Anmelden

Google

Google Instant ist derzeit nicht verfügbar. Drücke die Eingabetaste, um die Suche zu starten. Weitere Informationen
Google Instant ist aufgrund zu geringer Verbindungsgeschwindigkeit deaktiviert. Drücke zum Suchen die Eingabetaste.
Zum Start der Suche Eingabetaste drücken
Unangemessene Vervollständigungen melden
Alle
Videos
Bilder
Bücher
News
Mehr
MapsShoppingFlügeFinanzen
Einstellungen
SucheinstellungenSprachen (Languages)
SafeSearch aktivieren
Erweiterte SucheProtokollHilfe zur Suche
Tools
    Ungefähr 205.000 Ergebnisse (0,32 Sekunden) 
    Tipp: Begrenze die Suche auf deutschsprachige Ergebnisse. Du kannst deine Suchsprache in den Einstellungen ändern.

     
     

    Suchergebnisse

    [PDF]Die Programmiersprache Perl - CPAN

    www.cpan.org/authors/id/E/EI/EIKEG/doc/perl-tutorial-DE_2.02.pdf
    1. Im Cache
    2. Ähnliche Seiten
    WWW-Adresse: http://perl-seiten.homepage.t-online.de/1. Version: 2.02 (30.5.2005). Download. Sowohl eine archivierte Version der HTML-Seiten als auch die PDF-Variante stehen auf den CPAN-Servern zum Herunterladen bereit: PDF-Dokument: perl-tutorial-DE 2.02.pdf. HTML (tar/gzip-Archiv): perl-tutorial-DE 2.02.tar.gz.

    [PDF]Download Perl Tutorial (PDF Version) - TutorialsPoint

    https://www.tutorialspoint.com/perl/perl_tutorial.pdf
    1. Ähnliche Seiten
    Perl i. About the Tutorial. Perl is a programming language developed by Larry Wall, especially designed for text processing. It stands for Practical Extraction and Report Language. It runs on a variety of platforms, such as Windows, Mac OS, and the various versions of UNIX. This tutorial provides a complete understanding on ...

    [PDF]Perl 5 Tutorial, First Edition - Chan Bernard Ki Hong

    www.cbkihong.com/download/perltut.pdf
    1. Ähnliche Seiten
    Preface. If you are looking for a free Perl tutorial that is packed with everything you need to know to get started on Perl programming, look no further. Presenting before you is probably the most comprehensive Perl tutorial on the Web, the product of two years of diligence seeking reference from related books and Web sites.

    [PDF]Perl Tutorial - ke.tu-darmstadt.de

    https://www.ke.tu-darmstadt.de/lehre/archiv/.../perl-tutorial.pdf
    1. Im Cache
    2. Ähnliche Seiten
    Diese Seite übersetzen
    Perl is. – Pathologically Eclectic Rubbish Lister. – the duct tape of the internet. – the Swiss-army chain saw of UNIX. • good at. – text processing. – rapid development. – flexibility. – operating system stuff. • in particular UNIX/LINUX. – code re-use. • CPAN:large repository of re-usable modules. • bad at. – numeric processing.

    [PDF]Débuter en Perl

    www.info.univ-angers.fr/~gh/tuteurs/coursperl.pdf
    1. Im Cache
    2. Ähnliche Seiten
    Diese Seite übersetzen
    von F Dagorn - ‎2000 - ‎Ähnliche Artikel
    06.06.2000 - Perl est un langage interprété et les programmes Perl se diffusent en format source. Le terme interprété est toutefois ambigu car un programme Perl s'exécute en deux phases : la pré-compilation du programme qui produit du pseudo-code, puis l'interprétation du pseudo-code (l'exécution proprement dite).

    [PDF]Object-Oriented Perl

    blob.perl.org/books/beginning-perl/3145_Chap11.pdf
    1. Ähnliche Seiten
    Diese Seite übersetzen
    Object-Oriented Perl. As we've mentioned before, there are several schools of thought in programming. One in particular has gained a lot of popularity over the past five or ten years – it's called object-oriented programming, or. OOP for short. The type of programming we've been doing so far has been based around tasks –.

    [PDF]Perl - Institute of Bioinformatics

    www.bioinf.jku.at/teaching/current/ws.../Perl-Tutorial.pdf
    1. Im Cache
    Diese Seite übersetzen
    Institute of Bioinformatics. Johannes Kepler University Linz. Perl. Perl: A Short Introduction for Biological Chemists ... Perl is an interpreted (scripting) language. Perl is (almost) platform-independent. Perl is free of charge. Perl is a common standard in bioinformatics, language pro- ... http://perldoc.perl.org/index-tutorials.html.

    [PDF]Perl tutorial

    hpc.ilri.cgiar.org/beca/training/...2/Oct_2013/perl_tutorial.pdf
    1. Im Cache
    2. Ähnliche Seiten
    Diese Seite übersetzen
    Perl tutorial. Working with DNA Sequences. #!/usr/bin/perl -w. # Storing DNA in a variable, and printing it out. # First we store the DNA in a variable called $DNA. $DNA = 'ACGGGAGGACGGGAAAATTACTACGGCATTAGC';. # Next, we print the DNA onto the screen print $DNA;. # Finally, we'll specifically tell the program to ...

    [PDF]Learning Perl Through Examples Part I - Boston University

    https://www.bu.edu/tech/files/.../PerlThruExample1_slideOnly.pd...
    1. Im Cache
    Diese Seite übersetzen
    21.02.2017 - Spring 2017. Tutorial Resource. Before we start, please take a note - all the codes and supporting documents are accessible through: • http://rcs.bu.edu/examples/perl/tutorials/ www.perl.org. Yun Shen, Programmer Analyst yshen16@bu.edu. IS&T Research Computing Services ...

    [PDF]Perl Tutorial Download - Hypernode

    ivan.hypernode.com/perl-tutorial-pdf.pdf
    1. Im Cache
    Diese Seite übersetzen
    PERL TUTORIAL Download ma, 01 jan 2018 12:21:00 GMT perl tutorial pdf - Perl 2 Perl is a general-purpose programming language originally developed for text manipulation and now used for a wide range of tasks including system ... ma, 01 jan 2018 23:26:00 GMT Download Perl Tutorial (PDF Version ...

    Ähnliche Suchanfragen zu perl tutorial filetype:pdf

    perl programmierung beispiele

    perl programmieren lernen

    perl wiki

    perl programming

    perl download

    python lernen

    12345678910Weiter
    Frankreich
     - Weitere Informationen
    HilfeFeedback gebenDatenschutzerklärungNutzungsbedingungen
    • Mein Konto
    • Suche
    • Maps
    • YouTube
    • Play
    • Gmail
    • Drive
    • Kalender
    • Google+
    • Übersetzer
    • Fotos
    Mehr
    • Shopping
    • Docs
    • Books
    • Blogger
    • Kontakte
    • Hangouts
    • Notizen
    Noch mehr von Google