression of fibroblast-specific genes, Thyl, Col5a2, and Postn was absent in all examined iTSC clones and blastocyst-derived TSCs (Figure 15).

To conclude, eighteen 3F-iTSC clones and twenty four 4F-iTSC clones were isolated and cultured with reprogramming efficiency typically ranging between 0.01- 0.1% of the starting population. The results suggest that the introduction of Gata3, Tfap2c and Eomes into somatic cells generates stable colonies that can be maintained in culture independently of their exogenous factors and are similar in their morphology and TSC-specific marker expression to blastocyst-derived TSCs. EXAMPLE 2

MESENCHYMAL-TO-EPITHELIAL (MET) IS AN EARLY PHENOMENON DURING GENERATION OF iTSCs FROM FIBROBLASTS BY EXTOPIC

EXPRESSION OF KEY MASTER REGULATORS

Mesenchymal-to-epithelial transition (MET) is an essential process that contributes to the formation of many tissues during embryonic development (Chaffer et al., 2007) and is initiated early on during the conversion of fibroblasts into epithelial cells such as iPSCs and Sertoli cells (Buganim et al., 2013; Buganim et al., 2012b; Polo and Hochedlinger, 2010). However, while MET is vital for the reprogramming process, it cannot mark the rare reprogrammable cell population as the vast majority of the induced cells in the culture undergo MET (Buganim et al., 2012a). Since TSCs are epithelial cells, the time point during the conversion process the induced fibroblasts undergo MET was examined. To this end, the morphology of the induced cells was monitored for 8 days following concomitant expression of Gata3, Eomes, Tfap2c and Myc (GETM). To clearly observe the morphology of the induced cells overtime the cells were plated at low density. As can be seen in Figure 16A, a morphological change was already observed 2 days following dox exposure. At days 4, 6, and 8 a large number of epithelial cells appeared in the plate due to increased proliferation, suggesting that MET is an early event in the reprogramming process to iTSCs with GETM. In contrast, when fibroblasts were infected with GET, fewer colonies developed in the plate and clear and large epithelial colonies could be seen only on day 12 of dox exposure, suggesting a less prominent MET process (Figure 16B).

To investigate how Gata3, Tfap2c, Eomes and Myc initiate MET, the mRNA levels of several key genes that were shown to play a major role in the opposite process, epithelial-to-mesenchymal transition (EMT) was monitored (Figures 16C). As can be seen in Figure 17, a substantial downregulation of key EMT genes such as, Twistl, Zeb2, Snai2, Foxc2, Gsc, Mmp3 and Snail was noted already 1 day following factor induction and remained low for the first 8 days in culture. In accordance with that, a sharp decrease was observed in mesenchymal markers such as Cdh2, Des, Fnl and Cldnl and a gradual elevation in epithelial markers such as Cdhl, Krtl8, Dsp and Ocln (Figure 18A). The same trend was also observed with GET factors but to a much lesser extent (Figure 18B), suggesting that Myc contributes to the induction of the MET process. This is in agreement with a previous study demonstrating that Myc alone is sufficient to downregulate mesenchymal markers (Sridharan et al., 2009). Upregulation of the epithelial marker Krtl8 and Cdhl, and downregulation of the mesenchymal marker Acta2, was also detected at the protein level (Figure 19). Notably, while the levels of upregulated epithelial markers such as Cdhl and Dsp, and downregulated mesenchymal markers such as Foxc2, Fnl, and Mmp3, were similar between ESCs and TSCs, the expression levels of the epithelial markers, Krtl8 and Ocln, and the mesenchymal markers, Twistl, Zeb2, Cdh2 and Snail, were similar between TSCs and induced cells and different from ESCs.

These results suggest that MET is an early and robust phenomenon occurring during the conversion to iTSCs that cannot serve as a predictive marker for cells destined to become iTSCs and that the ectopic expression of GET or GETM in mesenchymal cells induces epithelial morphology with characteristics resembling blastocyst-derived TSCs.

EXAMPLE 3

CHARACTERIZATION OF THE GENERATED iTSCs iTSCs exhibit similar transcriptome and karyotype as that of blastocyst-derived TSCs

One indication for a stable conversion and a high degree of nuclear reprogramming state is the capability of the induced cells to activate their endogenous circuitry (Buganim et al., 2013). Proper activation of the endogenous circuitry should be reflected in the transcriptome of the cells. Abnormal activation of the endogenous circuitry will lead to an aberrant transcriptional profile that will be only partially similar to the transcriptome of their corresponding cells (Cahan et al., 2014; Morris et al., 2014). Indeed, in the vast majority of the direct conversion models, the endogenous circuitry was not activated properly and the cells expressed only a fraction of the markers/genes that characterize the corresponding cells.

To assess whether the isolated iTSC clones activate their endogenous circuitry and express a similar transcriptome to that of the blastocyst-derived TSCs, several clone samples were subjected to RNA-sequencing (RNA-Seq) analysis. Specifically, the transcriptional profiles of six iTSC clones: 3F-iTSC#3, 3F-iTSC^B6#4, 4F-iTSC#l, 4F- iTSC#3, 12F-iTSC#4 and 12F-iTSC#5 were probed and compared to the transcriptome of two blastocyst-derived TSC clones, TSC^blast#1, TSC^blast~B6#1. The transcriptome of the parental MEFs and ESCs were monitored as negative controls. As can be seen in Figure 20A, the various iTSC clones clustered together with the blastocyst-derived TSC clones and were far away from the MEF and ESC controls, as indicated by hierarchical clustering analysis. Importantly, one of the blastocyts-derived TSC lines, TSC^blast#l, clustered closer to the three induced TSC clones, 4F-iTSC#l, 3F-iTSC#3, 3F-iTSC#4 than to the other blastocyst-derived TSC line, TSC^{blast B6}#l (Figure 20A). Principle component analysis (PC A) (Figure 20B), scatter plots (Figure 20C) and an unbiased clustering heatmap of the top 10,000 expressed genes (Figure 20D) confirmed the results obtained by the hierarchical clustering analysis and demonstrated a highly similar gene expression pattern between blastocyst-derived TSCs and iTSCs.

It has been shown that stress induced by oncogenes such as Myc lead to DNA damage that promotes genomic instability and tumor progression (Vafa et al., 2002). Since the conversion to iTSCs is a long process that involves the expression of oncogenes, the possibility that the iTSC clones acquire genomic aberrations in the course of the reprogramming process was evaluated. To this end, the chromosomal content of iTSC clones was examined by whole genome single-cell sequencing and compared with blastocyst-derived TSC clones, MEF and ESC controls. Single-cell sequencing libraries were made from nine cell lines: ESCs, parental MEFs, three 3F- iTSC clones (3F-iTSC#l, 3F-iTSC#3 and 3F-iTSC^B6#4), two 4F-iTSC clones (4F- iTSC#l and 4F-iTSC#5), and two blastocyst-derived TSC clones (TSC^blast#1, TSC^blast" ^B6#1), that were cultured for at least 20 passages. As shown in Figure 21A, a larger number of chromosomal aberrations was noticed in all TSC lines compared to the MEF and ESC controls, however, the iTSC clones exhibited a comparable extent of abnormal chromosomal content to the two blastocyst-derived TSC lines. This result suggests that the reprogramming process per se, or the transient expression of TSC reprogramming factors, did not lead to an increased number of genomic aberrations.

DNA rearrangements such as sister chromatid exchanges (SCEs) are sensitive indicators of genomic stress and instability, and as such, SCEs was mapped in seven lines using Strand-seq (Falconer et al., 2012). Analysis of average SCE rates in all seven cell lines showed no significant differences between any of the cell types (Figures 21B-C). Taken together, the results suggest that iTSCs resemble blastocyst-derived TSCs in their transcriptome and genomic stability.

iTSCs exhibit a methylation pattern and H2A.X deposition comparable to blastocyst- derived TSCs

A high level of nuclear resetting refers to the erasure of all epigenetic marks

(such as loci-specific DNA methylation) of the parental somatic cell and to the remodeling of a new epigenome that is similar to the corresponding cell type.

To test whether the iTSCs acquired epigenetic marks that are specific to TSCs, the DNA methylation status of one TSC-specific locus, the Elf5 promoter, and one ESC-specific locus, the Nanog promoter, were determined by bisulfite sequencing. The genomic DNA of two iTSC clones (3F-iTSC#3 and 4F-iTSC#l), two blastocyst-derived TSC clone (TSC^blast#l and TSC^blast"B6#l), the parental MEFs and ESCs were subjected to bisulfite conversion and the specific loci were sequenced. As can be seen in Figure 22, while the TSC-specific locus, the Elf5 promoter, exhibited robust hypomethylation in all examined iTSC clones and in blastocyst-derived TSCs, it remained hypermethylated in the ESC and MEF controls. In contrast, the ESC-specific locus, the Nanog promoter, was hypomethylated only in the ESC control sample and was hypermethylated in all iTSC lines and in blastocyst-derived TSCs (Figure 22). These results suggest that the iTSCs acquire a new methylation status that is comparable to blastocyst-derived TSCs as assessed by two pivotal TSC and ESC loci.

Several loci have been suggested to act as gatekeepers in the trans- differentiation of mESCs to TSC-like cells upon manipulation of lineage-determining transcription factors such as Cdx2 and Oct4 (Cambuli et al., 2014). These regions exhibited a higher methylation status and lower gene expression in all trans- differentiation models as compared to blastocyst-derived TSCs. Thus, the expression level of these genes in various iTSC clones was determined. As shown in Figure 23, although some variation in gene expression was noticed in a number of genes, the overall gene expression was comparable between the various iTSC clones and the two blastocyst-derived TSCs. Variation in gene expression was also observed in the two blastocyst-derived TSCs (Figure 23) and in other differentially methylated regions between different ESC lines and various iPSC clones (Buganim et al., 2014). Importantly, it was shown before that variation in gene expression and specific methylation did not correlate with iPSC quality as assessed by the tetraploid complementation assay (Buganim et al., 2014).

Methylation analysis of one representative locus, the Handl promoter, revealed a robust hypomethylation in blastocyst-derived TSC and iTSC lines compared to MEF control (Figure 22). Interestingly, hypomethylation was also observed in ESC, suggesting that the Handl promoter region (-110 to +40) is not ideal for discriminating between the methylation status of ESC and TSCs.

Genome-wide organization of histone variant H2A.X is cell type-dependent. Abnormal H2A.X deposition is frequently observed in iPSC clones generated by OSKM factors that failed to support "all-iPSC" mice development in tetraploid complementation experiments (Wu et al., 2014). In contrast, iPSCs that are generated with other reprogramming factors, such as, Sall4, Nanog, Esrrb and Lin28 (SNEL), support the development of "all-iPSC" mice and show normal H2A.X deposition (Buganim et al., 2014), suggesting that H2A.X deposition can faithfully predict the quality of the converted cells. Thus, the genome-wide H2A.X deposition patterns of the iTSC clones was determined and compared to those of blastocyst-derived TSCs. Specifically, ChlP-seq for H2A.X was effected on two 3F-iTSC clones (3F-iTSC#l and 3F-iTSC^B6#4), two 4F-iTSC clones (4F-iTSC#l and 4F-iTSC#4) and two blastocyst- derived TSC clones (TSC^blast#l and TSC^blast"B6#l). The distribution of H2A.X in mESCs and the parental MEFs was monitored as controls. An established Hidden- Markov-Model (HMM) algorithm (Song and Smith, 2011) was used to interrogate the differential H2A.X deposition regions in these cells. As shown in Figures 24A-B, H2A.X deposition patterns in all examined iTSC clones closely resembled blastocyst- derived TSC clones and were significantly different (P < l.OE-100) from the MEF and mESC controls.

Taken together, these data suggest that iTSCs have restored key epigenetic landscape signatures of TSCs during the conversion process, as assessed by DNA methylation on specific loci and genome-wide H2A.X reorganization. iTSCs function similarly to blastocyst-derived TSCs

Cells acquiring a high degree of reprogramming state should exhibit all the functions of their corresponding cells as can be seen in the case of high quality iPSCs and ESCs. To test whether iTSCs are capable of executing the functions exerted by endogenous TSCs, the iTSCs were subjected to three gold-standard TSC tests.

Initially, iTSCs were assessed for multipotency and capability of differentiating into trophoblast lineages represented in the placenta. To this end, an iTSC clone, 4F- iTSC#5, was cultured on gelatin without Fgf4 and heparin for 10 days, a time period that allows proper differentiation in vitro (Figure 25 A). Notably, already two days following Fgf4 and heparin withdrawal, the iTSCs differentiated into giant multinucleated cells, associated with primary trophoblast cells (Figure 25 A, second image from the left). The presence of multinucleated cells and their growing number over the differentiation period was evident also when flow cytometry analysis was applied on these cells using propidium iodide (PI) for measuring DNA content (Figure 25B). In agreement with that, a gradual elevation in gene expression of the specific trophoblast giant cell markers Ctsq, Prl3bl and Prl2c2 was observed in two iTSC clones, 3F-iTSC#l and 4F-iTSC#5 and one blastocyst-derived TSC clone, TSC^blast#l, following differentiation (Figure 25C). Other trophoblast-lineage markers such as Tpbpa (specific for spongiotrophoblast cells) and Cga (specific for syncytiotrophoblast cells (Anson-Cartwright et al., 2000)) were elevated as well during differentiation. In contrast, undifferentiated TSC markers such as Bmp4, Cdx2 and Eomes were downregulated during differentiation (Figure 25C).

One of the roles of trophoblast giant cells is to invade the maternal blood vessels during the development of the placenta (Rossant and Cross, 2001). The formation of a transient hemorrhagic lesion under the skin of nude mice by transplanted blastocyst- derived TSCs is considered as one of the hallmarks of TSCs as it recapitulates the invading properties of the trophoblast giant cells (Kibschull et al., 2004). Similar to blastocyst-derived TSCs, when injected subcutaneously into nude mice, iTSCs formed lesions that reached their maximal size 5-8 days following injection, and thereafter began to resorb (Figure 26A). Some of the lesions were excised and analyzed by hematoxylin and eosin (H&E) staining. Pathology examination revealed a typical structure of trophoblastic hemorrhagic lesion with big blood-filled lacunas and differentiated trophoblastic giant cells (Figure 26B).

In the next step, the ability of the iTSCs to function properly in their native environment was evaluated. It has been shown that blastocyst-derived TSCs can contribute to the formation of the placenta when injected into the blastocyst or into an 8- cell stage embryo (Niwa et al., 2005; Tanaka et al., 1998). To assess the ability of the iTSCs to contribute to the formation of the placenta tdTomato-iTSCs (3F-iTSC^B6/R26_ ^tdTomato#4) were first injected into 8-cell stage embryo and the localization of the injected cells was followed at the blastocyst stage. Notably, the vast majority of the cells migrated toward the outer layer of the blastocyst in accordance with their role as extraembryonic cells (Figure 27). To accurately localize the cells inside the blastocyst one iTSC clone, 4F-iTSC#l, was infected with H2b-GFP lentiviral vector to better visualize the nuclei of the cells (Figure 28). Cells from 4F-iTSC^{H2b GFP}#l clone were injected into 8-cell stage embryos that were cultured until the blastocyst stage. The blastocysts were then fixed, stained for Cdx2 and Nanog and analyzed by confocal fluorescent microscopy. As can be seen in Figures 29A-B, the injected H2b-GFP iTSCs were negative for Nanog, positive for Cdx2 and localized to the extraembryonic region similarly to blastocyst-derived TSCs (Figures 29A-B). Importantly, many of the injected H2b-GFP-positive blastocyst-derived TSCs or iTSCs lose the expression of Cdx2 during blastocyst maturation (Figure 29B), proposing an explanation for the low contribution efficiency of blastocyst-derived TSCs to developing placenta seen, following blastocyst injection (Cambuli et al., 2014). Moreover, this observation suggests an active mechanism inside the blastocyst to shot off any cell that is wrongly localized in the blastocyst.

In the next step the ability of the iTSCs to chimerize developing placenta was evaluated. Careful examination of 13.5 days post coitum (dpc) placenta by fluorescent microscope revealed many structures with a high auto-fluorescence activity both in the green and red channels. To overcome this limitation, the H2b-GFP iTSC clones, 3F- iTSC^H2b~GFP#l and 4F-iTSC^H2b~GFP#5 were used, (Figure 29 A) because the nuclear GFP signal is unique and can be easily distinguished from the other structures of the placenta. This marked clone, 4F-iTSC^{H2b GFP}#5, was injected into blastocysts that were then transferred into pseudopregnant female. On 13.5 dpc the placenta and embryos were isolated and analyzed for H2b-GFP expression. A clear H2b-GFP signal was detected in some placentas (an average of 2 out of 15 examined placentas) in several patches within the placenta and was completely absent from the embryo (representative patch of nuclear-GFP cells is depicted in Figures 30A-D). To examine whether the cells differentiated into the trophoblast lineage the placenta was stained with a Tfap2c antibody. As can be seen in Figure 31, double-positive cells (i.e., cells that are positive for H2b-GFP (green) and Tfap2c (red) were detected in 13.5 placentas. Importantly, a comparable contribution was seen following the injection of a blastocyst-derived TSC line, _TSC^blast-^H2b-^GFP#l (data not shown).

Taken together, these data suggest that the iTSCs are fully functional cells that can recapitulate all the functions exerted by blastocyst-derived TSCs.

The conversion of fibroblasts into iTSCs does not go through a pluripotent state

It has been suggested that the short expression of pluripotent genes such as OSKM can induce a hyperdynamic chromatin state (Buganim et al., 2013) or a transient pluripotency phase (Bar-Nur et al., 2015) that can be utilized to force differentiation to various cell types such as cardiomyocytes and neuronal progenitors (Efe et al., 2011; Kim et al., 2011). As shown in Figures 2 and 32, ESCs and TSCs share the expression of several key genes (e.g. Sox2, Sall4, Utfl, Esrrb) and Gata3 was shown to induce pluripotency in other combinations of factors (Montserrat et al., 2013; Shu et al., 2013). Thus, the possibility that the conversion to iTSCs occurs via a pluripotent stage was examined. First, the present inventors tried to obtain iTSCs with ectopic expression of OSKM in cells that grew under culture conditions of TSCs. As a control, the cells were cultured also under mESC culture conditions. MEFs that harbor the Nanog-GFP and Oct4-GFP reporters were chosen as a starting population of cells because Nanog and Oct4 are expressed solely and specifically in pluripotent cells (Figure 15). Transduced MEFs were exposed to dox for 13 days after which it was removed for 6 days to allow proper stabilization of the core circuitry of the cells. As can be seen in Figure 33, only differentiated cells (mTSC medium) or stable iPSCs (mESC medium) that were also positive for the Nanog-GFP or Oct4-GFP reporters were detected in the dish of both culture conditions. The number of GFP-positive cells was significantly lower when the TSC culture conditions were used as compared to cells that grew under mESC culture conditions, suggesting that reprogramming with TSC culture conditions is suboptimal for acquiring a stable pluripotent state and that the acquisition of pluripotent state is not beneficial for the formation of iTSCs.

In the next step, the present inventors tried to obtain iPSCs by using the TSC reprogramming factors, GETM, instead of OSKM. The cells were cultured either under TSC culture conditions, or under mESC culture conditions (i.e. medium containing serum and LIF), or under optimal mESC culture conditions (i.e. medium containing LIF and 2i, GSK3P and Mek 1/2 inhibitors) to facilitate pluripotency. No stable iPSCs were attained in all examined conditions even when the cells were exposed to dox for a longer period of time (data not shown).

Following, the possibility that Nanog or Oct4 are activated during the reprogramming process to iTSCs was evaluated. The presence of Nanog-GFP or Oct4- GFP-positive cells during the reprogramming process might suggest that these cells acquire a short and transient pluripotent state. To this end, the above experiments were repeated, but this time the reprogrammable cells were analyzed every three days by flow cytometry. Figure 34 shows that GFP-positive cells were undetectable during the 12 days of the reprogramming process. Supporting that is the observation that even an early and robust marker for pluripotency such as Fbxol5 was not activated following GETM induction (Figure 35). In addition, iTSC colonies could be obtained when JAK inhibitor (JAKi), that blocks Stat3 phosphorylation, was added to the reprogramming medium (Figure 36) or even when Oct4 was looped out from the starting MEFs (i.e., Sox2-GFP MEFs harboring Oct4 lox/lox homozygous alleles, (Kehler et al., 2004)) using lentiviral vector encoding for Cre (Figure 37A-C). Furthermore, to rule out the possibility that GETM induces a hyperdynamic chromatin state or transient pluripotency phase similar to OSKM, the protocol by Efe et al., for inducing cardiomyocytes from fibroblasts (Efe et al., 2011), was effected. Notably, while a large number of cardiomyocyte colonies were obtained when OSKM was used as reprogramming factors, no cardiomyocyte colonies were detected while employing the GETM reprogramming factors even when the reprogramming factors were expressed for a longer period of time (i.e., 10 days instead of 6 days, (Figures 38A-B). Of note, the OSKM-derived cardiomyocyte colonies were positive to the cardiomyocyte marker Tnnt2 and approximately half of them were beating (Figures 38B-D).

Taken together, these results suggest that GETM reprogramming factor combination is specific for the trophectoderm lineage and that iTSC formation does not go through a pluripotency phase. EXAMPLE 4

ESTABLISHMENT OF A QUADRAPOLE FLUORESCENT KNOCK-IN REPORTER SYSTEM TO CAPTURE REPROGRAMMABLE CELLS EARLY ON IN THE CONVERSION INTO iPSCs AND iTSCs The lack of knowledge of the genes that can efficiently predict reprogrammable cells and the difficulty of capturing those cells early on in the process hamper our understanding of the basic criteria that must be fulfilled in a given cell that is destined to become converted. Therefore, generating a reliable reporter knock-in system is of paramount importance to detect and sort out this small fraction of cells and to monitor their transcriptional profile. To date, there are only very few reporter knock-in systems for studying reprogramming to pluripotency (such as Oct4, Sox2, Nanog and Fbxol5). These are either very late markers in the process (e.g. Oct4, Sox2 or Nanog) or do not efficiently predict reprogrammable cells (e.g. Fbxol5). Recently, the present inventors have demonstrated that expression of four genes (Zuo, B. et al (2012) Biol Open 1, 1118-1127) early on in the reprogramming process is highly correlated with successful conversion to iPSCs (Buganim, Y., et al. (2012) Cell 150, 1209-1222, Buganim, Y., et al. (2013) Nat Rev Genet 14, 427-439). To sort out only reprogrammable cells from the entire population of induced cells, the inventors sought to establish a reporter knock-in system that is marked by two early predictive markers (Utfl and Esrrb) of the reprogramming to pluripotency process and one late iPSCs marker (Nanog) (Buganim, Y., et al. (2012) Cell 150, 1209-1222, Buganim, Y., et al. (2013) Nat Rev Genet 14, 427-439). As Utfl and Esrrb are also expressed in TSCs ( Okuda, A., et al. (1998) The EMBO journal 17, 2019-2032; Luo, J., et al. (1997) Nature 388, 778-782), this system may be employed in the conversion model to iTSCs as well. To add a specific and late marker for iTSCs, the TSC marker, Elf5 was selected. To generate a dox-inducible system that is marked by four different fluorescent proteins, the mESC line KH2 was chosen as it contains the dox-inducible activator M2rtTA, in the Rosa26 locus and a flip-in system in the collagen (Collal) locus(Stadtfeld, M., et al. (2010) Nature 465, 175-181). The system was generated in ESC line as opposed to an established iPSC line in order to avoid commitment to the four "Yamanaka factors", and because the quality of the parental line is crucial for the success of the sequential targeting method. Reporter genes have been introduced into the 3'UTR of the targeted genes using the conventional homologous recombination technique with a targeting vector containing a self-cleaving 2A peptide to retain as much as possible the normal expression of the targeted alleles. 2A-like peptide sequences separate different protein coding sequences in a single ORF transcription unit. To increase targeting efficiency and to avoid the use of strong selection, the previously characterized CRISPR/Cas9 technique was utilized (for details about the technique see (Wang, H., et al. (2013) Cell 153, 910-918; Yang, H., et al. (2013) Cell) and positive cells were sorted out by FACS.

In general, the complete KH2 system contains one specific late reporter for iPSCs (Nanog-2A-EGFP), one specific late reporter for iTSCs (Elf5-2A-EYFP-NLS) and two early reporters for both iPSCs and iTSCs (Utfl-2A-tdTomato and Esrrb-2A- EBFP) (Figures 39). To corroborate the feasibility of the technique this method of sequential targeting in the KH2 line was established for three of the reporters (Nanog-2A- EGFP, Utfl-2A-tdTomato and Esrrb-2A-EBFP) Figures 40A-F). The engineered KH2 ESC line expresses the three reporters and gives rise to adult mice using the tetraploid complementation assay, indicating that the cells retained their high quality. Moreover, the expression of the three reporters is specific to the germ cells in the gonad, demonstrating the specificity of the reporters to pluripotent genes (Figure 40D). As a last step in the establishment of the reporter system the EYFP-NLS reporter is introduced into the Elf5 3'UTR locus.

To examine whether this system is indeed useful to study the conversion of fibroblasts into iTSCs as well, two engineered MEF systems containing knock-in fluorescent reporters (Nanog-2A-EGFP and Utfl-2A-tdTomato) or (Nanog-2A-EGFP and Esrrb-2A-EBFP) were infected with the 12 TSC dox-inducible key master regulators. As mentioned above (Figure 1), the cells were exposed to dox for 20 days to initiate the conversion process and then dox was removed from the medium. Ten days post dox withdrawal tdTomato or EBFP-positive iTSC colonies were observed in the dish (Figure 41). Importantly, while both Esrrb and Utfl were turned on relatively early in the process, suggesting that they can serve as early markers for the conversion model of iTSCs, Nanog remained off, indicating that the conversion to iTSCs does not go through the pluripotent state.

Generating secondary dox-inducible quadruple fluorescent knock-in reporter systems To complete the establishment of the described quadruple fluorescent knock-in reporter KH2 system, the EYFP-NLS reporter is introduced into the 3'UTR of the Elf5 locus. As this marker is not expressed in ESCs, the conventional homologous recombination technique with donor plasmid that contains neomycin resistance to select for targeted correctly clones is used, as opposed to the sorting approach that was used to introduce the other three reporters that are expressed in ESCs. To improve targeting efficiency, the CRISPR/Cas9 technique is employed. Correctly targeted KH2 clone that harbors all the four reporters is used to generate secondary inducible somatic cell systems.

The induction of iPSCs and iTSCs is based on de novo transduction of fibroblasts with viral constructs that results in genetically heterogeneous population of infected cells. To circumvent the genetic heterogeneity of "primary" virus-transduced fibroblasts, the previously characterized technique to generate clonal dox-inducible secondary somatic cell systems is employed(Wernig, M. et al. (2008) Nat Biotechnol 26, 916-924). Secondary inducible systems are somatic tissues that are composed of genetically homogeneous cells carrying identical dox-inducible proviral insertions known to achieve reprogramming in primary fibroblasts. The genetically engineered KH2 lines that harbor the four fluorescent proteins (Nanog-2A-EGFP/Utfl-2A- tdTomato/Esrrb-2A-EBFP/Elf5-2A-EYFP-NLS) are injected into blastocysts to generate chimeric embryos. At E13.5 embryos are sacrificed and MEFs carrying the M2rtTA activator are isolated following puromycin selection. The surviving MEFs are then infected with either dox-inducible single polycistronic lentiviral vector encoding for OSKM, (STEMCA), to generate iPSC colonies, or with a TSC-cocktail of transcription factors, to generate iTSCs. A single iPSC colony that expresses the three fluorescent reporters, Nanog-2A-EGFP/Utfl-2A-tdTomato/Esrrb-2A-EBFP and a single iTSC colony that expresses the three fluorescent reporters, Utfl-2A-tdTomato/Esrrb- 2A-EBFP/Elf5-2A-EYFP-NLS, are isolated and used to generate secondary systems. It has been shown that a single factor, Oct4, is sufficient to convert TSCs into iPSCs(21). This observation is exploited to generate secondary systems for the iTSC conversion model by initially producing iPSCs from the iTSCs that are then injected into blastocysts. An excisable retroviral construct encoding for Oct4 is used to convert the isolated iTSC colony into iPSCs. An iPSC colony that contains all the factors needed to convert fibroblasts into iTSCs, while the Oct4 virus is removed, and a single iPSC colony that contains the STEMCA polycistronic lentiviral construct is injected into blastocysts to produce secondary dox-inducible MEFs for both models of conversion (iPSCs and iTSCs). Secondary dox-inducible adult somatic tissues such as tail tip fibroblasts (TTFs) and Keratinocytes (Krts) are isolated as well from adult chimeric mice as described in (Wernig, M. et al. (2008) Nat Biotechnol 26, 916-924). These secondary inducible somatic cell systems are employed to sort out solely reprogrammable cells from different origins.

Testing the predictive capability of the early markers to capture reprogrammable cells

To examine the capability of the early reporters (Utfl-2A-tdTomato and Esrrb- 2A-EBFP) to detect cells that are destined to become iPSCs or iTSCs at early time points in the conversion process, the isolated secondary inducible MEFs, TTFs and Krts are exposed to dox to initiate the reprogramming process. Cells that are exposed to dox for six days (early time point) are collected and single cells are sorted based on the different combinations of reporters (i.e single-positive tdTomato cells, single-positive EBFP cells or double-positive tdTomato/EBFP cells). Single cells from each combination of reporters are plated into one 96-well plate (one single cell per well) that contains unmarked feeder cells (in total eighteen 96-well plates, i.e., three combination of reporters X three different cell types X two conversion models). These unmarked feeder cells are important for cell-cell interaction to enable proliferation of the individual single/double positive-cell. Two weeks after sorting, dox is removed from the medium for ten days and the eighteen 96-well plates are analysed by the Cytation™ 3 Cell Imaging Multi-Mode Reader system to examine whether the forming colonies could activate the late marker Nanog in the case of the iPSC model or Elf5 in the iTSC model of conversion (EGFP and EYFP-NLS respectively). The Cytation™ 3 is a cell imaging multi-mode microplate reader that combines automated digital microscopy and conventional microplate detection. Cytation™ 3 includes both high sensitivity filter- based detection and a flexible quadruple monochromator based system for unmatched versatility and performance. This experiment allows examining the predictive capability of the early reporter genes (Esrrb and Utfl) to enrich the reprogrammable cells population. The combination of reporters that exhibits the highest predictive capability (i.e., the highest number of single cells that could form iPSC or iTSC colonies and activated all three reporters) are utilized for the entire study. In accordance with the method of the invention it is possible to use either a quadruple fluorescent knock-in reporter system or the triple-positive system. In addition, analyzing these cells is instructive as sorting based on these reporters enrich the population of reprogrammable cells.

Monitoring the transcriptional profile of single cells undergoing conversion

Multiple complementary single-cell techniques are applied to segregate the real signals from the noise. The quadruple fluorescent knock-in reporter system described above is employed to capture the early rare reprogrammable cells. Multiple single-cell techniques (RNA-Seq, Fluidigm BioMark and sm-mRNA-FISH) are utilized to support the conclusions. Analyzing the transcriptome of a reprogrammable cell at the single-cell level, as opposed to population level, is crucial also in a system where reprogrammable cells are sorted out using fluorescent reporters because even in an enriched population there is a high variation in gene expression between individual cells (Buganim, Y., et al. (2012) Cell 150, 1209-1222). This cell-to-cell variation is the basis for identifying sub- populations with unique characteristics.

Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.

All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987) Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51, 987-1000

Xie, H., Ye, M., Feng, R., and Graf, T. (2004) Stepwise reprogramming of B cells into macrophages. Cell 117, 663-676

Takahashi, K., and Yamanaka, S. (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676

Gurdon, J. B., and Melton, D. A. (2008) Nuclear reprogramming in cells. Science 322, 1811-1815

Vierbuchen, T., Ostermeier, A., Pang, Z. P., Kokubu, Y., Sudhof, T. C, and Wernig, M. (2010) Direct conversion of fibroblasts to functional neurons by defined factors. Nature 463, 1035-1041

Ieda, M., Fu, J. D., Delgado-Olguin, P., Vedantham, V., Hayashi, Y., Bruneau, B. G., and Srivastava, D. (2010) Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142, 375-386

Huang, P., He, Z., Ji, S., Sun, H., Xiang, D., Liu, C, Hu, Y., Wang, X., and Hui, L. (2011) Induction of functional hepatocyte-like cells from mouse fibroblasts by defined factors. Nature 475, 386-389

Zhang, K., Liu, G. H., Yi, F., Montserrat, N., Hishida, T., Esteban, C. R., and Izpisua Belmonte, J. C. (2014) Direct conversion of human fibroblasts into retinal pigment epithelium-like cells by defined factors. Protein & cell

Boland, M. J., Hazen, J. L., Nazor, K. L., Rodriguez, A. R., Gifford, W., Martin, G., Kupriyanov, S., and Baldwin, K. K. (2009) Adult mice generated from induced pluripotent stem cells. Nature 461, 91-94

Pera, M. F. (2011) Stem cells: The dark side of induced pluripotency. Nature 471, 46-47

Bar-Nur, O., Russ, H. A., Efrat, S., and Benvenisty, N. (2011) Epigenetic memory and preferential lineage- specific differentiation in induced pluripotent stem cells derived from human pancreatic islet beta cells. Cell Stem Cell 9, 17- 23 Chin, M. H., Mason, M. J., Xie, W., Volinia, S., Singer, M., Peterson, C, Ambartsumyan, G., Aimiuwu, O., Richter, L., Zhang, J., Khvorostov, I., Ott, V., Grunstein, M., Lavon, N., Benvenisty, N., Croce, C. M., Clark, A. T., Baxter, T., Pyle, A. D., Teitell, M. A., Pelegrini, M., Plath, K., and Lowry, W. E. (2009) Induced pluripotent stem cells and embryonic stem cells are distinguished by gene expression signatures. Cell Stem Cell 5, 111-123

Lujan, E., Chanda, S., Ahlenius, H., Sudhof, T. C, and Wernig, M. (2012) Direct conversion of mouse fibroblasts to self-renewing, tripotent neural precursor cells. Proc Natl Acad Sci U SA 109, 2527-2532

Yu, B., He, Z. Y., You, P., Han, Q. W., Xiang, D., Chen, F., Wang, M. J., Liu, C. C, Lin, X. W., Borjigin, U., Zi, X. Y., Li, J. X., Zhu, H. Y., Li, W. L., Han, C. S., Wangensteen, K. J., Shi, Y., Hui, L. J., Wang, X., and Hu, Y. P. (2013) Reprogramming fibroblasts into bipotential hepatic stem cells by defined factors. Cell Stem Cell 13, 328-340

Chen, Y., Wang, K., Gong, Y. G., Khoo, S. K., and Leach, R. (2013) Roles of CDX2 and EOMES in human induced trophoblast progenitor cells. Biochemical and biophysical research communications 431, 197-202

Genbacev, O., Donne, M., Kapidzic, M., Gormley, M., Lamb, J., Gilmore, J., Larocque, N., Goldfien, G., Zdravkovic, T., McMaster, M. T., and Fisher, S. J. (2011) Establishment of human trophoblast progenitor cell lines from the chorion. Stem Cells 29, 1427-1436

Ezashi, T., Matsuyama, H., Telugu, B. P., and Roberts, R. M. (2011) Generation of colonies of induced trophoblast cells during standard reprogramming of porcine fibroblasts to induced pluripotent stem cells. Biology of reproduction 85, 779-787

Roberts, R. M., and Fisher, S. J. (2011) Trophoblast stem cells. Biology of reproduction 84, 412-421

Jauniaux, E., Poston, L., and Burton, G. J. (2006) Placental-related diseases of pregnancy: Involvement of oxidative stress and implications in human evolution. Human reproduction update 12, 747-755 James, J. L., Srinivasan, S., Alexander, M., and Chamley, L. W. (2014) Can we fix it? Evaluating the potential of placental stem cells for the treatment of pregnancy disorders. Placenta 35, 77-84

Wu, T., Wang, H., He, J., Kang, L., Jiang, Y., Liu, J., Zhang, Y., Kou, Z., Liu, L., Zhang, X., and Gao, S. (2011) Reprogramming of trophoblast stem cells into pluripotent stem cells by Oct4. Stem Cells 29, 755-763

Claims

WHAT IS CLAIMED IS:

1. A method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising expressing within the cell at least one exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c, under conditions which allow generation of an iTSC from said cell, thereby generating the iTSC from the cell, with the proviso that the method does not consist of expressing within said cell Eomes, Cdx2, Elf5, cMyc and Klf4.

2. A method of generating an induced trophoblast stem cell (iTSC) from a cell, the method comprising expressing within the cell exogenous Gata3, Eomes and Tfap2c transcription factors, under conditions which allow generation of an iTSC from said cell, thereby generating the iTSC from the cell.

3. The method of any one of claims 1-2, wherein said expressing comprises transiently expressing.

4. The method of any one of claims 1-3, comprising expressing within said cell an exogenous c-Myc transcription factor.

5. The method of any one of claims 1-4, comprising expressing within said cell at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf 5.

6. The method of any one of claims 1-5, wherein said conditions are such that expressing is for at least 10 days following introducing said exogenous transcription factor into said cell.

7. The method of any one of claims 1-5, wherein said conditions are such that expressing is for no more than 30 days following introducing said exogenous transcription factor into said cell.

8. The method of any one of claims 1-7, wherein said iTSC does not comprise said exogenous transcription factor as determined by PCR, western blot and/or flow cytometry.

9. The method of any of claims 1-8, wherein said expressing comprises introducing into said cell a polynucleotide encoding said transcription factor.

10. The method of claim 9, wherein said polynucleotide is a DNA.

11. The method of claim 9, wherein said polynucleotide is a RNA.

12. The method of any one of claims 1-11, comprising isolating said iTSC.

13. A nucleic acid construct or system comprising at least one polynucleotide comprising a nucleic acid sequence encoding at least two transcription factors selected from the group consisting of Gata3, Eomes and Tfap2c.

14. The nucleic acid construct or system of claim 13, wherein said at least one polynucleotide comprises a nucleic acid sequence encoding c-Myc transcription factor.

15. The nucleic acid construct or system of any one of claims 13-14, wherein said at least one polynucleotide comprises a nucleic acid sequence encoding at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf 5.

16. An isolated cell expressing at least two exogenous transcription factor selected from the group consisting of Gata3, Eomes and Tfap2c.

17. An isolated cell expressing exogenous Gata3, Eomes and Tfap2c transcription factors.

18. The isolated cell of any one of claims 16-17, further expressing an exogenous Myc transcription factor.

19. The isolated cell of any one of claims 16-18, further expressing at least one exogenous transcription factor selected from the group consisting of Tead4, Ets2, Cdx2 and Elf 5.

20. The isolated cell of any one of claims 16-19, wherein said cell comprises a DNA molecule encoding said at least one transcription factor.

21. The isolated cell of any one of claims 16-19, wherein said cell comprises a RNA molecule encoding said at least one transcription factor.

22. The isolated cell of any one of claims 16-19, wherein said cell comprises a protein molecule of said at least one transcription factor.

23. The method of any one of claims 1-12 or the isolated cell of any one of claims 16-22, wherein said expressing is not in the natural location and/or expression level of the native gene of said transcription factor.

24. The method of any one of claims 1, 3-12 and 23, wherein said at least one exogenous transcription factor comprises at least two exogenous transcription factors.

25. The method of any one of claims 1, 3-12 and 23, wherein said at least one exogenous transcription factor comprises Gata3, Eomes and Tfap2c.

26. The method or the isolated cell of any one of claims 1-12 and 16-25, wherein said cell is a human cell.

27. The method or the isolated cell of any one of claims 1-12 and 16-26, wherein said cell is a somatic cell.

28. An isolated induced trophoblast stem cell (iTSC) obtainable according to the method of any one of claims 1-12 and 23-27.

29. An isolated induced trophoblast stem cell (iTSC) maintaining differentiation level of a trophoblast stem cell for at least 20 passages in culture.

30. The isolated iTSC of claim 29 comprises an ectopic DNA of a transcription factor integrated in the genome.

31. The method or the isolated iTSC of any one of claims 1-12 and 23-30, wherein said iTSC is characterized by at least one of:

(xiv) TSC morphology;

(xv) TSC markers, as determined by an immunocytochemistry and/or PCR assay;

(xvi) absence of fibroblast specific markers, as determined by an immunocytochemistry and/or PCR assay;

(xvii) a transcriptome similar to a blastocyst-derived TSC, as determined by a RNA sequencing assay;

(xviii) genomic stability similar to a blastocyst-derived TSC, as determined by a whole genome sequencing;

(xix) a methylation pattern similar to a blastocyst-derived TSC, as determined by a bisulfate assay;

(xx) similar H2A.X deposition to a blastocyst-derived TSC, as determined by a chromatin immunoprecipitation (ChIP) assay;

(xxi) in-vitro differentiation following culture in a medium without Fgf4 and heparin, as determined by morphology, flow cytometry and/or PCR assay;

(xxii) in-vitro and/or in-vivo differentiation into derivatives of the trophectoderm lineage, as determined by morphology, immunocytochemistry, immunocytochemistry, flow cytometry and/or PCR assay; (xxiii) in-vivo formation of a trophoblastic hemorrhagic lesion, as determined by histological evaluation;

(xxiv) localization to the extraembryonic region of the blastocyst as determined by immunohistochemistry;

(xxv) localization to the placenta of the developing embryo as determined by immunohistochemistry; and

(xxvi) no change in differentiation level for at least 20 passages in culture as determined by at least of the assay in (i) - (xii).

32. The method or the isolated iTSC of claim 31, wherein said methylation pattern comprises hypomethylation of the Elf 5 promoter, hypomethylation of the Handl promoter and/or hypermethylation of the Nanog promoter as compared to a somatic cell and/or an ESC cell.

33. A cell culture comprising the isolated iTSC of any one of claims 28-32 and a culture medium.

34. A cell culture comprising the isolated cell of any one of claims 16-23 and 26-27 and a culture medium.

35. The cell culture of any one of claims 33-34, wherein said culture medium comprises FGF4 and heparin.

36. The iTSC of any one of claims 28-32 being a cell line.

37. A cell line of the isolated cell of any one of claims 16-22 and 26-27.

38. A pharmaceutical composition comprising the iTSC of any one of claims 28-32 and 36 and a pharmaceutically acceptable carrier or diluent.

39. An isolated placenta or a blastocyst comprising the iTSC of any one of claims 28-32 and 36 or the construct of any one of claims 13-15.

40. A method of augmenting a placenta or a blastocyts comprising introducing into a placenta or a developing embryo the iTSC of any one of claims 28-32 and 36 or the construct of any one of claims 13-15.

41. A method of treating and/or preventing a disorder associated with development and/or activity of trophoblasts in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of the iTSC of any one of claims 28-32 and 36, the pharmaceutical composition of claim 38, or the construct of any one of claims 13-15, thereby treating and/or preventing the disorder associated with development and/or activity of trophoblasts in the subject.

42. A method of identifying an agent capable of modulating trophoblast development and/or activity, the method comprising:

(i) contacting the isolated iTSC of any one of claims 28-32 and 36 or the isolated placenta of claim 39 with a candidate agent; and

(ii) comparing development and/or activity of said isolated iTSC or said isolated placenta following said contacting with said agent to development and/or activity of said isolated iTSC or said isolated placenta without said agent,

43. A method of obtaining a compound produced by a trophoblast, the method comprising culturing the isolated iTSC of any one of claims 28 and 36 or the cell culture of claim 33 and isolating from the culture medium a compound secreted by the cells, thereby obtaining the compound produced by the trophoblast.

44. A method of discovering a gene which can generate an induced trophoblast stem cell (iTSC), the method comprising:

(a) introducing a candidate gene into a cell; and (b) selecting a cell that exhibits TSC morphology and/or TSC marker as determined by an immunocytochemistry and/or PCR assay and acquire a stable state in the absence of expression of said gene.

45. A nucleic acid construct or system comprising at least one polynucleotide comprising:

(iii) a nucleic acid sequence encoding a third reporter polypeptide and a regulatory element for directing expression of said third reporter polypeptide, said regulatory element being under the control of a late predictive marker of an iTSC or iPSC,

wherein said first reporter polypeptide, said second reporter polypeptide and said third reporter polypeptide are distinguishable.

An isolated cell comprising the construct of claim 45.

A transgenic animal comprising the cell of claim 46.

48. A method of identifying a reprogrammable iTSC or iPSC, the method comprising:

(i) obtaining the cell of claim 46 or a cell isolated from the transgenic animal of claim 47; and